Ethics statement
The experimental protocol in this study was approved by Ethics Committee of The Second Hospital of Liaocheng Affiliated to Shandong First Medical University. All participants and their guardians were well informed and signed the informed consent form prior to the study. All animal studies were approved by the Institutional Animal Research Committee of The Second Hospital of Liaocheng Affiliated to Shandong First Medical University.
Study subjects
From January 2018 to December 2019, 12 IVDD patients undergoing discectomy in our hospital were recruited as study subjects (Pfirrmann grade: III-V, mean age: 41.6 ± 8.3 years). During the same period, the normal NP tissues were obtained from 10 patients (mean age: 23.4 ± 5.3 years) with idiopathic scoliosis classified as Pfirrmann grade I or II according to Magnetic Resonance Imaging (MRI). All patients had no history of tumor, tuberculosis, diabetes, chronic infection and autoimmune diseases. NP tissues from IVDD patients and control patients were quickly collected and stored in liquid nitrogen for later experiments, and all tissues were preserved in cell center of our hospital. Then, the expressions of miR-195 and TNF-α in NP tissues were quantified by qRT-PCR, and Bcl-2 protein expressions were detected by Western blotting. Study design is summarized in Figure 1.
Isolation and culturing of NP cells
Human NP tissues were carefully isolated, washed three times with PBS, and cut to 1 mm3 pieces with ophthalmic scissors and placed in 15 mL centrifuge tube. At the temperature of 37°C, NP tissues were digested for 40 min in PBS solution with 0.25% trypsin (Gibco-BRL, Grand Island, NY). The digestive solution was removed, and the left tissues were washed with PBS again. Next, NP tissues were digested for 4 h in PBS solution with 0.025% type II collagen (Invitrogen,USA), followed by filtering, centrifugation and discarding the upper supernatant. Then the NP cells were resuspended in DMEM/F12 supplemented with 15% fetal bovine serum (FBS, Gibco-BRL), 100 μg/mL streptomycin, 100 U/mL penicillin, and 1% L-glutamine and incubated at 37°C in an atmosphere containing 5% CO2. At 80-90% confluence, cells were digested by 0.25% trypsin solution and subculture in DMEM/F12 supplemented with 15% FBS, 100 μg/mL streptomycin, 100 U/mL penicillin at 37°C in a humidified 5% CO2 atmosphere. The culture medium was replaced twice every week. The second passage cells were used for subsequent experiments.
Dual-luciferase reporter gene assay
Bioinformatics software was used to predict the target site of Bcl-2 3’UTR to bind to miR-195. Wild-type Bcl-2-Wt 3’UTR and mutant-type Bcl-2-Mut 3’UTR recombinant plasmids were constructed. One day before transfection, cells were digested by trypsin, counted (2 × 105 cells/mL) and inoculated to 24-well plates. Cells were co-transfected with wild-type or mutant-type luciferase reporter gene plasmid, Renilla (pRL-TK) plasmid, and miR-195 mimic or miR-NC in accordance with the instructions of Lipofectamine 2000 kit (Invitrogen, USA). At 24 h after transaction, cells were collected to detect the luciferase activity using dual-luciferase reports gene assay kit (Promega, USA). The ratio of pGL3 firefly luciferase activity to pRL-TK Renilla luciferase activity was regarded as the relative luciferase activity. The experiment was performed three times independently to obtain the mean value.
Grouping and transfection of NP cells
NP cells were divided into 6 groups: Blank group (NP cells without any treatment), TNF-α group (NP cells treated with 20 ng/mL TNF-α for 12 h 16), TNF-α + miR-NC group (NP cells transfected with miRNA NC prior to TNF-α treatment), TNF-α + miR-195 inhibitors group (NP cells transfected with miR-195 inhibitors prior to TNF-α treatment), TNF-α + siBcl-2 group (NP cells transfected with Bcl-2 siRNA prior to TNF-α treatment) and TNF-α + miR-195 inhibitors + siBcl-2 group (NP cells co-transfected with miR-195 inhibitors and Bcl-2 siRNA prior to TNF-α treatment). MiRNA negative control (NC), miR-195 inhibitors and Bcl-2 siRNA were all purchased from Shanghai Genechem Co., Ltd. The miR-195 inhibitors could stably suppress the target miR-195 and are designed and optimized for miR-195 loss of function study. When reached 70-80% confluence, cells were transfected with miR-195 inhibitors/miRNA NC/Bcl-2 siRNA at a final concentration of 40 nM for transfection using LipofectamineTM 2000 (Invitrogen, USA) according to the manufacturers’ instructions.
Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)
Total RNA in NP tissues or cells were extracted using TRIZOL agent, quantified for RNA concentration using an ultraviolet spectrophotometer, and reversely transcribed into cDNA using PrimeScript RT kit (RR014A, Takara Biomedical Technology (Beijing) Co., Ltd., China). Appropriate amount of cDNA was used as template for PCR. Primers were designed using software Primer 5.0 (Table 1), and synthesized by GenScript (Nanjing) Co., Ltd). qRT-PCR was performed according to instructions of PCR kit (KR011A1, TIANGEN Biotech (Beijing) Co. Ltd., Beijing, China) and reaction conditions included pre-denaturation at 95°C for 1 min and 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C, extending for 40 s. With U6/β-actin as internal reference, 2-△△Ct method was used to calculate the expression of target genes, with △Ct=Cttarget gene-Ctinternal reference gene, △△Ct=△Ctexperimetn group-△Ctcontrol group, and relative expression = 2-△△Ct. The experiment was performed three times independently to obtain the mean value.
Table 1 Primers for qRT-PCR
Gene
|
Primers (5’-3’)
|
miR-195
|
F: CGTAGCAGCACAGAAATATTGGC
|
|
R: CCAGTCTCAGGGTCCGAGGTATTC
|
U6
|
F: CTCGCTTCGGCAGCACATATA
|
|
R: ACGCTTCACGAATTTGCGTGTC
|
TNF-α
|
F: CGAGTCTGGGCAGGTCTACTTT
|
|
R: AAGCTGTAGGCCCCAGTGAGTT
|
β-actin
|
F: GCAGAAGGAGATCACTGCCCT
|
|
R: GCTGATCCACATCTGCTGGAA
|
Western blotting
Total proteins in NP tissues or cells were extracted and quantified for protein concentration with a BCA kit. The protein samples were adjusted to the same level regarding protein content and loading volume. Polyacrylamide gel electrophoresis was performed to separate proteins, which were transferred to Polyvinylidene fluoride (PVDF) membranes using semi-dry transfer system (Bio-Rad, USA). The membrane was blocked in skimmed milk at room temperature and washed with PBST buffer, before the addition of primary antibodies for 1 h reaction at room temperature, including rabbit-anti-human Bax, Bcl-2 and cleaved caspase 3, and GAPDH monoclonal antibody (all purchased from Abcam, UK). Next, the membrane was incubated for 1 h with horseradish peroxidase (HRP) labeled goat-anti-rabbit IgG (Beijing Zhongshan Gold Bridge Biotechnology Co., Ltd.), and rinsed with PBST for 5 times × 3 min. chemiluminescence (ECL) luminescent reagent was used for the visualization of target proteins. With GAPDH protein as loading control, the software Image-pro Plus 6.0 was used to determine the relative expression of target protein. The relative expression of target protein was set as the gray value ratio of target protein to GAPDH. The experiment was performed three times independently to obtain the mean value.
Cell viability detected by MTT assay
NP cells in each group were inoculated to 96-well plates by density of 1 × 104 cells/well. When cell confluence reached 70%, 5 mg/mL MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) solution (ST316, Beyotime Biotechnology) was added to each well by 10 μL/well and cells were cultured at 37°C for 4 h. After removing the upper clear supernatant, the plate was washed with PBS, followed by addition of dimethylsulfoxide (DMSO) (D5879, Sigma) by 100 μL/well and 10 min of oscillation. At 48 h after inoculation, the optical density (OD) value was determined at wavelength of 492 nm with a Microplate Reader (MK3, Thermo, Pittsburgh, PA, USA). The experiment was performed three times independently to obtain the mean value.
Cell apoptosis detected by flow cytometry
NP cells were digested by 0.25% trypsin (without EDTA) (PYG0107, Wuhan Boster Biological Technology., LTD, China) in a 15 mL centrifuge tube, centrifuged for 5 min at the speed of 1000 r/min, and washed three times with cold PBS. The clear supernatant was discarded. Next, 400 μL 1 × binding buffer was added to suspend cells, followed by addition of 5 μL Annexin V-FITC for 15 min staining at 4°C in an avoidance of light, with the addition of 10 μL propidium iodide (PI) staining for 5 min at 4°C without light. A flow cytometer was used to detect the cell apoptosis, with the excitation wavelength of 488 nm. Passband filter with the wavelength of 515 nm was used to detect FITC fluorescence, and the filter with wavelength of 560 nm was used to detect PI fluorescence. The experiment was performed three times independently to obtain the mean value.
Detection of mitochondrial membrane potential (MMP)
In accordance with instructions of the JC-1 MMP detection kit (TIANGEN Biotech (Beijing) Co., Ltd., China), JC-1 staining solution was added to cells for 20 min of incubation at 37°C. Next, JC-1 staining buffer was used to wash cells twice. 300 μL PBS was used to suspend cells before detection with the flow cytometer. The excitation and emission wavelength was 490 nm and 580 nm for red fluorescence respectively, and 490 nm and 520 nm for green fluorescence respectively. The experiment was performed three times independently to obtain the mean value.
Establishment of rat IVDD model
Forty male Sprague-Dawley (SD) rats weighted 200-250 g were used in this study. The animals were kept at a constant room temperature of (23 ± 1) °C on a 12 h light-dark cycle and had free access to food and tap water. Rats (n = 40) were randomly divided into four groups (n = 10 per group): Sham group, Punctured group, Punctured + antagomir-control and Punctured + antagomir-195 group. A rat model of IVDD was established using the annulus fibrosus needle puncture method 17. In brief, the rats were anesthetized by intraperitoneal injection of 10 mg/kg xylazine and 90 mg/kg ketamine hydrochloride. Subsequently, the syringe needle was inserted into the coccygeal discs C6-C7 in a vertical direction, and then rotated in the axial direction by 180° and held for 10 s. A 31-gauge needle was inserted, parallel to the endplates through the AF into the NP, 1.5 mm into the disc to depressurize the nucleus. For the rats in Sham group, the C6-C7 level discs were exposed without needle puncture. The antagomir-195 and antagomir-control were injected into disc C6-C7 of the rats in the Punctured + antagomir-195 and Punctured + antagomir-195, respectively11. The antagomir-195 and antagomir- control were designed and synthesized by RiboBio (Guangzhou, China). After four weeks, all rats were sacrificed by lethal anesthetic overdose and discs were collected and used for further analysis.
Radiography examination
All rats underwent radiography immediately before the IVDD puncture and 4 weeks after the second injection. The disc height index (DHI) was measured using the method as previously described 18. Changes in the DHI of the punctured IVDDs were expressed as %DHI (%DHI = post-punctured DHI/pre-punctured DHI × 100%).
HE and TUNEL staining
The paraffin-embedded tissues were cut into 4 sm sections and mounted on slides. The paraffin sections were deparaffinized with xylol and rehydrated. For clearing endogenous peroxidase, the intervertebral discs were treated with PBS containing 0.3% H2O2 for 15 min, and PBST with 1% BSA was applied to block the sample for 30 min. At last, Hematoxylin and Eosin (HE) staining was applied onto the samples of intervertebral discs. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed using a kit based on the manufacturer’s instruction (Promega, Fitchburg, WI, USA). Histological images were analyzed using the BX53 microscope (Olympus Inc., Tokyo, Japan).The grading score of HE staining was made according to the previous study 19.
Statistical methods
All statistical data were analyzed using SPSS 21.0 (SPSS, Inc, Chicago, IL, USA). Measurement data were presented by mean ± standard deviation. Comparison between two groups was analyzed using Student’s t-test, while difference among multiple groups was compared using One-Way ANOVA followed by a Turkey post-hoc test for multiple group comparison. P < 0.05 was regarded as statistical significance.