Leucine supplementation during late gestation globally altered placental metabolism and nutrient transport via modulation of the PI3K/AKT/mTOR signalling pathway

doi:10.21203/rs.3.rs-695499/v1

Background

Our previous study found that sow dietary leucine supplementation signicicantly improved fetal intrauterine growth and newborn piglet birth weight. But we still have limited knowledge how leucine regulated placental functions to promote the nutrient supply to fetus to support its intrauterine development.

Methods

150 sows at day 90 of gestiation were divided into three groups and fed with either control diet (CON), CON + 0.4% Leu or CON + 0.8% Leu separately until parturition. Placental metabolomics, full spectrum amino acids and nutrient transporters were systematically analyzed.

Results

Leu supplementation lead to an altered placental metabolism with higher amount of metabolites related to glycolysis and fatty acids oxidatation, and more amino acids accumulation in placenta. Besides, nutrient transporters including amino acids transporters, glucose transporters and fatty acids transporters in placenta were globally enhanced and several enzymes related to energy metabolism including hexokinase, succinatede hydrogenase, lactated hydrogenase, glycogen phosphorylase and hydroxyaryl-CoA-dehydrogenase were significantly increased with no change in antioxidative status in the groups with Leu supplementation. Futhermore, Leu supplementation significantly increased phosphalation of PI3K, Akt, and mTOR in placenta compared with control group.

Conclusions

Leu supplementation during late gestation globally altered placental metabolism, nutrient transport (amino acids, glucose, and fatty acids) via modulation of the PI3K/Akt/mTOR signalling pathway.

Animal Science

Biotechnology and Bioengineering

Agricultural Engineering

leucine

placenta

PI3K/AKT/mTOR signalling pathway

nutrient transporters

energy metabolism

Placenta, an extremely critical organ that connects mother and fetus during pregnancy, performs a variety of functions including nutrients supplying (e.g., amino acids, oxygen and water) from mother to fetus, as well as metabolites (e.g., ammonia and CO₂) removing from fetus to mother throughout the pregnant process to keep the fetus alive and development [1–3]. Besides, placenta also plays crucial roles in biosynthesis and metabolism of steroids to modulate both maternal and fetal physiology and metabolism[4, 5].

In mammals, foetal intrauterine development and maturity primarily depends on the performance of placenta [6]. Previous investigation clearly proved that insufficiency of placenta function could result in intrauterine growth restriction in varieties of animals. In sows, inadequate placental capacity limits optimal fetal development since day 25 of gestation and continue to the farrowing [7]. This problem is more severe in modern industry due to that much higher prolific breeds with more than 15 fetuses per sow were widely used in these days than 30 years ago [8, 9].

Maternal diet has been shown to strongly influence the placental development, nutrient transport capacity and metabolism, with subsequent effects on fetal growth and health during pregnancy [10]. Leucine (Leu), an essential amino acid for protein synthesis, has been reported to regulate several cellular processes such as protein synthesis, tissue regeneration, and metabolism [11]. Our previous studied found that Leu supplementation in sow diet during late pregnancy (day 70–110) significantly increased fetal birth weight and decreased the occurrence of intrauterine growth restriction by improving fetal protein synthesis, but we still have limited knowledge how Leu exert its effect through placenta to regulate fetal development.

Considering that fetal growth is primarily determined by nutrient availability, which is intimately related to placental nutrient transport [12, 13], we hypothesize the changes in placenta caused by dietary Leu supplementation might be the main contribution to the improved nutrient supplying from maternal to fetus and then effect on fetal development. Nutrients in maternal circulation were accumulated in placenta via specific transporters and then some of them are metabolized within placenta to supply energy for organ development and maintenance or converted to other active substance which could regulate placental function within placenta or further transported to fetal circulation. Another part of nutrients is directly transported through placenta into fetal circulation to participate fetal development during pregnancy. Thus, in present study we determined the placental metabolics, gene expression of global nutrient transporters and energy metabolism related enzymes to systematically investigate the impact of maternal Leu supplementation on placenta function with the purpose to reveal the underlying mechanism of improved fetal growth induced by maternal dietary Leu supplementation during late pregnancy.

Animals, experimental diets, and sample collection

All the animal procedures uesd during this experiment were approved by the South China Agricultural University Animal Care and Use Committee. 150 healthy sows (Landrace × Large White, average weight =260 kg) were assigned to one of three treatments with 50 replications in each group according to the principle of parity (4-5), similar weight, istorical reproductive performance and body condition. The basal experimental diets were formulated to meet the nutrient requirements of swine (NRC 2012). The composition and nutrient content of treatment diets are presented in Table 1, 2. Three treatments are listed as follows: (1) corn and soybean basal diets (CON); (2) CON + 0.40% Leu; (3) CON + 0.80% Leu. Leu (purity ≥ 98.5%) was obtained from Jizhou Huayang Chemical Co. Ltd. (Jizhou, China). During experiment, the sows were fed twice a day (7:00 and 14:00) and could drink water freely. During sow delivery, the placenta excreted was collected in time after 75% alcohol was used for surface disinfection. About 100 g placenta samples were obtained from areas rich in blood vessels each sow. The samples were cut into pieces, sub-packaged and stored in liquid nitrogen until analysis. Blood samples were collected aseptically in tubes from the jugular vein and kept at 37°C for 1 h and then centrifuged at 3,000 g at 4 °C for 15 min.The serum was separated and stored at –80°C until analysis.

Placental metabolomics analysis

After pretreatment of placental samples, the samples were subjected to HPLC- MS/MS (Ultimate 3000 - API, 3200 Q TRAP) for detection in positive ion modes. 100 μL serum was added into 400 μL methanol and acetonitrile solution (1:1), and the mixture was centrifuged at 13,200 g at 4 °C for 12 min after vortexing for 30 s. The supernatant was filtered using an Oasis PRiME HLB SPE (30 mg, 1 mL; Waters, Millford, MA, USA) and transferred into a fresh tube. The extract was dried in a vacuum concentrator, the dried metabolite for resolution was added 100 μl acetonitrile and water (1∶1). Vortex for 30 s, ice water bath ultrasound for 10 min, the samples were centrifuged at 4 ℃ for 13,200 g for 10 min. 50 μL supernatant was taken out into injection flask for LC-MS detection.The serum was analyzed using an MSLab 45+AA-C18 C18 (15μm, 50× 4.6mm) column at 35 °C, the flow rate at 0.35 mL min⁻¹ and the injection volume at 2.0 μL.The adduct was set to M+Na, M+H, M+K, 2M+Na, 2M+H, 2M+K, M+H-H2O, and the molecular weight tolerance was set to 20 ppm. The mobile phase was consisted of water (A) and 0.10% formic acid in acetonitrile (B). The MS parameters were as follows: onspray voltage = 3500 V, Ion Source Gas1 = 40 psi, Ion Source Gas2 = 80 psi and source temperature = 650 °C. The Human Metabolome Database and the Metlin database were used to identify the qualitative differential metabolites.

Serum full spectrum amino acids analysis

50 μL serum sample was placed in a 1.5 mL EP tube and added 50 μL mixed amino acid standard substance and 50 μL protein precipitator (containing NVL). The mixture was mixed for 30 s and centrifuged 13,200 g at 4°C for 4 minutes. 10 μL supernatant was obtained and added 50 μL marked buffering solution (containing 20 μmol /L orthovalic acid) and 20 μL derivatization reagent, then incubated at 55°C for 15min. Concentrations of serum free amino acids were determined using HPLC- MS/MS (Ultimate3000 – API, 3200 Q TRAP). MSLab 45+AA-C18 (15μm, 50× 4.6mm) was used for separation and 5 μl of the sample was injected onto the column. The column temperature was set at 50 ◦C. Mobile phase A was 0.1% formic acid in water and mobile phase B was 0.1% formic acid in acetonitrile at a flow rate of 1 mL/min. The LC gradient condition was 0-2 min of mobile phase B at 10%, 3 min at 70%, 4-5 min at 100%, 6-7 min at 10%. After HPLC analysis, the mass spectrometer was used to analyze. The mainly operating parameters were as follows: ion source = +ESI, scan mode = MRM, curtain gas = 20 psi, collision gas = medium, ion spray = +5500 V, ion source temperature = 500 °C, nebulizing gas = 55 psi, drying gas = 60 psi and entrance potential = 10 V[14].

Real-time PCR

The total RNA was isolated from placenta tissues using the RNA extraction kit (LS040, Promega, Shanghai, China) followed the manufacturer’s instruction. The RNA purity and concentration were checked by electrophoresis on 1.0% agarose gel (130 V, 18 min) . The purity of RNA (A260/A280) for all RNA samples were greater than 1.8 by using a spectrophotometer. The cDNA synthesis was performed from the RNA reverse transcription reaction using the PrimeScript First Strand cDNA Synthesis Kit (RR047A, Takara, Dalian, China) according to the manufacturer’s protocol. Real time quantitative PCR was carried out on an ABI Prism 7500 sequence detection system (Applied Biosystems, Carlsbad, CA, USA) consisting of 20 μL reaction volume. The PCR reaction protocol was consisted of Initial denaturation one cycle at 94 ◦C for 1 min, amplification forty cycles at 94 ◦C for 30 s , 60 ◦C for 30 s and 72 ◦C for 20 s and melting one cycle at 95 ◦C for 60 s, 60 ◦C for 15 s and 72 ◦C for 30 s. The primers used as shown in Table 3.

Western blot

Protein was extracted from placente tissue frozen in liquid nitrogen and cleaved by adding a mixture of RIPA lysis buffer (Beyotime, Shanghai, China) and the protease inhibitor PMSF (Beyotime, Shanghai, China). The protein concentration from the supernatant was determined by a BCA Protein Assay Kit (P0010, Beyotime, Jiangsu, China) after the supernatant was separated using the centrifuge.The equal amount of protein (30 μg) was separated on 8-12% SDS-PAGE gels, and then electrically transferred to polyvinylidene difluoride (PVDF) membranes.The PVDF membranes were washed 5 times for 5 min with TBST after blocking 5% skimmed milk powder at room temperature for 1h. Then the PVDF membranes were incubated with the different primary antibody [mTOR (2983S, Cell Signaling Technology, USA), p-mTOR (5536S, Cell Signaling Technology, USA), PI3K (4249S, Cell Signaling Technology, USA), p-PI3K (17366S, Cell Signaling Technology, USA), Akt (4685S, Cell Signaling Technology, USA), P-Akt (9271S, Cell Signaling Technology, USA) and β-actin (bs-0061R, Bioss, China)] at 4 degrees for 12h. Repeat the steps of washing with TBST, the PVDF membranes were incubated with corresponding secondary antibodies (511203, ZenBio, China) for 1h at room temperature,followed by testing the target Protein bands using an enhanced chemiluminescence kit (P1020, Applygen, Beijing, China) with the ImageQuant LAS 4000 mini system.

Antioxidant status

The antioxidant status of serum,including glutathione peroxidase (GSH-PX), glutahione transferase (GSH-Tr), superoxide dismutase (SOD), catalase (CAT) and malonaldehvde (MDA) were tested by commercially available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Energy metabolism related enzyme activities

About 30 mg placenta was taken and homogenized in phosphate buffer (1 : 40; EDTA-Na 2 mmol/L, glucose 5 mmol/L, mercaptoethano 5l mmol/L in potassium phosphate buffer 100mmol/L; pH 7.2). All operations were done in an ice bath. The homogenate was centrifuged at 2,000 g in a refrigerated centrifuge for 10 min. The supernatants were collected for determination of the enzyme activities of hexokinase, succinatede hydrogenase, lactated hydrogenase, glycogen phosphorylase and hydroxyaryl-CoA-dehydrogenase using commercial kits according to manuals. All enzyme activities were expressed as units per gram of protein (U/g Protein).

Data Analysis

SIMCAP software (Version 14.0, Umetrics, Umeå, Sweden) was used for data modeling and analysis of placental metabolomics and full spectrum of amino acids. Data were mean-centered using Pareto scaling and models were built on partial least-square discriminant analysis (PLS-DA). PLS-DA allowed the determination of discriminating metabolites using the variable importance on projection (VIP). The VIP score indicates the contribution of a variable to the discrimination between all the classes of samples and the VIP values over 1are considered as significant. The P value was calculated by one-way analysis of variance (ANOVA) using SPSS 22.0 software (IBM Inc., United Staes). Metabolites with VIP values more than 1.0 and P value less than 0.05 were statistically significant. The data of PCR, western blot, antioxidant status and energy metabolism related enzyme activities were analyzed with one way ANOVA followed the procedure using SPSS 22.0 software. P less than 0.10 was considered as an upward or downward trend and P less than 0.05 was considered as the judgment criterion for the significance of difference.

Metabolite profiling

To assess the effects of Leu in metabolic pathways of the placenta, we performed an untargeted metabolomic analysis using a panel of LC-MS protocols. Totally 40 differential metabolites were identified between control group and the groups with 0.4% Leu, 46 differential metabolites between control group and groups with 0.8% and 35 differential metabolites between groups with 0.4% and 0.8% Leu. Totally 25 common differential metabolites were found among these three groups. PLS-DA of placental metabolites showed a clear separation among the sows from control group, control + 0.4% Leu, and control + 0.8% Leu (Figure 1A, 1B, 1C and 1D). Figure 1E illustrates the identified common differential metabolites with more than 2 folds change and further Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis indicated 9 pathways including fatty acid metabolism; alanine(Ala), aspartate, and glutamate metabolism; glycolysis/gluconeogenesis; valine (Val), Leu, and isoleucine (Ile) degradation; ABC transporters; cell cycle; regulation of lipolysis in adipocytes; apoptosis; and one carbon pool by folate, were involved in the regulation of Leu in placenta. Figure 1F summarized the 25 common differential metabolites among three groups with VIP scores higer than 1. The groups added with Leu were significantly decreased in metabolites of palmitic acid, 13S- hydroxy- octadedienoic acid and 9S- hydroxy- octadedienoic acid tcompared with control group. On contrast, prostaglandins (PGs), polyamines, putrescine, spermidine and spermine were increased from the groups fed with 0.4% and 0.8% Leu.

Full spectrum of amino acids in placenta

Amino acids accumulated in placenta is the main supply of amino acid for fetal intrauterine growth during pregnancy. LC-MS were used to evaluate the effect of Leu on full spectrum of amino acids in placenta and PLS-DA analysis showed a clear separation among the sows from control group, control + 0.4% Leu, and control + 0.8% Leu (Figure 2A, 2B, 2C and 2D). Figure 2E illustrates the identified common differential amino acids between three groups. Sow dietary Leu supplementation improved 24 amino acids accumulation in placenta: Leu, Val, Ile, glutamine (Gln), glutamic acid (Glu), aspartic acid (Asp), Ala, arginine (Arg), glycine (Gly), taurine (Tau), lysine (Lys), serine (Ser), histidine (His), proline (Pro), cysteine (Cys), phenylalanine (Phe), methionine (Met), aminoadipic acid (Aad), phosphoserine (PSer), N-histidine (NHis), citrulline (Cit), hydroxyproline (HPro), tryptophan (Trp) and homoarginine (Harg) (VIP scores > 1). The VIP scores of Leu, Val, Ile, Glu and Gln were highest among all the amino acid.

Gene expression of amino acids, fatty acids and glucose transporters in placenta

Placenta plays an important role in nutrient transport from maternal to fetus during pregnancy, which process are mainly regulated by specific amino acids transporters, fatty acids transporters and glucose transporters located on placenta. Figure 3A, 3B and 3C shows the gene expression of main nutrient transporters in pig placenta and we found that most of amino acid transporters (Figure 3A) were upregulated with the supplementation of Leu including SLC7A1, SLC7A2, SLC7A8, SLC7A11, SLC15A1, SNAT1, LAT1, 4F2hc and rBAT. The gene expression of glucose transporters (Figure 3B) including SLC2A1, SLC2A2, SLC2A3 and SLC2A6 were also increased in the placenta from the sows fed with 0.4% and 0.8% Leu, but SLC2A5 and SLC2A8 were changed unapparently.We interestingly found that fatty acid transporters (Figure 3C) were differentially regulated by Leu in present study. The expression of the genes involved in fatty acid cross-membrane transport were increased with Leu supplementation,including FATP1, FATP2, FATP3, FATP4, CD36, FABP3, FABP5 and FABP7, but the expression of those genes related to intracellular transport showed no significant change.

Enzymes related to energy metabolism in placenta

The expression of enzymes activities are shown in Figure 4. Compared with the control group, hexokinase, glycogen phosphorylase, lactated hydrogenase,hydroxyaccyl-CoA-dehydrogenas and succinatede hydrogenase was expressed at a significantly higher level in 0.4 % and 0.8 % Leu group.

Protein expression of mTOR signal pathway

Western Blot were used to detect the expression of proteins related to mTOR signal pathway and the results indicates that the ratio of T-PI3K/P-PI3K, T-Akt/P-Akt and T-mTOR/P-mTOR were up-regulated with the supplementation of Leu.The phosphorylation of PI3K and Akt were significantly higher in the 0.8 % Leu groups than in the 0.4 % Leu groups (Figure 5).

Oxidative indices

No significant differences in blood oxidative status including GSH-PX, GSH-Tr, SOD, CAT and MDA were observed in different sows fed with either control diet or supplemented with 0.4% and 0.8% Leu in present study ( P ＞ 0.05 , Figure 6).

Placenta, a crucial organ linking maternal and fetal for nutrients and waste exchange, undergoes extensive metabolism for its development and function during pregnancy. The interaction between nutrients transport and metabolism within placenta is directly related to the nutrient supply from maternal to fetal to regulate fetal development. To our knowledge, this is the first study providing preliminary data on the influence of maternal nutrition to a broad range of metabolites and global nutrients transporter in placenta in mammals. Important differences in metabolism and transport of lipids, glucose and amino acids were observed in placentas from those sows fed with Leu during late pregnancy.

Amino acids transport and metabolism

The quality and relative composition of amino acids delivered to fetus through placenta is directly related to fetal growth during pregnancy due to the importance of amino acids as basic substance for protein synthesis[15]. In present study, amino acids full spectrum analyses indicates that sow dietary Leu supplementation widely improved amino acids accumulation within placenta, which implying more amino acids supply to fetuses. In porcine placenta, branch chain amino acids (BCAAs), including Leu, Val, Ile, could be degraded to donate their amino groups to synthesize Gln, which is important precursor for protein, purine and pyrimidines synthesis to supply to fetuses[16-18]. In addition, Gln also could be used in the fetus to produce Glu, Asp, and Ala [19, 20]. Thus, Gln accumulated in the placenta either from maternal circulation or placental synthesis, serves as a major nitrogen supply for fetus. Further study found that the amount of Gln in placenta were increased with higher dietary intake of BCAAs during pregnancy [21]. In our present study, we also found that the amount of Gln was significantly increased more than 2 folds in placentas from the sows fed with 0.4% Leu compared with control group. In porcine placenta, those amino acids including Glu, Gln, Ile, Val and Leu showed the highest amount among all amino acids and their accumulation play important role for both placental and fetal development [22]. In the present study, we interestingly found that Leu, Val, Ile, and Glu were enhanced with the addition of Lue and showed the highest VIP scores among all differential amimo acids, which might be growth stimulator for improved fetal development during pregnancy [23].

Amino acids from maternal circulation are accumulated within the placenta by active transport systems for further transportation or metabolism[24, 25]. Amino acids transport cross placenta are also important determinants of the amino acid composition in the fetal circulation [26] and impaired amino acid transport could lead to placental metabolic disorder and restricted fetal growth [27,28, 29] . In present study, we determined the gene expression of global amino acids transporters in placenta and found that most of transporters were significantly upregulated with the supplementation of Leu. Tau, an essential nutrient in fetal development, need to be mainly supplied by maternal via placenta due to inadequate synthesis from placenta and fetus [30]. Reduced activity of a placental Tau transporter were related with fetal intrauterine growth restriction and impaired placental function [31, 32]. In the present study, the increased level of Tau in placenta from the sows fed with Leu might attribute to elevated transporters expression in those placentas. In addition, Arg could not be metabolized in porcine placenta because of the lack of arginase [33, 34]. The increased Arg within placenta with Lue supplementation might also attribute to the elevated transporters and would be further transported across placenta to promote Arg supply from maternal to fetus.

Metabolotic anysis indicated that amino acid metabolism related to polyamines in placenta were significantly altered by supplementation of Leu in sow diets. Polyamines, which plays essential roles for DNA and protein synthesis in animal cells, are key regulator of placental growth and mammalian embryo early development [29]. Porcine placenta could convert Pro to polyamines by providing the bulk of the carbon skeleton and nitrogen in putrescine, spermidine, and spermine [33]. In the present study, several metobolities related to polyamines including putrescine, spermidine and spermine were up-regulated in the placenta from those sows fed with Leu. In addition, we found the placental glutathione were greatly increased in treatment sow. Glutathione, synthesized in placenta from glutamate, Gly and Cys, are transported to fetus to provide antioxidative protect during development [35]. The enhanced glutathione in placenta has a potential to improve fetal growth during pregnancy.

Fatty acids metabolism and transport

Essential fatty acids and their long-chain polyunsaturated fatty acids play crucial roles for fetal intrauterine development due to their contribution in formation and dynamic properties of biological membranes during pregnancy [36-39]. In placenta, most of fatty acids require facilitated transport by several plasma membrane-located transport/binding proteins such as fatty acid translocase (FAT/CD36), plasma membrane fatty acid binding protein (FABPpm), fatty acid transport protein (FATP 1-6) and intracellular fatty acid binding protein 1-9 (FABP 1-9) [40]. The family of FATPS and FAT/CD36 have been demonstrated to mediate cellular uptake of long-chain and very long chain fatty acids to facilitate fatty acid influx across biological membranes [41]. Previous studied reported that increased expression of CD36 and FATP4 were certainly associated with higher fatty acids uptake in placenta[42, 43]. In present study, the mRNA expression of CD36, FATP1 and FATP2 were significantly enhanced in the placenta from the sows fed with Leu, implying more fatty acid influx from maternal circulation to fetus. Polyunsaturated fatty acids (PUFAs) are essential for fetal development because they are the precursors of eicosanoids and also are essential constituents of the membrane lipids that maintain cellular and organelle integrity [37, 44]. During pregnancy, intrauterine transfer from maternal across placenta is the only supply of PUFAs to the fetus [45]. We found that Leu supplementation resulted in placental higher levels several essential fatty acids (EFA) and their derivatives including arachidonoc, decosahexaenoic acid, and cholesterol in present study, which might be the results of increased gene expression of CD36 and FATP family.

After inside the placenta, fatty acids could be directly transported into the fetal circulation or bound to FABPs to participate in cellular metabolism within placenta [46]. Selective cellular metabolism of certain fatty acids in placenta could contribute to new synthesized lipid supplying from mother to fetus, conversion of certain proportion of arachidonic acid to PGs, incorporation of some fatty acids into phospholipids and triacylglycerols, and the oxidation of fatty acids[47]. Metabolics analysis showed that sow dietary Leu supplementation leads to altered placental lipid metabolism. Placenta has been shown to oxidize fatty acids as an important metabolic fuel to supply energy during the whole gestational process [48, 49] and FABP 3, 4, 5 were upregulated in placenta during fatty acids oxidation [50, 51,52]. On the other hand, long-chain fatty acid metabolites may exert toxic effects on cellular functions and cause cell injury [53].In present study, gene expression of FABP 3, FABP 5 and FABP 7 were significantly enhanced in placenta from those sows fed with Leu supplementation. But metabolic analysis showed decreased level of several metabolities relalted to lipid oxidation including 9S- hydroxy-octadedienoic acid (HODE) and 13S-HODE, in treatment placenta compared with control. These results indicated that Leu supplementation upregulated fatty acid oxidization to produce more energy to support placental function without boosting cellular transport.

In addition, we interestingly found PGs which is a crucial regulator for pregnancy and has been linked to induction of fetal organ maturation [54, 55], were upregulated with the leu supplementation. During pregnancy, placenta is the major source of PGs within intrauterine tissues. This result might suggest a new regulation effect of leu to PGs synthesis.

Glucose transport and metabolism

Glucose is the main metabolic fuel for fetal intrauterine growth and is one of the major nutrients transported from maternal circulation [56]. In pig placenta, SLC2A family of glucose transporters including 14 members (SLC2A1-SLC2A14), are responsible for transporting glucose in addition to multiple other sugars from maternal to fetus and SLC2A1 and SLC2A3 play the prominent role among these transporters [57, 58]. In present study, we globally determined all transporters belong to SLC2A family and not surprisingly found that SLC2A1 and SLC2A3 were dramatically increased with leu supplementation, suggesting more glucose delivery between maternal and fetus.

Interestingly that although glucose is the major metabolic fuel, but fructose shows the most abundant hexose sugar in porcine endometria and conceptuses to support conceptus development as a subtract in many metabolic pathway [59]. In porcine placenta, glucose could be actively converted to fructose and then enter the hexosamine biosynthesis pathway and stimulate trophectoderm proliferation or transported into fetus to supply energy through glycolytic pathway [60].Because that fructose is undetected in blood of pregnant gilts and sows, placental synthesis from glucose is the main source of fructose for intrauterine fetus during pregnancy [61]. We interestingly found that placenta glucose and fructose amount was both greatly higher in the sows fed with 0.4% Leu compared with control group, but the expression of fructose transporters SLC2A5 and SLC2A8 showed no difference induced by addition of Leu [62]. This result suggested that the promoted fructose synthesis from glucose induced by Leu in placenta just only was metabolized within placenta to provide energy, but no contribution to fetal supply.

Energy metabolism and mTOR signal pathway

Constant and abundant source of energy supply is necessary in placenta for its specialized roles, both nutrient transportation and the synthesis of placental protein hormones, as well as for its nonspecific functions [63]. Previous studies indicated that intensity of energy metabolism in placenta was greatly decreased in intrauterine growth restriction and resulted in disturbances of the placental morphological structure and functional insufficiency. [64]. In present study, the activities of enzymes in placenta involved in energy metabolism including carbohydrate metabolism (hexokinase, glycogen phosphorylase and lactated hydrogenase), tricarboxylic acid cycle enzyme (succinatede hydrogenase) and fatty acid oxidation (hydroxyacyl-CoA-dehydrogenase) were all significantly enhanced with Lue supplementation in sow diet, implying more intensive energy metabolism to provide ATP for placenta development and function.

The mechanisms by which the placenta adjusts signals to meet appropriate intrauterine fetal growth are complex [5, 65]. The mammalian target of rapamycin (mTOR) protein is a Ser/threonine-specific protein kinase that belongs to the PI3K-related kinase (PIKKs) family, which functions in the regulation of cell growth and protein transcription by serving as a nutrient sensor during gestation, and a downstream target of the PI3K and PKA pathways [66, 67]. Previous studies have shown that the inhibition of mTOR activation results in impaired placental function and elevated expression of mTOR as compensation of Intrauterine growth retardation (IUGR) [68]. In current study, we found that mTOR pathway is higher activated in placenta from the sows fed with Leu, demonstrated by elevated levels of p-PI3K, p-Akt, and p-mTOR, implying that PI3K/Akt/mTOR signal pathway was involved in the regulation of leu to placenta nutrient transport and metabolism.

The present study suggests that dietary Lue supplementation during late gestation improved amino acids, fatty acids, and glucose transport cross placenta, and globally altered placental metabolism to enhance glycolysis and fatty acids oxidization to supply energy to support more nutrient transport. In addition, PI3K/AKT/mTOR signal pathway was involved in the regulation of leu to placenta nutrient transport and metabolism. It would be of great interest in future studies to clarify the mechanism of regulation of PI3K/Akt/mTOR by Leu in an in vitro model.

Aad: Aminoadipic acid; Akt: Protein kinase B; Ala: Alanine; ANOVA: One-way analysis of variance; Arg: Arginine; Asp: Aspartic acid; CAT: Catalase; Cit: Citrulline; Cys: Cysteine; EFA: Essential fatty acids; Gln: Glutamine; Glu: Glutamic acid; Gly: Glycine; GSH-Px: Glutathione peroxidase; GSH-Tr: Glutathione transferase; Harg: Homoarginine; His: Histidine; HODE: Hydroxy-octadedienoic acid; HPLC- MS/MS: High performance liquid chromatography–tandem mass spectrometr; Hpro: Hydroxyproline; IUGR: Intrauterine growth retardation; Ile: Isoleucine; KEGG: Kyoto Encyclopedia of Genes and Genomes; Leu: Leucine; Lys: Lysine; MDA: Malonaldehyde; Met: Methionine; mTOR: Mammalian target of rapamycin; NHis: N-histidine; PGs: Prostaglandins; Phe: Phenylalanine;PI3K: Phosphatidylinositol 3-kinase; PLS-DA: Partial least-square discriminant analysis; Pro: Proline; PSer: Phosphoserine; PUFAs: Polyunsaturated fatty acids; PVDF: Polyvinylidene difluoride; Ser: Serine; SOD: Superoxide dismutase; Tau: Taurine; Trp: Tryptophan; Val: Valine;VIP:Variable importance on projection

Ethics approval and consent to participate

All the animal procedures uesd during this experiment were approved by the South China Agricultural University Animal Care and Use Committee.

Consent for publication

Not applicable.

Conflicts of interest

The authors states there is no conflicts of interest.

Availability of data and materials

The data analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by the Natural Science Foundation of Guangdong Province (2021A1515010944) and the National Natural Science Foundation of China (31402082).

Authors’ contributions

CC, WG, SZ and FC conceived and designed the experiments; CC, CW and PZ performed the experiments; CC, JW, ZM and XZ used software to analyze and examine the data. CC and FC wrote and revised the article. All authors read and approved the final version of the manuscript.

Acknowledgment

Not applicable.

Author details

¹Guangdong Provincial Key Laboratory of Animal Nutrition Control, College of Animal Science, South China Agricultural University, Guangzhou 510642, China. ²College of Animal Science and National Engineering Research Center for Breeding Swine Industry, South China Agricultural University, Guangzhou 510642, China. ³Guangdong Laboratory for Lingnan Modern Agriculture, South China Agricultural University, Guangzhou 510642, China

Ingrid C, Means RE, Paulomi A, Kaori K, Lang SM, Booth CJ, Carmen B, Alejandro M, Enrique O, Roberto R. Viral infection of the placenta leads to fetal inflammation and sensitization to bacterial products predisposing to preterm labor. J Immunol. 2010;185(2):1248.
Burton GJ, Watson AL. The Structure of the Human Placenta: Implications for Initiating and Defending Against Virus Infections. Rev Med Virol. 1997;7(7):219–28.
Gude NM, Roberts CT, Kalionis B, King RG. Growth and function of the normal human placenta. Thromb Res. 2004;114(5):397–407.
Barker DJ, Thornburg KL, Osmond C, Kajantie E, Eriksson JG. Beyond birthweight: the maternal and placental origins of chronic disease. J Dev Orig Health Dis. 2010;1(6):360–4.
Burton GJ, Fowden AL, Thornburg KL. Placental Origins of Chronic Disease. Physiol Rev. 2016;96(4):1509–65.
Cetin I, Fetal growth restriction: Implications for placental metabolism and transport, 2008.
Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G. Comparative aspects of implantation. Reproduction. 2009;138(2):195–209.
Silva CLAD, Brand Hvd A, Laurenssen BF, Broekhuijse MLW J, Knol F, Kemp EB, Soede M. N. Relationships between ovulation rate and embryonic and placental characteristics in multiparous sows at 35 days of pregnancy. Animal An International Journal of Animal Bioscience. 2016;10(7):1192–99.
Vallet JL, Miles JR, Freking BA. Development of the pig placenta. Soc Reprod Fertil Suppl. 2009;66(66):265–79.
Thornburg K, O'Tierney-Ginn P, Louey S. The placenta is a programming agent for cardiovascular disease. Placenta 2010; 311 – 12.
Pedroso JA, Zampieri TT, Donato J. Jr. Reviewing the Effects of L-Leucine Supplementation in the Regulation of Food Intake, Energy Balance, and Glucose Homeostasis. Nutrients. 2015;7(5):3914–37.
Jones H, Powell T, Jansson T. Regulation of Placental Nutrient Transport - A Review. Placenta 2007; 28763–74.
Sibley CP, Brownbill P, Glazier JD, Greenwood SL. Knowledge needed about the exchange physiology of the placenta. Placenta 2018S0143400418300092.
Urbaniak B, Plewa S, Klupczynska A, Sikorska D, Samborski W, Kokot ZJ. Serum free amino acid levels in rheumatoid arthritis according to therapy and physical disability. Cytokine 2019; 113332–39.
Cleal JK, Brownbill P, Godfrey KM, Jackson JM, Jackson AA, Sibley CP, Hanson MA, Lewis RM. Modification of fetal plasma amino acid composition by placental amino acid exchangers in vitro. J Physiol. 2007;582(Pt 2):871–82.
Self JT, Spencer TE, Johnson GA, Hu J, Bazer FW, Wu G. Glutamine synthesis in the developing porcine placenta. Biol Reprod. 2004;70(5):1444–51.
Wu G, Bazer FW, Tou W. Developmental changes of free amino acid concentrations in fetal fluids of pigs. J Nutr. 1995;125(11):2859–68.
Wu X, Xie C, Zhang Y, Fan Z, Yin Y, Blachier F. Glutamate–glutamine cycle and exchange in the placenta–fetus unit during late pregnancy. Amino Acids. 2015;47(1):45–53.
Jinyoung K, Gwonhwa S, Guoyao W, Bazer FW. Functional roles of fructose. Proc Natl Acad Sci USA. 2012;109(25):9680–81.
Sawant OB, Wu G, Washburn SE. Maternal L-glutamine supplementation prevents prenatal alcohol exposure-induced fetal growth restriction in an ovine model. Amino Acids. 2015;47(6):1183–92.
Wu G, Bazer FW, Dai Z, Li D, Wang J, Wu Z. Amino acid nutrition in animals: protein synthesis and beyond. Annu Rev Anim Biosci 2014; 2387 – 417.
Wu G, Bazer FW, Burghardt RC, Johnson GA, Kim SW, Knabe DA, Li P, Li X, McKnight JR, Satterfield MC, Spencer TE. Proline and hydroxyproline metabolism: implications for animal and human nutrition. Amino Acids. 2011;40(4):1053–63.
Dunn WB, Brown M, Worton SA, Crocker IP, Broadhurst D, Horgan R, Kenny LC, Baker PN, Kell DB, Heazell AE. Changes in the metabolic footprint of placental explant-conditioned culture medium identifies metabolic disturbances related to hypoxia and pre-eclampsia. Placenta. 2009;30(11):974–80.
Avagliano L, Garã² C, Marconi AM. Placental amino acids transport in intrauterine growth restriction. J Pregnancy. 2012;2012(1):972562.
Lewis RM, Brooks S, Crocker IP, Glazier J, Hanson MA, Johnstone ED, Panitchob N, Please CP, Sibley CP, Widdows KL. Review: Modelling placental amino acid transfer – From transporters to placental function. Placenta 2013; 34(Suppl): S46-S51.
Pantham P, Rosario FJ, Weintraub ST, Nathanielsz PW, Powell TL, Li C, Jansson T. Down-Regulation of Placental Transport of Amino Acids Precedes the Development of Intrauterine Growth Restriction in Maternal Nutrient Restricted Baboons. Biol Reprod. 2016;95(5):98.
Wu G, Bazer FW, Johnson GA. Maternal and fetal amino acid metabolism in gestating sows. Soc Reprod Fertil Suppl 2013; 68185–98.
Finch AM, Yang LG, Nwagwu MO, Page KR, McArdle HJ, Ashworth CJ. Placental transport of leucine in a porcine model of low birth weight. Reproduction. 2004;128(2):229–35.
Wu G, Bazer FW, Datta S, Johnson GA, Li P, Satterfield MC, Spencer TE. Proline metabolism in the conceptus: implications for fetal growth and development. Amino Acids. 2008;35(4):691–702.
Gaull G, Sturman JA, Raiha NC. Development of mammalian sulfur metabolism: absence of cystathionase in human fetal tissues. Pediatr Res. 1972;6(6):538–47.
Cetin I, Corbetta C, Sereni LP, Marconi AM, Bozzetti P, Pardi G, Battaglia FC. Umbilical amino acid concentrations in normal and growth-retarded fetuses sampled in utero by cordocentesis. Am J Obstet Gynecol. 1990;162(1):253–61.
Desforges M, Ditchfield A, Hirst CR, Pegorie C, Martyn-Smith K, Sibley CP, Greenwood SL. Reduced placental taurine transporter (TauT) activity in pregnancies complicated by pre-eclampsia and maternal obesity. Adv Exp Med Biol 2013; 77681–91.
Wu G, Bazer FW, Hu J, Johnson GA, Spencer TE. Polyamine synthesis from proline in the developing porcine placenta. Biol Reprod. 2005;72(4):842–50.
Wu G, Bazer FW, Tuo W, Flynn SP. Unusual abundance of arginine and ornithine in porcine allantoic fluid. Biol Reprod. 1996;54(6):1261–5.
Gao H, Wu G, Spencer TE, Johnson GA, Li X, Bazer FW. Select nutrients in the ovine uterine lumen. I. Amino acids, glucose, and ions in uterine lumenal flushings of cyclic and pregnant ewes. Biol Reprod. 2009;80(1):86–93.
Dutta-Roy AK. Transport mechanisms for long-chain polyunsaturated fatty acids in the human placenta. Am J Clin Nutr. 2000;71(1 Suppl):315S-22S.
Innis SM. Essential fatty acid transfer and fetal development. Placenta 2005; 26 Suppl AS70-5.
Innis SM. Perinatal biochemistry and physiology of long-chain polyunsaturated fatty acids. J Pediatr. 2003;143(4):1–8.
Innis SM. Fatty acids and early human development. Early Human Dev. 2007;83(12):761–66.
Duttaroy AK. Transport of fatty acids across the human placenta: a review. Prog Lipid Res. 2009;48(1):52–61.
Hall AM, Wiczer BM, Herrmann T, Stremmel W, Bernlohr DA. Enzymatic properties of purified murine fatty acid transport protein 4 and analysis of acyl-CoA synthetase activities in tissues from FATP4 null mice. J Biol Chem. 2005;280(12):11948–54.
Digel M, Staffer S, Ehehalt F, Stremmel W, Ehehalt R, Füllekrug J. FATP4 contributes as an enzyme to the basal and insulin-mediated fatty acid uptake of C2C12 muscle cells. American Journal of Physiology-Endocrinology Metabolism. 2011;301(5):E785-E96.
Goldberg IJ, Eckel RH, Abumrad NA. Regulation of fatty acid uptake into tissues: lipoprotein lipase-and CD36-mediated pathways. Journal of lipid research. 2009;50:86–90.
Hulbert AJ, Turner N, Storlien LH, Else PL. Dietary fats and membrane function: implications for metabolism and disease. Biol Rev Camb Philos Soc. 2005;80(1):155–69.
Sprecher H. Biochemistry of essential fatty acids. Prog Lipid Res 1981; 2013-22.
Ducharme NA, Bickel PE. Lipid droplets in lipogenesis and lipolysis. Endocrinology. 2008;149(3):942–9.
Lewis RM, Wadsack C, Desoye G. Placental fatty acid transfer. Curr Opin Clin Nutr Metab Care. 2018;21(2):78–82.
Shekhawat P, Bennett MJ, Sadovsky Y, Nelson DM, Rakheja D, Strauss AW. Human placenta metabolizes fatty acids: implications for fetal fatty acid oxidation disorders and maternal liver diseases. Am J Physiol Endocrinol Metab. 2003;284(6):E1098-105.
Oey NA, den Boer ME, Ruiter JP, Wanders RJ, Duran M, Waterham HR, Boer K, van der Post JA, Wijburg FA. High activity of fatty acid oxidation enzymes in human placenta: implications for fetal-maternal disease. J Inherit Metab Dis. 2003;26(4):385–92.
Cunningham P, McDermott L. Long chain PUFA transport in human term placenta. J Nutr. 2009;139(4):636–9.
Biron-Shental T, Schaiff WT, Ratajczak CK, Bildirici I, Nelson DM, Sadovsky Y. Hypoxia regulates the expression of fatty acid-binding proteins in primary term human trophoblasts. Am J Obstet Gynecol. 2007;197(5):516 e1–6.
Xu Y, Wang Q, Cook TJ, Knipp GT. Effect of placental fatty acid metabolism and regulation by peroxisome proliferator activated receptor on pregnancy and fetal outcomes. J Pharm Sci. 2007;96(10):2582–606.
Criddle DN, Murphy J, Fistetto G, Barrow S, Tepikin AV, Neoptolemos JP, Sutton R, Petersen OH. Fatty acid ethyl esters cause pancreatic calcium toxicity via inositol trisphosphate receptors and loss of ATP synthesis. Gastroenterology. 2006;130(3):781–93.
Thorburn GD. The placenta, prostaglandins and parturition: a review. Reprod Fertil Dev. 1991;3(3):277–94.
Chatuphonprasert W, Jarukamjorn K, Ellinger I. Physiology and Pathophysiology of Steroid Biosynthesis, Transport and Metabolism in the Human Placenta. Frontiers in Pharmacology 2018; 91027-.
Benincasa L, Mandala M, Paulesu L, Barberio L, Ietta F. Prenatal Nutrition Containing Bisphenol A Affects Placenta Glucose Transfer: Evidence in Rats and Human Trophoblast. Nutrients 2020; 12(5).
Johnson GA, Kramer AC, Steinhauser C, Seo H, McLendon BA, Burghardt RC, Wu GY, Bazer FW. Steroids Regulate SLC2A1 and SLC2A3 to Deliver Glucose into Trophectoderm for Metabolism via Glycolysis. Journal of Animal Science 2020; 98188–88.
Augustin R. The Protein Family of Glucose Transport Facilitators: It's Not Only About Glucose After All. Iubmb Life. 2010;62(5):315–33.
White CE, Piper EL, Noland PR, Daniels LB. Fructose utilization for nucleic acid synthesis in the fetal pig. J Anim Sci. 1982;55(1):73–6.
Meznarich HK, Hay WW Jr, Sparks JW, Meschia G, Battaglia FC. Fructose disposal and oxidation rates in the ovine fetus. Q J Exp Physiol. 1987;72(4):617–25.
Pere MC. Maternal and fetal blood levels of glucose, lactate, fructose, and insulin in the conscious pig. J Anim Sci. 1995;73(10):2994–9.
Steinhauser CB, Landers M, Myatt L, Burghardt RC, Vallet JL, Bazer FW, Johnson GA. Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway. Biology of Reproduction 2016; 95(5).
Bloxam DL, Bobinski PM. Energy metabolism and glycolysis in the human placenta during ischaemia and in normal labour. Placenta. 1984;5(5):381–94.
Lucenko MT, Andrievskaya IA, Dolzhikova IV. [Energy Metabolism in the Placenta and the Role of Disturbances in the Development of Placental Insufficiency at an Exacerbation of Cytomegalovirus Infection]. Vestn Ross Akad Med Nauk. 2016;71(3):177–82.
Chassen S, Jansson T. Complex, coordinated and highly regulated changes in placental signaling and nutrient transport capacity in IUGR. Biochim Biophys Acta Mol Basis Dis. 2020;1866(2):165373.
Jansson N, Pettersson J, Haafiz A, Ericsson A, Palmberg I, Tranberg M, Ganapathy V, Powell TL, Jansson T. Down-regulation of placental transport of amino acids precedes the development of intrauterine growth restriction in rats fed a low protein diet. J Physiol. 2006;576(Pt 3):935–46.
Wullschleger S, Loewith R, Hall MN. TOR signaling in growth and metabolism. Cell. 2006;124(3):471–84.
Arroyo JA, Brown LD, Galan HL. Placental mammalian target of rapamycin and related signaling pathways in an ovine model of intrauterine growth restriction. Am J Obstet Gynecol 2009; 201(6): 616 e1-7.

Table 1. Composition of the diet (as-fed basis)

Ingredient (%)	Added leucine level (%)
Ingredient (%)	CON	0.40	0.80
Corn	66.00	66.00	66.00
Soybean meal	18.5	18.5	18.5
Soybean oil	1.00	1.00	1.00
Wheat bran	9.50	9.50	9.50
Limestone	1.20	1.20	1.20
Dicalcium phpsphate	0.50	0.50	0.50
Salt	0.30	0.30	0.30
L-lysine HCL(78%)	0.12	0.12	0.12
DL-methionine(100%)	0.02	0.02	0.02
L-threonine(98.5%)	0.06	0.06	0.06
L-tryptophan(98.5%)	0.02	0.02	0.02
L-valine(98.5%)	0.07	0.07	0.07
L-leucine(98.5%)	0.00	0.40	0.80
Vitamin-mineral premix^a	0.20	0.20	0.20
Choline chloride(50.0%)	0.30	0.30	0.30
Phytase	0.02	0.02	0.02
Mold removal agent	0.10	0.10	0.10
Mold inhibitors	0.05	0.05	0.05
antioxidant	0.04	0.04	0.04
carrier	2.00	1.60	1.20
Total	100.00	100.00	100.00

Note: ^aVitamin and mineral premix (by per kilogram of diet): vitamin A, 13 000 IU; vitamin D3, 4000 IU; vitamin E, 60 mg; vitamin K3, 4 mg; vitamin B1, 4 mg; vitamin B2, 10 mg; vitamin B6, 4.8 mg; vitamin B12, 0.034 mg; niacin, 40 mg; pantothenic acid, 20 mg; folic acid, 2 mg; biotin, 0.16 mg; 80 mg of Fe (as FeSO4·H2O); 5 mg of Cu (as CuSO4· 5H2O); 51 mg of Zn (as ZnSO4·H2O); 20.5 mg of Mn (as MnSO4· H2O); 0.14 mg of I (as Ca(IO3)2); and 0.15 mg of Se (as sodium selenite).

Table 2. Nutritional value of the diet (as-fed basis)

Nutritional level (%)^a	Added leucine level (%)
Nutritional level (%)^a	CON	0.40	0.80
Digestible energy,MJ/kg	13.35	13.31	13.27
Crude protein	14.99	15.19	15.40
Calcium	0.86	0.86	0.86
Total phosphorus	0.64	0.64	0.64
nonphytic acid phosphorus	0.39	0.39	0.39
Salt	0.36	036	0.36
Arginine	0.96	0.95	0.95
lysine	0.79	0.79	0.79
methionine	0.24	0.24	0.24
Methionine+cysteine	0.46	0.46	0.46
threonine	0.06	0.06	0.06
Tryptophan	0.18	0.18	0.18
Valine	0.74	0.74	0.74
Isoleucine	0.56	0.56	0.56
Leucine	1.30	1.70	2.10
Phenylalanine	0.71	0.71	0.71
Phenylalanine+tyrosine	1.21	1.21	1.21

aCalculated values according to the tables of feed composition and nutritive values in China.

Table 3. Primer sequences used in Real-time PCR

Genes	Accession	Sequencens（5’-3’）
SLC1A4	XM_003125088	F:AGACCTCTCTTTGATCCTGGC	R:TGTTTCCTCCTCTGATTTGCA
SLC7A1	NW_003611328.1	F:GCCTGAGAGCAAGACCAAAC	R:GCCGTAGCCGAAGTAGATGA
SLC7A2	EU155140	F:GCCCCAGAATCAGCAAAAAGTA	R:GATGCTGAAGGCTGGCAAAA
SLC7A5	NM_003486	F:CTCTTCCTGATCGCCGTCTC	R:CTTCTGACACAGGACGGTCGT
SLC7A6	NM_003983	F:CTGCCGCCTGCATGTGT	R:TGTGCCCCACTTGACATAGG
SLC7A7	EU047705	F:TTTGGTTCCCAAGGTTGCA	R:GCAGCTTCCTGGCATTGC
SLC7A8	AF135830	F:TCGCTGTGACTTTTGGAGAGA	R:CGGGAGGAGGTGAAGAGG
SLC7A10	XM_003127014	F:TGGACCCTCGAAAGAACCTAC	R:TGATCCCTCCGAAAGTGGA
SLC7A11	AB271957	F:AATGTGGCCTACTTCACGACC	R:CCTCCCGAGATGCAACATAGA
SLC15A1	NM_214347.1	F:TTCGGTTATCCCTTGAGCATCTTCTTC	R:GTGGTAGATGGCAGTGGACAGATTG
SNAT1	XM_003355629	F:AAGAACCTGGGCTATCTCGG	R:TGTTGCGTTAGGACTCGTTG
SNAT2	NM_018976	F:GTTACCTTTGGTGATCCAGGC	R:ACCAATGACACCAGCAGAACC
LAT1	NM_003486	F:GCCCATTGTCACCATCATC	R:GAGCCCACAAAGAAAAGC
4F2hc	XM_003353809	F:CTCGAACCCACCAAGGAC	R:GAGGTGAGACGGCACAGAG
rBAT	EU587017	F:TTTCCGCAATCCTGATGTTC	R:GGGTCTTATTCACTTGGGTC
SGLT1	NM_001164021	F:CATCATCGTCCTGGTCGTC	R:CATCATCGTCCTGGTCGTC
SGLT3	NM_214182	F:CCTTGGGATTGGACCTTTATC	R:CGTTTGCGGAGGGTGTCTGTGT
SGLT5	NM_001012297	F:GCGTCCAGATCGGCAGAACCT	R:GCGTCCAGATCGAGAACCT
CD36	DQ192230.1	F:GGACTCATTGCTGGTGCTGT	R:GTCTGTAAACTTCCGTGCCTGT
FATP1	NM_001083931.1	F:GGCAACAGACGTGATCTATGAC	R:AGCGGCTGGCTGAAAACT
FATP2	JX092264.1	F:TCTAACACGGATGGGGTCG	R:AGGGCAGGAGTGGAAAAGT
FATP3	XM_001929591.2	F:AGGTCTCAGCCGAAGTGGAT	R:TGGGAGGGCGAGGTAGAT
FATP4	XM_003353676.1	F:AGCCGCATCCTGTCCTTT	R:GACATCCTTGGCGATCTTTT
FABP3	AY569332.1	F:CTGGGAGTGGAGTTTGATGAGAC	R:CCATGGGTGAGTGTCAGGAT
FABP4	NM_001002817.1	F:TGAAAGGTGTCACGGCTAC	R:TCGGGACAATACATCCAACAGAG
FABP5	AY841270.1	F:CTGGGACAGAAGTTTGAAGAGAC	R:GACCCGAGTGCAGGTGACATT
FABP7	NM_001025229.1	F:GACTCAAAGCACATTCAAGAAC	R:GCAACCACATCACCAAAAGTAA
SLC2A1	XM_021096908.1	F:GCTCCTGGTCCTGTTCTTCATCTTC	R:CTCGGGTGTCTTGTCGCTTTGG
SLC2A2	NM_001097417.1	F:CCATTGTCACAGGCATTCTTGTTAGTC	R:CACAGCAGATAGACCAAGCAGGATG
SLC2A3	XM_021092391.1	F:TCTCCATCATGCTCCAGCTCTCC	R:AATAGTGGCATAGATTGGCTCCTGAAC
SLC2A5	XM_021095282.1	F:CTCTTCATCACCGTTGGCATCCTC	R:GGGAAGAAGGGCAGGCAAAGAAG
SLC2A6	XM_003353701.4	F:GGCTCCTGTCTGTGCTGATTGC	R:ATGGTGGCTCCTGAGACGAAGAG
SLC2A8	XM_003480608.4	F:CTTCGTCATCGGCGTCTCACTG	R:CCAGGCTGCTCTCCTTGAACTTG

Leucine supplementation during late gestation globally altered placental metabolism and nutrient transport via modulation of the PI3K/AKT/mTOR signalling pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Status:

Version 1