2.1 Clinical Tissue Samples
A total of five tumor tissue specimens without treatment with chemotherapy were collected from colon cancer patients in Putuo Hospital, Shanghai University of Traditional Chinese Medicine. The whole investigation was approved by the Ethics Committee of Shanghai University of Traditional Chinese Medicine affiliated Putuo Hospital and written consents were provided by all five patients. The clinical diagnosis was confirmed by two experienced pathologists without discrepancy.
2.2 Cell Culture
The human colon cancer cell lines of HCT116 and SW480 were acquired from the American Type Culture Collection (ATCC, Rockville, MD, USA) and cultured in RPMI-1640 containing 10% FBS (fetal bovine serum) and 1% penicillin-streptomycin. Tumor cells are cultured in a 5% (v/v) CO2 humidified incubator at 37°C.
2.3 Knockdown and overexpression
TET1 short hairpin RNA (shRNA, synthetized by Gene Pharma, CN) were utilized to transfect into HCT116 cells and SW480 cells for TET1 knockdown. Following please find the sequences of shRNA targeting TET1 (shTET1) 5′- TCAGAAGATTTAGAATTGATTTCAAGAGAATCAATTCTAAATCTTCTGTTTTTTC-3′ or 5′-TTGTGCCTCTGGAGGTTATAATTCAAGAGATTATAACCTCCAGAGGCACAA‐3′. CTNNB1 (shCTNNB1) containing the sequence
5`-GGTTAATAAGGCTGCAGTTATTTCAAGAGATAACTGCAGCCTTATTAACC-3` was designed and cloned into the pSicoR-GFP vector (Addgene, Cambridge, MA).
For TET1 overexpression, the gRNA for TET1 was designed at following website (http://sam.genome-engineering.org/database/). The TET1 overexpressing gRNA was designed to target the sequence 5′-AGGGGGTCGAGAGGGAGTCG-3′. Then, insert the gRNA oligo into lenti gRNA (MS2)-puro plasmid, by the process of Oligo annealing, digestion with BsmBI, ligation, transformation and plasmid extraction, we obtain the TET1 plasmid and transfect the plasmid in cells. 72h after transfection, the lentivirus for TET1-overexpression was collected and filtered through 0.45 µm filters. After infection with the virus for 24h, targeted cancer cells were replaced with fresh media for further analysis.
2.4 RNA Extraction and Detection of RT-PCR
Colonic cells were planted in 6-well plates. Total RNA was extracted from both human tissue samples and cultured cells with the TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Additionally, the cells with downregulated TET1 or TET1-activated were treated DOX with a concentration of 1µg /ml incubating for 24 h. Generally, High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) and SYBR Green master mix (Roche, Mannheim, Germany) were utilized to reverse transcribe mRNA into cDNA and were adopted to assay the relative expression of WNT1, SFRP1, MyC, TET1, CTNNB1, respectively. GAPDH (glyceraldehyde-3‐phosphate dehydrogenase) was used as control. The amplification was set as follows: 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. Primer sequences were shown in Table 1.
Table 1
Primer sequences of RT-qPCR
Gene name | Primer sequence (5’-3’) |
WNT1 | F: CGATGGTGGGGTATTGTGAAC R: CCGGATTTTGGCGTATCAGAC |
SFRP1 | F: ACGTGGGCTACAAGAAGATGG R: CAGCGACACGGGTAGATGG |
MyC | F: GGCTCCTGGCAAAAGGTCA R: CTGCGTAGTTGTGCTGATGT |
TET1 | F: CAGAACCTAAACCACCCGTG R: TGCTTCGTAGCGCCATTGTAA |
CTNNB1 | F: AAAGCGGCTGTTAGTCACTGG R: CGAGTCATTGCATACTGTCCAT |
GAPDH | F: GGAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATGG |
2.5 Western Blot
Cultured cancer cells (5 × 106 cells/mL) were collected and lysed in cold RIPA buffer plus phosphatase and protein inhibitors, placed on ice for 30 min and collected at 12,000 g for 20 min at 4°C to remove cell debris. The protein concentration was detected by Bradford assay. 40 µg total protein was loaded, separated on 10% SDS-PAGE and electro-transferred onto 0.45µm PVDF membranes (Millipore, Billerica, MA). After blocking with 5% BSA (bovine serum albumin) in TBST solution for 2 h, the membrane was incubated a primary antibody against beta-catenin, Cyclin D1, cMyC, CTNNB1 and GAPDH (Cell Signaling Technology, CST) diluted at 1:1000 overnight at 4°C. After incubating with HRP-conjugated secondary antibody (Sigma-Aldrich, Dorset, UK) at a 1:5000 dilution was added to the membrane and incubated for 60 min at room temperature. The membrane was visualized by chemiluminescence assay with an ECL kit and the relative expression was quantified with Image J (National Institute of Health, Bethesda, MD).
2.6 Trans-well invasion assay
Cultured cancer cells were infected with shTET1 and with TET1-activated, treated with or without DOX, respectively. An equivalent of 1 × 105 cancer cells in 150 µL serum-free RMPI medium were added to upper chambers of 8µm-24 well Transwell culture dishes, with 750 µL of 10%FBS-containing medium in lower chambers. After 48 hours incubation at 37°C, cells were rinsed with calcium free PBS and fixed with methanol, then stained with crystal violet. These tumor cells which passed through the membranes were evaluated in five randomly selected fields, then dissolved in methanol and quantified by microplate reader OD 405nm
2.7 3-(4,5‐Dimethylthiazol‐2‐yl)-2,5‐diphenyltetrazolium bromide assay
The cells supernatants were added with 5 mg/ml 3-(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT; Sigma‐Aldrich) and incubated at 37°C for 4 hours. 100 µL dimethyl sulfoxide was then added. The optical density (OD) was measured at both 492 nm and 630 nm wavelength; Cell viability was calculated according to the following formula: cell viability = [OD value of treatment group−OD value of background] / [OD value of control group−OD value of background] × 100%.
2.8 Chromatin immunoprecipitation (ChIP)
ChIP was performed in HCT116 cells. Cells cultured in 10 cm plates were cross-linked with formaldehyde and processed following the ChIP kit protocol (EMD Millipore, Burlington, MA, USA). The target DNA fragments were detected by PCR. The primers used to detect target DNA fragments are as follows: CTNNB1-Forward 5′-AAACAGAGAAGCCTGGCCG-3′, CTNNB1-Reverse 5′-TTCGGACTGGGGCAAAACAA-3′.
2.9 Bisulfate sequencing
Genomic DNA was bisulfate-treated using the EpiTect Bisulfite Kit Qiagen following the manufacturer’s protocol. Bisulfate-treated DNA was amplified by PCR with the following primers: CTNNB1 Forward: 5′-GAGTTGGCGCTGTTAACCATGTT-3′ and Reverse: 5′-CCGAGACACACACACAAAGTC-3′. PCR products were then cloned into the T-Easy Vector (Quanshijin Biotechnology, Beijing, China). For each treated group, 10 clones were randomly selected for sequencing, and the results were analyzed by QUMA, an online CpG methylation analysis tool (http://quma.cdb.riken.jp/).
2.10 Statistical Analysis
Statistical analysis was performed using Prism 6 software. All experiments were carried out at least three times, and the results are presented as the mean ± standard deviation. The sample sizes were determined by power analyses, based on variation shown in our previous experiments and predicted effect sizes considered to be biological significant. No data were excluded from any analyses and all replicates were true biological replicates. Statistical significance between two samples and among multiple samples was assessed by using the one-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test. Survival curves were plotted using the Kaplan–Meier method and compared using the log-rank test. Correlations were determined by Pearson’s correlation. P-values < 0.05 were considered statistically significant.