The protocols used in this study were approved by the Animal Research Ethics Board of the University of Saskatchewan (Animal Use Protocol #20190042) and followed the Canadian Council of Animal Care guidelines for the care and use of farm animals in research.
Animals, housing, and experimental design
Details of the experimental procedure have been outlined previously [7]. Briefly, a total of 14 sows (Camborough Plus × C3378; PIC Canada Ltd.) were housed in farrowing crates at the Prairie Swine Centre (Saskatoon, SK) over 4 blocks and fed a standard commercial lactation diet. After farrowing, all piglets in the litter were individually weighed and identified as LBW or NBW based on previously established weight ranges in this population of pigs [8], with piglets < 1.5 kg initial body weight considered LBW. Postnatal nutrient restriction (RN) was induced in 4 target piglets per litter (2 LBW and 2 NBW) through isolation from the sow for 6 h/d from 0800–1400 h from d 3 post-farrowing to weaning (d 28), based on a modification of previously described methods [9, 10]. All other piglets were allowed unrestricted access to the sow [normal nutrition (NN)]. No additional feed was provided to the piglets before weaning. At the end of the suckling period, piglets were weaned onto a commercial nursery diet for 28 d (d 28–56 post-weaning) and housed in groups of 3–6/pen and fed standard commercial diets. At d 28 and 56 of the study, 8 pigs/treatment were euthanized with an overdose of isoflurane (oxygen flow at 1 L/min with 5% isoflurane) followed by exsanguination. After evisceration, sections of the small intestine (jejunum) were sampled and immediately snap-frozen in liquid nitrogen and then stored at -80◦C until analysis.
Enzyme activity assay
The enzyme activities of intestinal digestive enzymes including intestinal alkaline phosphatase (ALP), maltase, and sucrase were determined. Briefly, approximately 500 mg of pulverized and frozen jejunal tissue samples were thawed in an ice-cold homogenizing buffer consisting of 50 mM D-mannitol and 0.1 mM phenylmethylsulphonyl fluoride (PMSF) at pH 7.4 (Sigma-Aldrich Chemical Co. St. Louis, MO, USA) and homogenized on ice using a polytron homogenizer (Fisher Scientific, Ottawa, ON, Canada). After centrifugation (4000 rpm, 10 min, 4℃), the protein concentrations of the homogenate suspensions were determined using a BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA). Alkaline phosphatase (EC. 3.4.11.2) activity was assayed according to the method of Engström [11]. Potassium fluoride (Sigma-Aldrich Chemical Co. St. Louis, MO, USA) was added to inhibit the interference of intracellular acid phosphatase in the intestinal mucosa [12]. Incubations were conducted in a final volume of 0.50 mL containing homogenized tissue suspensions (0.100 to 0.200 mg protein), 2.0 mM potassium fluoride, 5.0 mM MgCl2, and 40.0 mM p-nitrophenyl phosphate (Sigma-Aldrich Chemical Co. St. Louis, MO, USA) at pH 10.5 for 15 min at 37℃. The enzyme reaction was stopped by adding 0.50 mL of 0.50 M NaOH (Sigma-Aldrich Chemical Co. St. Louis, MO, USA). The end-product of the enzyme reaction, p-nitrophenol, was measured using a Synergy™ H4 Hybrid Multi-Mode Microplate Reader (BioTek, Winooski, VT, USA) at 400 nm wavelength. Maltase (E.C. 3.2.1.20) and sucrase (E.C. 3.2.1.48) activities were assayed according to a previously established method [13]. Incubations were conducted in a final volume of 0.500 mL containing homogenized cell suspensions (0.200 to 0.300 mg protein), 100 mM maleate buffer (maleic acid dissolved in NaOH), and 60 mM maltose, 60 mM sucrose or 100 mM amylose, at pH 6.0 and 37℃ for 20 min. Incubations were terminated by adding 70 mM ZnSO4. The end-product of both enzyme reactions, D-glucose (Pointe Scientific, Inc.), was measured by spectrophotometric analysis at 500 nm. All enzyme assays were corrected for nonspecific blank readings.
Real time polymerase chain reaction (RT-PCR)
Total RNA of the jejunum tissue was extracted by the Trizol procedure (Invitrogen, Carlsbad, CA, U.S.) according to the manufacturer’s instructions. Total RNA was dissolved in 20 µL RNase-free water and concentration was determined using a NanoDrop 2000 Spectrophotometer (Nano-Drop Technologies, Wilmington, DE, U.S.) with purity ascertained (A260/A280) between 1.8 and 2.0. The total RNA (about 1 µg) from each sample was converted into cDNA using iScript cDNA Synthesis Kit (Bio-Rad, Mississauga, ON, Canada) according to the manufacturer’s instructions. The qPCR analysis was performed to quantify the target genes encoding for enzyme (ALP, SI), nutrient transporter (SGLT1, PepT1, EAAC1, ASCT2 and B0AT1) and barrier function genes (ZO-1 and Claudin-3), as presented in Table 1. The cyclophilin-A (Cyc-A) gene was used as the housekeeping gene. The relative changes in gene expression levels of genes in the jejunum tissues normalized against Cyc-A were determined by using the 2−∆∆CT method according to Livak and Schmitten [14].
Table 1
The primer sequences of the target genes and the internal reference gene
Gene Name | Sequence (5′-3′) | Accession Number | Product Size (bp) |
| Enzyme genes | | |
ALP | F: CCACTCCGCGCCACC | XM_021097682.1 | 76 |
| R: AAGAGCTCGTGGGTGAAGG | | |
SI | F: TGATAGGCCAGTGAGAGTGC | XM_021069748.1 | 99 |
| R: AGAGTTGAGTAAGGCTGCCA | | |
| Nutrient transporter genes | | |
SGLT1 | F: GGCTGGACGAAGTATGGTGT | NM_001164021.1 | 153 |
| R: ACAACCACCCAAATCAGAGC | | |
EAAC1 | F: GTTCCTGATTGCCGGGAAGA | NM_001164649.1 | 165 |
| R: ATGGCGAATCGGAAAGGGTT | | |
ASCT2 | F: GCCAGCAAGATTGTGGAGAT | XM_003355984.4 | 206 |
| R: GAGCTGGATGAGGTTCCAAA | | |
B0AT1 | F: AAGGCCCAGTACATGCTCAC | XM_0033559855.4 | 102 |
| R: CATAAATGCCCCTCCACCGT | | |
PepT1 | F: CATCGCCATACCCTTCTG | NM_214347.1 | 143 |
| R: TTCCCATCCATCGTGACATT | | |
| Barrier function genes | | |
ZO-1 | F: GATCCTGACCCGGTGTCTGA | XM_021098896.1 | 200 |
| R: TTGGTGGGTTTGGTGGGTT | | |
CLDN3 | F: CTACGACCGCAAGGACTACG | NM_001160075.1 | 123 |
| R: TAGCATCTGGGTGGACTGGT | | |
| Internal reference gene | | |
CycA | F: GCGTCTCCTTCGAGCTGTT | NM_214353.1 | 160 |
| R: CCATTATGGCGTGTGAAGTC | | |
ALP; alkaline phosphatase, SI; sucrase-isomaltase, SGLT1; sodium/glucose cotransporter 1, EAAC1; excitatory amino acid transporter 1, ASCT2; glutamine transporter, B0AT1; neutral amino acid transporter, PepT1; peptide transporter 1, ZO-1; zonula occludens-1, CLDN3; claudin 3, CycA; Cyclophilin-A. |
Statistical analysis
Data were tested for normality and outliers using the PROC UNIVARIATE model and the Shapiro–Wilk test in SAS version 9.4 (SAS Institute Inc.). Outliers were determined as a value ± 2 standard deviations away from the treatment mean using the studentized residual analysis. Different groups of piglets were sampled on d 28 and 56, and each time point was analyzed separately as a randomized complete block design with a 2 × 2 factorial arrangement. The fixed effects were 1) birth weight category (BWC) (LBW and NBW), 2) dietary treatment (RN and NN), and 3) their interaction. The block (sampling group) was included in the model as a random factor. Initially, gender effect was also included as a fixed effect model but was not significant hence removed from the model. Differences between treatment means were separated by the PDIFF option adjusted for Tukey-Kramer test. Significance differences were determined at P ≤ 0.05; a trend toward significance was considered at P < 0.10.