Subjects
Skin samples from subjects between the ages of 26 and 78 years were obtained from Biopredic International, Rennes, France. Studies were conducted in accordance with the principles of the Declaration of Helsinki, and all participants had given written, informed consent to provide samples for research. The characteristics of the donors are summarized in Supplementary Table S1. Skin samples were fixed in cold acetone (AMeX procedure) and embedded in paraffin for immunohistochemical observation using specific antibodies.
Materials
Heparanase inhibitor 1-[4-(1H-benzoimidazol-2-yl)phenyl]-3-[4- (1H-benzo-imidazol-2-yl)phenyl]urea (BIPBIPU), MMP inhibitor N- hydroxy-2(R)-[[(4-methoxyphenyl)sulfonyl](3-picolyl)amino]-3-methylbutanamide hydrochloride (CGS27023A), and bi-functional inhibitor hydroxyethyl imidazolidinone (HEI) were synthesized at Shiseido Co. Ltd. (Yokohama, Japan) according to the reported methods 11,39,40.
Skin Equivalent (Se) Model
The SE model (EFT-400) and medium (EFT-400-ASY) were purchased from MatTek Corp. (Ashland, MA). The SE model was cultured in the presence or absence of 0.1 mg/mL HEI, BIPBIPU (10− 5 M) and/or CGS27023A (10− 5 M) as described 11. At 4 days after the start of culture, samples were fixed in cold acetone (AMeX procedure) and embedded in paraffin for immunohistochemical analysis. At 4 days after the start of culture, samples were separated into epidermis and dermis, and RNA was extracted for quantitative PCR analysis 11.
Organotypic Human Skin Model
Fresh human abdominal skin (from 4 females aged 22–32; the characteristics of the donors are summarized in Supplementary Table S2) (Biopredic International, Rennes, France) was cut into 1.5 × 1.5 cm pieces, which were cultured in the presence or absence of 0.1 mg/mL HEI, BIPBIPU (10− 5 M) and CGS27023A (10− 5 M) after UVB irradiation (50 mJ/cm2) as described 11. At 5 days after the start of culture, samples were fixed in cold acetone (AMeX procedure) and embedded in paraffin for immunostaining 11.
Immunohistochemistry
Each section was incubated overnight at 4°C with primary antibodies targeting Type I procollagen (ab64409, rat mAb, Abcam, Cambridge, UK), Type III collagen (ab6310, FH-7A, mouse mAb, Abcam, Cambridge, UK), Type V collagen (AM10159PU-N, V13F6, mouse mAb, Acris, San Diego, CA), keratin-14 (20R-CP002, guinea pig pAb, Fitzgerald Industries International, Acton, MA) and PDGFRbeta (MAB1263, mouse mAb, R&D Systems, Minneapolis, MN). Primary antibodies were detected using Alexa488- or Alexa594-conjugated secondary antibody (Thermo Fisher Scientific). Sections were examined with an Olympus BX51 microscope (Olympus, Tokyo, Japan) and images were captured with a DP72 controller digital camera (Olympus).
Transmission electron microscopy
After 4-day culture (skin equivalent model) or 5-day culture (organotypic abdominal skin model), samples were immersed in glutaraldehyde fixative at 4°C overnight and then rinsed in 0.1 M phosphate buffer for 30 min at room temperature as described 10. Samples were fixed in 1% OsO4 for 30 min at room temperature and then rinsed in triple-distilled water, embedded and subjected to routine processing. Finally, thin sections were stained with uranyl acetate and lead citrate and examined with an electron microscope (JEM-1400; JEOL Ltd., Tokyo, Japan) 10.
Cell Culture
Human normal epidermal keratinocytes from donors of various ages (for details, see Supplementary Table S3) (Biopredic International, Rennes, France) were cultured in Humedia-KG2 (KURABO, Osaka, Japan). Human dermal fibroblasts from donors of various ages (for details, see Supplementary Table S4) (Biopredic International, Rennes, France) were cultured in DMEM containing 10% FBS (Gibco, Tokyo, Japan). Culture flasks were incubated at 37oC in a humidified atmosphere with 5% CO2. 2.5×105 keratinocytes or fibroblasts were seeded into 6-well plates coated or not coated with iMatrix-511, and incubated for 24 hours. RNA was extracted from each sample for quantitative PCR analysis and protein was extracted using RIPA lysis buffer (Nacalai tesque, Kyoto, Japan) for protein array analysis.
Quantitative Real-time Rt-pcr
Quantitative real-time RT-PCR
Total RNAs from cultured keratinocytes, fibroblasts, and separated epidermis and dermis from the skin equivalent model were isolated using the Qiagen Rneasy mini kit (Qiagen) and cDNA was synthesised using SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific). Expression of COL5A1, COL3A1, COL1A1, PDGFB, PDGFRB, B2M and GAPDH genes was analyzed by means of quantitative PCR using Platinum SYBR Green qPCR superMix-UDG (Invitrogen Japan, Tokyo, Japan), as described 41. Primer sequences used were as follows: COL5A1 forward; 5’-GTGGCACAGAATTGCTCTCA-3’, COL5A1 reverse; 5’-TCACCCTCAAACACCTCCTC-3’, PDGFRb forward; 5’-CCTCAT- CATGCTTTGGCAGAAGAA-3’, PDGFRB reverse; 5’-GCTCATGTCCATGTA- GCCACCGTC-3’, COL3A1 forward; 5’-TCCGGGTGAGAAAGGTGA-3’, COL3A1 reverse; 5’-GCAGGTCCAGAACCTCCAG-3’, COL1A1 forward; 5’-C- TCGAGGTGGACACCACCCT-3’, COL1A1 reverse; 5’-CAGCTGGATGGCCA- CATCGG-3’, B2M forward; 5’-GTGGGATCGAGACATGTAAGCA-3’, B2M reverse; 5’-CAATCCAAATGCGGCATCT-3’, GAPDH forward; 5’- GAAGGTG- AAGGTCGGAGTC-3’, GAPDH reverse; 5’- GAAGATGGTGATGGGATTTC -3’.
Membrane Protein Array
After 4-day culture of the skin equivalent model in the presence of MMP inhibitor and heparinase inhibitor, the epidermis was separated from the dermis, and harvested using RIPA lysis buffer (Nacalai tesque, Kyoto, Japan). After 1-day culture on iMatrix-511 coated or non-coated plates, keratinocytes were harvested using RIPA lysis buffer. Protein concentration of the tissue lysates was normalized by using BCA protein assay (Nakarai, Tokyo). The levels of 41 cytokines in the tissue lysates were measured by using a membrane array (ab134002, Abcam, Cambridge, UK). Images were captured with a LAS-1000UVmini (FUJIFILM, Tokyo) and the signal intensity of each spot was calculated by analytical software, Multi Gauge Version 3.0 (FUJIFILM, Tokyo).
Clinical Study
Healthy Japanese female subjects (30–54 years old, n = 30) were enrolled in a single-blind study. HEI blended lotion was used to treat one side of the face, and placebo lotion was used on the other side. This study was carried out in March 2018 in Japan. It was conducted in accordance with the declaration of Helsinki protocols and was approved by the Ethics Committee of Shiseido (Approval number: B01471). The HEI-blended lotion or placebo lotion was applied twice a day for 4 weeks. Informed consent was obtained from all subjects before commencement of the study. Water-permeable barrier function of the cheek skin on each side was evaluated by measuring TEWL 3 times with a Vapometer at each time point. Hydration of the stratum corneum was also evaluated by measuring the skin conductance 3 times on each side with a Corneometer CM-825. Skin elasticity was evaluated by measuring Ur/Uf 3 times with a Cutometer. The thickness of the papillary dermis at the cheek was evaluated by scanning acoustic microscopy, as described 42.
Statistical analysis
Data are presented as mean values ± SD. Statistical significance was determined by analysis of variance (ANOVA) and P-values were calculated using Fisher’s protected least significant difference (Fisher’s PLSD) test.