MicroRNA-155 Expression Is Associated With Pulpitis Progression By Targeting SHIP1

doi:10.21203/rs.3.rs-735774/v1

Download PDF

Research Article

MicroRNA-155 Expression Is Associated With Pulpitis Progression By Targeting SHIP1

https://doi.org/10.21203/rs.3.rs-735774/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Pulpitis is a commonly seen oral inflammation condition in clinical practice, it can cause much pain for the patient and may induce infections in other systems. Much is still unknown for the pathogenic mechanism of pulpitis. In this work, we discovered that the expression of miR-155 was associated with dental pulpal inflammation both in vivo and in vitro. Experiments on odontoblast cell line MDPC-23 showed miR-155 could act as a positive regulator by increasing the production of pro-inflammatory cytokines IL-1β and IL-6 during inflammatory responses, whereas knockdown of miR-155 can reverse the effects. Bioinformatics analysis demonstrated that SHIP1 is a direct target of miR-155 in odontoblasts, this result was further verified at both mRNA and protein level. Inhibition of miR-155 resulted in the downregulation of inflammation factors, while co-transfection of si-SHIP1 and miR-155 inhibitor promoted the inflammatory responses. Treatment with miR-155 mimic or si-SHIP1 up-regulated the protein level of p-PI3K and p-AKT. By contrast, miR-155 inhibitor exerted the opposite effects. miR-155 mimics could upregulated the gene expression of IL-1β and IL-6. Co-transfection of LY294002 and miR-155 mimic attenuated the inflammatory responses. Consistent with in vitro results, miR-155^-/- mice could alleviate inflammatory response, as well as decrease the activation of p-PI3K and p-AKT, whereas increase the activation of SHIP1. In conclusion, these data revealed a novel role for miR-155 in regulation of dental pulpal inflammatory response by targeting SHIP1 through PI3K/AKT signaling pathway.

Immunology

Allergy & Immune Disorders

Pulpitis

MicroRNA-155

SHIP1

PI3K/AKT

Pulpitis is a prevalent chronic inflammation in the dental pulp. Bacterial infection into the pulp tissue is one of the primary causes, cells in the pulp under the stimulation of bacterial components can release a variety of inflammatory factors, leading to severe pain [1]. Pulpitis can induce infections and other conditions in distant systems if not treated properly in time [2]. Researchers have studied many aspects of inflammatory mechanism in the dental pulp, which including pathogen factors, related signal pathways and the response of pulp cells like fibroblasts and odontoblasts [3]. Among them, reports have been made about the possible involvement of microRNAs in the process of pulpitis [4].

MicroRNAs are small non-coding RNAs that regulate gene expression by binding to complementary sequences found in the 3′UTR of target mRNAs, thus repressing translation, or degrading the expression of mRNA. Varies of microRNAs are expressed in dental pulp and periodontal tissues, it has been reported that microRNAs can work as factors in oral inflammations [5, 6]. Researches on miR-155 have found it is a multifunctional factor which regulates inflammation in cancers, lung disease and coronary heart diseases [7, 8]. Previous studies have revealed that miR-155 has been recognized as an important biomarker in oral diseases. As it can regulate the proliferation, cell cycle and apoptosis of oral cancer [9]. It can also participate in the immune process of oral lichen planus and periodontal and peri-implantation diseases [10, 11]. Yue et al. have demonstrated that miR-155 may play an important role in apical periodontitis progression, which indicates that miR-155 is implicated in the regulation of apical periodontal inflammation [12]. For the mechanism of miR-155 regulation, previous studies have demonstrated that the miR-155 can downregulate SHIP1 in macrophages [13] and reduce collagen production and endothelia-mesenchymal transition in lung fibrosis [14]. However, for the progression of pulpitis, the mechanism of miR-155 modulates dental specific cells like odontoblasts on pulpal inflammatory responses is yet to be testified.

In this study, we explored the role of miR-155 in pulpal inflammation, attempting to find its interaction with other factors and signal pathways for the regulation. Results show that miR-155 could act as a positive role in regulation of inflammatory response by repressing SHIP1 through enhancing PI3K/AKT signaling activation.

Ethical declaration

All animal experiments were conducted under the protocols approved by and in accordance with the guidelines of the Institute Animal Care and Use Committee of the University (approval number: GY2018-096).

Induction of Pulpal Lesion on Mice

In this study, Pulpitis model was established as our previous work described [15]. In brief, C57BL/6 mice were acquired from the Guangdong Medical Laboratory Animal Center. Exposed pulp group (n = 10) mice were anesthetized with intra-abdominal injection of pentobarbital sodium (50mg/kg). Their dental pulp of maxillary first molars were opened on the occlusal surface. This procedure was carried out with #1/4 dental round diamond burs on high-speed handpieces and operated under a surgical microscope. Mice without treatment were set to control group (n = 10). Animals were sacrificed at time points of 1, 6, 12 and 24 hours after operation. Five samples were used for histopathological and immunohistochemical analysis, while the other 5 maxillae sections were prepared for analysis of IL-6, IL-1β and miR-155. Study of gene knockout animals was set with fifty miR-155^−/− mice, which were purchased from the Jackson Laboratory, USA.

Cell culture and treatment

Mice odontoblast-like cell lines MDPC-23 cells (Cell Bio, Shanghai, China) were cultivated in Dulbecco's Modified Eagle's Medium (DMEM, Sigma, MO, USA) containing 10% fetus bovine serum (FBS) and 1% of penicillin/streptomycin mixture at 37ºC and 5% CO₂. We observed the cells growth to cover 70–80% of the flask surface as an indication for LPS activation. The original medium was discarded and additional 1µg/mL LPS (Sigma) was used to stimulate cell inflammation for 3 hours, 6 hours, 12 hours, and 24 hours in different groups.

Cell transfection

MDPC-23 cells were transfected with miR-155 mimic, miR-155 inhibitor, miRNA negative control (miR-NC) and siRNA (RiboBio, Guangzhou, China) for 48hours using the riboFECT CP transfection reagent (RiboBio) following the manufacturer’s protocol. After transfection, the stably transfected cells were treated with medium containing 1 µg/mL LPS for 12 hours [16].

Histopathological Analysis

The murine maxillae were dissected and fixed in 4% phosphate-buffered paraformaldehyde for 48 hours at room temperature. Then the samples were rinsed with PBS and decalcified with ethylene diamine tetra acetic acid (EDTA) solution for two weeks. After that, the samples were embedded in paraffin and cut into 4mm thick serial sections. Representational sections of each group were stained with hematoxylin-eosin (H&E) for further analysis.

Immunohistochemical Analysis

Animal samples were performed to immunohistochemical analysis according to a previously described protocol [16]. The primary antibodies were anti-PI3K p85 (1:300, Abcam, MA, USA), anti-AKT (1:300, Abcam) and SHIP1(1:300, Abcam), following by biotinylated secondary antibody. In each section, we chose three random different visions (× 400 magnification). Acquired photographs were analyzed with Image Pro Plus 6.0 software.

RNA isolation and quantitative real time-PCR (qRT-PCR)

Total RNA was extracted from cells or tissues using the Trizol reagent (Invitrogen, CA, USA) following the manufacturer’s protocol. Conversion into cDNA were performed with PrimeScript RT Master Mix and Mir-X miRNA First-Strand Synthesis Kit (Takara, Dalian, China) for mRNA and miRNA determination respectively. qRT-PCR analysis for mRNA and miRNA were conducted by using SYBR Premix Ex Taq II solution (Takara). The mRNA level of U6 and GAPDH were used as normalization controls.

The following are the primer sequences: miR-155: forward ACACTCCAGCTGGGTTAATGCTAATTGTG and reverse CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCCCTAT; IL-6: forward TCACAGAAGGAGTGGCTAAGGACC and reverse ACGCACTAGGTTTGCCGAGTAGAT; IL-1β: forward ACGGCCTTCCCTACTTC and reverse GCTGGACTGTTTCTAATGC; SHIP1: forward GTACAACTTGCCGTCCTGGT and reverse TGTGACTCCTGCTTCAAACG; GADPH: forward AGAAGGTGGTGAAGCAGGCATC and reverse AGAAGGTGGTGAAGCAGGCATC; U6: forward CTCGCTTCGGCAGCACA and reverse AACGCTTCACGAATTTGCGT.

Western Blot

The proteins were extracted with RIPA lysis buffer (Thermo Fisher, IL, USA). Protein concentration was determined with bicinchoninic acid (BCA) quantitative detection reagent kit following manufacturer’s protocol (Epizyme Biotech, Shanghai, China). Western Blot was carried out in following steps: Proteins were separated with 10% SDS-PAGE electrophoresis and transferred on PVDF membranes, following manufacturer’s protocol (Epizyme). We then probed proteins with primary antibodies: anti-PI3K p85 (1:2000, Abcam), anti-AKT (1:2000, Abcam), anti-SHIP1 (1:1000, Abcam, Cambridge, UK) and GAPDH (1:6000, Abcam) in 4℃ overnight. Then the membranes were incubated with secondary antibody of goat anti-mouse IgG (Proteintech, IL, USA) carrying alkaline phosphatase for 1h at room temperature. We detected the membranes using BCIP/NBT kit. (Beyotime, Shanghai, China) following the protocol. Quantification was calculated with Image Pro Plus 6.0 software.

Luciferase reporter assay

The SHIP1 3′UTR target site and the luciferase reporter constructs carrying a putative miR-155-binding site were amplified by PCR (Promega, WI, USA). Cells were cultured on 48-well plates and co-transfected with psiCHECK-2 luciferase reporter plasmid, miR-155 control were transfected with double luciferase reporter vector plasmid. Plates were incubated in a CO₂ incubator at 37°C for 24 ~ 96 hours. Dual Luciferase Reporter Assay (Promega) was performed to calculate relative luciferase activity after 24 h transfection following manufacturer’s protocol.

In brief, the pre-configured Luciferase Assay Reagent was added to the samples, we measured the luciferase reaction intensity (hLuc fluorescence value) and the internal reference Renilla fluorescence value (hRluc fluorescence value). Every sample was performed with three times repeat. The hLuc/hRluc ratio and the ratio of the control wells were statistically analyzed for verification of the accuracy of miRNAs' target sites. This procedure was set to determine whether the predicted binding site mutations will change the effects of miRNAs.

Enzyme-linked immunosorbent assay (ELISA)

The culture medium collected from the cells of different groups were measured directly by ELISA to quantify the production of IL-1β and IL-6 according to the manufacturer’s protocol (R&D Systems, MN, USA). The results were analyzed with an enzyme - labelled meter (Thermo Fisher Scientific, MA, USA)

Statistical analysis

Data is presented as mean ± standard deviation (SD) for at least three independent experiments. Differences between groups were subjected to t-test or one-way ANOVA using SPSS statistics 16.0 (SPSS Inc, Chicago, IL, USA). The values of p < 0.05 was considered to be statistically significant.

miR-155 is a related regulator in pulpal inflammation animal model

In this study, we first explored miR-155 involvement in pulpitis with a C57BL/6 mice model. Experimental pulpal exposure C57BL/6 mice was established, and time points were set at 1, 6, 12 and 24 hours. The expressions of inflammatory factor IL-1β and IL-6 were both gradually increased in pulpal tissues (Fig. 1A, B). To discover the role of miR-155 in pulpal inflammation, we measured the miR-155 expression by qPCR. Results showed that miR-155 expression was lower in the pulpitis group compared to the control group, but its expression increased as the inflammation progressed (Fig. 1C). These results suggested that miR-155 is an involving factor of pulpitis in mice.

miR-155 is involved in the reaction of MDPC-23 cells to LPS treatment

The role of miR-155 on the regulation of LPS-treated MDPC-23 cells was evaluated to assess expression of miR-155 in vitro. Cells were stimulated with 1 µg/ml LPS for 3h, 6h, 12h and 24h time periods. Results showed IL-1β and IL-6 expression was increased in MDPC-23 cells (Fig. 1D, E). qPCR results of LPS-treated MDPC-23 cells showed that miR-155 was obviously down-regulated in LPS-stimulated cells compared to those at control group (Fig. 1F).

miR-155 down-regulation in tissues and LPS-stimulated cells suggest that miR-155 may be an involving factor of pulpal inflammation in odontoblasts.

miR-155 modulates LPS-induced inflammation in MDPC-23 cells

MDPC-23 cells were transfected with miR-155 mimic or control, cells were stimulated with LPS as previous mentioned. Pro-inflammatory cytokines including IL-1β and IL-6 were measured by qRT-PCR and ELISA assay. qRT-PCR was performed to assess the efficiency of transfection (Fig. 2A, B). qRT-PCR and ELISA results showed that overexpression of miR-155 can increase the mRNA and protein levels of IL-6 and IL-1β after exposure to LPS (1 µg/mL) for 12h. In addition, we use miR-155 inhibitor to investigate whether down regulation of miR-155 could induce opposite impacts. As expected, the data confirmed that the expression and production of IL-6 and IL-1β were decreased compared with control group (Fig. 2C-F). Taken together, these results demonstrated that miR-155 plays a positive regulative role in LPS-induced inflammatory productions.

miR-155 deficiency significantly alleviates pulpal inflammatory responses in vivo

To further examine the role of miR-155 in vivo, experimental pulpal animal models was established with C57BL/6 mice and miR-155^−/− mice. Results demonstrated that the miR-155^−/−mice exhibited mild damage of acute inflammatory cells compared with the C57BL/6 mice as measured by H&E staining assays (Fig. 3A). Additionally, qRT-PCR analysis also confirmed that the expression level of IL-6 and IL-1β was decreased in miR-155^−/− mice at 6 hours and 12 hours (Fig. 3B), indicating that miR-155^−/− mice results in lower susceptibility to pulpitis in animal model.

miR-155 increase inflammatory responses through directly targeting SHIP1 3′UTR

To explore how miR-155 regulated LPS-induced dental pulp inflammation, we use three publicly available algorithms (miRBase, TargetScan and miRanda) to identify potential target genes of miR-155. These results plus with the support of earlier reports [17] showed that SHIP1 is highly likely to be the target gene of miR-155(Fig. 4A). To confirm the association of miR-155 and SHIP1 in odontoblasts, 3′UTR regions of mouse SHIP1 containing putative binding site for miR-155 was constructed in psiCHECK2 by using Dual-Luciferase Reporter assays. As shown in Fig. 4B, overexpression of miR-155 repressed the luciferase activity in wild-type 3′UTR, whereas no difference was observed when cells were transfected with the SHIP1 mutant 3′UTR. Moreover, the data showed that the expression of SHIP1 was significantly decreased in miR-155-overexpressing cells at both the mRNA and protein levels, whereas knockdown of miR-155 can increase the expression of SHIP1 (Fig. 4C, D). Hence, these results demonstrate that miR-155 directly interacts with 3′ UTR of SHIP1.

miR-155 regulates LPS-stimulated inflammatory responses by inhibiting SHIP1 and the activation of PI3K/AKT pathway

Investigation was performed to determine whether SHIP1 directly contributes to miR-155 function in pulpitis. MDPC-23 cells were co-transfected with miR-155 inhibitor combined with si-SHIP1. Our data suggested that the down regulation of inflammation mediated by miR-155 inhibitor was abolished by the knockdown of SHIP1 (Fig. 5A, B). In summary, these data further confirm that miR-155 regulates LPS-induced dental pulp inflammatory reactions by mediating SHIP1.

Previous studies have identified miR-155 remarkably promoted pro-inflammatory secretions through PI3K/AKT activation [18]. To investigate whether miR-155 increases LPS-induced inflammatory factor expression through PI3K/AKT pathway, MDPC-23 cells were transfected with miR-155 mimic or inhibitor with LPS stimulation to examine the expression of p-PI3K and p-AKT by western blot. As shown in Fig. 5C, the transfection with the miR-155 mimic obviously up-regulated the protein level of p-PI3K and p-AKT. In contrast, knockdown of miR-155 markedly inhibited the p-PI3K and p-AKT in protein level. Furthermore, the results suggested that the protein level of p-PI3K and p-AKT were up regulatedby the knockdown of SHIP1. In addition, the results showed that co-transfection of LY294002(PI3K/AKT inhibitor) and miR-155 mimic attenuated LPS-induced inflammatory effect of miR-155 mimic in MDPC-23 cells (Fig. 5D, E). Taken together, these findings provide evidence that miR-155 plays a positive role in LPS-induced inflammatory responses of MDPC-23 by inhibiting SHIP1 via PI3K/AKT pathway, thus promoting inflammation mediator production.

miR-155 deficiency significantly alleviates pulpal inflammatory responses leads to increase SHIP-1 expression by decreasing the activation of PI3K/AKT signaling in experimental pulpitis mice.

To compare the results in vitro, we then evaluated whether the change in miR-155 could modulate pulpal inflammation through PI3K/AKT signaling pathway in vivo. An expression analysis of SHIP1, p-PI3K and p-AKT was performed by using Immunohistochemistry and found that SHIP1 was significantly increased in miR-155^−/− mice, whereas p-PI3K and p-AKT were decreased at 6 hour compared with C57BL/6 group, suggesting that the knockdown of miR-155 could contributes to relieve the inflammatory responses in experimental pulpitis (Fig. 6A, B).

Recent studies have identified miR-155 as critical regulators in various physiological and pathologic processes, including hematopoietic stem-progenitor cells differentiation, inflammation, infections, and immune process of cancer formation [19, 20, 21]. The different functions of miR-155 in different tissues, is calling for studies to identify its role in particular circumstances. Emerging evidence has indicated that miR-155 have a direct impact on the expression of inflammatory cytokines in biological processes of periodontal disease [6]. The close relationship between miRNAs and periodontal disease, meaning that miR-155 could be considered as possible novel biomarkers for periodontal disease [22, 23]. Another study has demonstrated that miR-155 may be involved in the regulation of progression in apical periodontal disease by directly targeting SEMA3A [12]. The role and mechanism of miR-155 has attracted the attention of scholars about the prospection of a potential diagnosis marker and targets of therapeutic methods [24]. The pathogenesis of pulpitis is characterized by its inflammation environment, which resembles those oral diseases mentioned above. Due to the similarity, miR-155 involvement in the pathologic processes of pulpitis, along with its detailed mechanism, is worthwhile for exploration. In our study, we utilize previously established experimental pulpitis animal models to observe whether miR-155 is also the biomarker in pulpitis [15]. The results showed that the expression of miR-155 was down-regulated in experimental pulpitis, which indicates that miR-155 could be recognized as a related factor in pulpal inflammation. By comparing with previous reports of miR-155’s involvement in inflammation [25, 26], which generally state that miR-155 a promotor of inflammation, we deduced that miR-155 also acts as a pro inflammation factor in dental pulp, and our further experiments below proved it. For the explanation of the downregulation of miR-155 in animal model, the reasonable deduction can be that its expression was suppressed by negative regulation mechanism in the initial stage, as literatures have reported [27, 28].

During the progress of inflammation in pulpal tissues, odontoblasts are considered to be one of the first cell populations to sense the gram-negative bacterial stimulation [29]. Therefore, we chose MDPC-23 cells for our in vitro study. Lipopolysaccharide (LPS) is an important component of the gram-negative bacteria, participates in the inflammatory cytokine-mediated pathogenesis of pulpitis [30, 31]. The expression levels of pro-inflammatory cytokines are identical biomarkers for inflammation [32]. LPS can induce cells to express the pulpal inflammatory factor IL-6 and IL-1β, which are the criteria for the diagnosis of pulpal inflammation [33, 34]. In LPS-induced MDPC-23 cells, miR-155 was down-regulated. It was found that the expression of miR-155 and inflammatory factors were not in a linear relationship according to the development of inflammation but fluctuating one. miR-155 first decreased compared to the control group, and then showed a trend to growth according to the timeline. These results shared a similar trend with our murine pulp exposure model. This may indicate that the expression of pro-inflammatory factors may be regulated by a variety of factors. miR-155 was firstly suppressed and mainly activated at the later development stage of inflammation. Our observations in vitro and in vivo suggested that there was a close link between miR-155 and pulpal inflammation.

Our experiments in vitro showed that overexpression of miR-155 can increased the production of IL-1β and IL-6. Furthermore, knockdown of miR-155 decreased IL-1β and IL-6 at mRNA levels. The experimental pulpitis model with gene knockout animals was established to further investigate the biological function of miR-155. Consistent with the finding in vitro, miR-155^−/− mice inhibited the expression of IL-6 and IL-1β compared with the miR-155 C57BL/6 group. Our findings have illustrated that miR-155 modulates pulpal inflammation by promoting the expression of IL-6 and IL-1β in vitro and in vivo.

For the downstream regulatory mechanism of miR-155, SHIP1 has been reported as an important factor [17]. In the searching for the most prominent targets of miR-155 in odontoblast, our bioinformatics results confirmed that SHIP1 was one of the most important factors in dental inflammation. Many reports have stated that SHIP1 is a key factor for miR-155 regulation in inflammation, fibrosis, and other immune processes [14, 21, 35]. We verified that miR-155 directly interacted and regulated the expression of SHIP1 in pulpal inflammation. Overexpression of miR-155 led to an obvious decrease of SHIP1 at mRNA and protein level. Furthermore, when co-transfected miR-155 inhibitor and si-SHIP1, the pro-inflammatory cytokines were notably upregulated compared with the miR-155 inhibitor group at mRNA levels. That means the inhibition of inflammatory effects induced by the knockdown of miR-155 was reversed by si-SHIP1. All above evidence demonstrate that miR-155 regulates pulpal inflammatory reaction by targeting SHIP1.

The expression of SHIP1 is associated to PI3K and AKT phosphorylation expression [36]. PI3K is an upstream molecule of the AKT/mTOR signaling pathway and is a class of specific kinases that catalyze phosphatidylinositol lipids [37, 38]. According to relevant studies, miR-155 can mediate inflammatory responses by modulating PI3K/AKT pathway [13, 39]. Study have discovered that PI3K/AKT pathways worked as an effector of miR-155 and SHIP1 interaction in fibrosis of macrophages [13]. In pulpitis and dental pulp specific cells like the odontoblasts, their relationship still needs experimental evidence. In our study, further investigations demonstrated that overexpression of miR-155 or SHIP1 silence could enhance PI3K phosphorylation and AKT phosphorylation, whereas knockdown of miR-155 demonstrated an opposite trend in PI3K and AKT phosphorylation. LY294002 is a synthetic molecule, known to inhibit the activation of PI3K/AKT signaling pathway. It was used to further confirm the interaction of miR-155 and PI3K/AKT signaling pathway [40]. Our results demonstrated that LY294002 could reversed the inflammatory responses caused by miR-155 mimic. Similarly, in experimental pulpitis animal model, miR-155^−/− mice exhibited lower positive staining of p-PI3K and p-AKT than the mice in C57BL/6 groups. The protein expression in this part of the results showed a non-linear fluctuation, which may be related to the rapid progression of pulpitis in mice. The sharp destruction of inflammation in the pulp tissue of mice reduces the secretion of cells in the pulp tissue, resulting in decreased expression of related proteins.

According to the above results, miR-155 contributes to pulpitis by suppressing SHIP1 Meanwhile, the activation of PI3K/AKT signaling pathway is involved with miR-155-regulated pulpal inflammatory development.. The regulation of the miR-155-SHIP1-PI3K/AKT axis might set a novel mechanism for dental inflammation and for odontoblasts specifically. Nevertheless, further validation should be provided to investigate whether miR-155 can modulate inflammation through other regulatory mechanisms.

In summary, our work has showed that miR-155 is a positive regulator in the process of dental pulpal inflammation. miR-155 promotes the progression of pulpitis through downregulated SHIP1, and controls the downstream PI3K/AKT pathway, which in turn enhances the expression of IL-6 and IL-1β. Therefore, the inhibition of miR-155 could effectively alleviate pulpitis and cytokine secretion. These results might provide an insight for future clinical diagnosis and therapy developments.

Funding

This work was supported by the Guangzhou Health Commission (No. 20191A011108), Science and Technology Research Projects of Universities in Guangzhou (NO: 1201610402). The authors declare no potential conflicts of interest with respect to the authorship and/or publication of this article.

Conflict of interest

The authors declare that they have no conflict of interest.

Availability of data and material

The data used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

Mr. Baishun Li: performed experiments and analyzed data. Dr. Liyang Guo: analyzed data and drafted the manuscript. Ms. Ying He: assisted experiments. Mr. Xingran Tu: assisted experiments. Ms. Jialin Zhong: assisted experiments. Prof. Hongbing Guan: revised manuscript. Prof. Qianzhou Jiang: designed and administrated project. Prof. Yiguo Jiang: administrated project. All authors read and approved the final manuscript.

Ethics approval

All animal experimental procedures were approved by the Animal Ethical Committee in the School of Stomatology, Guangzhou Medical University, Guangzhou, China. Experiments were proceeded according to the guidelines and regulations (approval number: GY2018-096).

Informed Consent. Not applicable.

Consent to Participate. Not applicable.

Consent for Publication. The manuscript is approved by all authors for publication.

Emara, R.S., H.M. Abou El Nasr, and R.M. El Boghdadi. 2018. Evaluation of postoperative pain intensity following occlusal reduction in teeth associated with symptomatic irreversible pulpitis and symptomatic apical periodontitis: a randomized clinical study. Int Endod J. 52(3):288-296.
Nomura, R., S. Matayoshi, M. Otsugu, T. Kitamura, N. Teramoto, and K. Nakano. 2020. Contribution of Severe Dental Caries Induced by Streptococcus mutans to the Pathogenicity of Infective Endocarditis. Infect Immun. 88(7), e00897-19.
Galler, K.M., M. Weber, Y. Korkmaz, M. Widbiller, and M. Feuerer. 2021. Inflammatory Response Mechanisms of the Dentine-Pulp Complex and the Periapical Tissues. Int J Mol Sci. 22(3):1480.
Hui, T., C. Wang, D. Chen, L. Zheng, D. Huang, and L. Ye. 2017. Epigenetic regulation in dental pulp inflammation. Oral Dis. 23(1):22-28.
Sehic, A., A. Tulek, C. Khuu, M. Nirvani, L.P. Sand, and T.P. Utheim. 2017. Regulatory roles of microRNAs in human dental tissues. Gene. 596:9-18.
Li, C., W. Yin, N. Yu, D. Zhang, H. Zhao, J. Liu, J. Liu, Y. Pan, and L. Lin. 2019. miR-155 promotes macrophage pyroptosis induced by Porphyromonas gingivalis through regulating the NLRP3 inflammasome. Oral Dis. 25(8):2030-2039.
Mahesh, G., and R. Biswas. 2019. MicroRNA-155: A Master Regulator of Inflammation. J Interferon Cytokine Res. 39(6):321-330.
Zhang, B., B. Li, F. Qin, F. Bai, C. Sun, and Q. Liu. 2019. Expression of serum microRNA-155 and its clinical importance in patients with heart failure after myocardial infarction. J Int Med Res. 47(12):6294-6302.
Fu, S., H.H. Chen, P. Cheng, C.B. Zhang, and Y. Wu. 2017. MiR-155 regulates oral squamous cell carcinoma Tca8113 cell proliferation, cycle, and apoptosis via regulating p27Kip1. Eur Rev Med Pharmacol Sci. 21(5), 937-944.
Hu, J.Y., J. Zhang, J.Z. Ma, X.Y. Liang, G.Y. Chen, R. Lu, G.F. Du, and G. Zhou. 2015. MicroRNA-155-IFN-gamma Feedback Loop in CD4(+)T Cells of Erosive type Oral Lichen Planus. Sci Rep. 5, 16935.
Asa'ad, F., C. Garaicoa-Pazmiño, C. Dahlin, and L. Larsson. 2020. Expression of MicroRNAs in Periodontal and Peri-Implant Diseases: A Systematic Review and Meta-Analysis. Int J Mol Sci. 21(11), 4147.
Yue, J., D. Song, W. Lu, Y. Lu, W. Zhou, X. Tan, L. Zhang, and D. Huang. 2016. Expression Profiles of Inflammation-associated microRNAs in Periapical Lesions and Human Periodontal Ligament Fibroblasts Inflammation. J Endod. 42(12), 1773-1778.
Yang, L., L. Liu, H. Ying, Y. Yu, D. Zhang, H. Deng, H. Zhang, and J. Chai. 2018. Acute downregulation of miR-155 leads to a reduced collagen synthesis through attenuating macrophages inflammatory factor secretion by targeting SHIP1. J Mol Histol. 49(2), 165-174.
Tang, H., J. Mao, X. Ye, F. Zhang, and W.G. Kerr. 2020. SHIP-1, a target of miR-155, regulates endothelial cell responses in lung fibrosis. FASEB J. 34(2):2011-2023.
He. Y., Y. Gan, J. Lu, Q. Feng, H. Wang, H. Guan, and Q. Jiang. 2017. Pulpal Tissue Inflammatory Reactions after Experimental Pulpal Exposure in Mice. J Endod. 43(1), 90-95.
Ma, L., S.C. Wang, J. Tong, Y. Hu, Y.Q. Zhang, and Q. Yu. 2016. Activation and dynamic expression of Notch signalling in dental pulp cells after injury in vitro and in vivo. Int Endod J. 49: 1165-1174.
O'Connell, R.M., A.A. Chaudhuri, D.S. Rao, and D. Baltimore. 2009. Inositol phosphatase SHIP1 is a primary target of miR-155. Proc Natl Acad Sci U S A. 106(17):7113-7118.
Wang, W., H. Bian, F. Li, X. Li, D. Zhang, S. Sun, S. Song, Q. Zhu, W. Ren, C. Qin, and J. Qi. 2018. HBeAg induces the expression of macrophage miR-155 to accelerate liver injury via promoting production of inflammatory cytokines. Cell Mol Life Sci. 75(14):2627-2641.
Ghafouri-Fard, S., V. Niazi, and M. Taheri. 2020. Role of miRNAs and lncRNAs in hematopoietic stem cell differentiation. Noncoding RNA Res. 19;6(1):8-14.
Bergallo, M., V. Daprà, C. Calvi, P. Montanari, I. Galliano, and P. Ravanini. 2018. Is HERV-K and HERV-W Expression Regulated by miR-155 in Kidney Transplant Patients with Human Cytomegalovirus Infection? Intervirology. 61(1), 23-29.
Kandell, W.M., S.S. Donatelli, T.L. Trinh, A.R. Calescibetta, T. So, N. Tu, D.L. Gilvary, X. Chen, P. Cheng, W.A. Adams, Y.K. Chen, J. Liu, J.Y. Djeu, S. Wei, and E.A. Eksioglu. 2020. MicroRNA-155 governs SHIP-1 expression and localization in NK cells and regulates subsequent infiltration into murine AT3 mammary carcinoma. PLoS One.15(2):e0225820.
Xie, Y.F., R. Shu, S.Y. Jiang, D.L. Liu, and X.L. Zhang. 2011. Comparison of microRNA profiles of human periodontal diseased and healthy gingival tissues. Int J Oral Sci. 3(3), 125-134.
Zeng, Q., X. Tao, F. Huang, T. Wu, J. Wang, X. Jiang, Z. Kuang, and B. Cheng. 2016. Overexpression of miR-155 promotes the proliferation and invasion of oral squamous carcinoma cells by regulating BCL6/cyclin D2. Int J Mol Med. 37(5), 1274-1280.
Neagu, M., C. Constantin, S.M. Cretoiu, and S. Zurac. 2020. miRNAs in the Diagnosis and Prognosis of Skin Cancer. Front Cell Dev Biol. 28;8:71.
De Smet, E.G., H.P. Van Eeckhoutte, F. Avila Cobos, E. Blomme, F.M. Verhamme, S. Provoost, S.E. Verleden, K. Venken, T. Maes, G.F. Joos, P. Mestdagh, G.G. Brusselle, and K.R. Bracke. 2020. The role of miR-155 in cigarette smoke-induced pulmonary inflammation and COPD. Mucosal Immunol. 13, 423–436.
Wan, J., X. Yang, Y. Ren, X. Li, Y. Zhu, A.N. Haddock, B. Ji, L. Xia, and N. Lu. 2019. Inhibition of miR-155 reduces impaired autophagy and improves prognosis in an experimental pancreatitis mouse model. Cell Death Dis. 10, 303.
Chen, Y., W. Liu, T. Sun, Y. Huang, Y. Wang, D.K. Deb, D. Yoon, J. Kong, R. Thadhani, and Y.C. Li. 2013. 1,25-Dihydroxyvitamin D Promotes Negative Feedback Regulation of TLR Signaling via Targeting MicroRNA-155-SOCS1 in Macrophages. The Journal of Immunology. 190(7), 3687–3695.
Li, S., Y. Sun, L. Zhong, Z. Xiao, M. Yang, M. Chen, C. Wang, X. Xie, and X. Chen. 2018. The suppression of ox-LDL-induced inflammatory cytokine release and apoptosis of HCAECs by long non-coding RNA-MALAT1 via regulating microRNA-155/SOCS1 pathway. Nutr Metab Cardiovasc Dis. 28(11):1175-1187.
Hahn, C.L., and F.R. Liewehr. 2007. Innate immune responses of the dental pulp to caries. J Endod. 33(6), 643-651.
Renard, E., A. Gaudin, G. Bienvenu, J. Amiaud, J.C. Farges, M.C. Cuturi, A. Moreau, and B. Alliot-Licht. 2016. Immune Cells and Molecular Networks in Experimentally Induced Pulpitis. J Dent Res. 95(2), 196-205.
Sugiuchi, A., Y. Sano, M. Furusawa, S. Abe, and T. Muramatsu. 2018. Human Dental Pulp Cells Express Cellular Markers for Inflammation and Hard Tissue Formation in Response to Bacterial Information. J Endod. 44(6), 992-996.
Rechenberg, D.K., J.C. Galicia, and O.A. Peters. 2016. Biological Markers for Pulpal Inflammation: A Systematic Review. PLoS One. 11(11), e0167289.
Tokuda, M., T. Sakuta, A. Fushuku, M. Torii, and S. Nagaoka. 2001. Regulation of interleukin-6 expression in human dental pulp cell cultures stimulated with Prevotella intermedia lipopolysaccharide. J Endod. 27(4), 273-277.
Elsalhy, M., F. Azizieh, and R. Raghupathy. 2013.Cytokines as diagnostic markers of pulpal inflammation. Int Endod J.46(6), 573-580.
Mortazavi-Jahromi, S.S., M. Aslani, S. Omidian, A. Ahmadzadeh, Z. Rezaieyazdi, and A. Mirshafiey. 2020. Immunopharmacological effect of β-d-mannuronic acid (M2000), as a new immunosuppressive drug, on gene expression of miR-155 and its target molecules (SOCS1, SHIP1) in a clinical trial on rheumatoid arthritis patients. Drug Dev Res. 81(3):295-304.
Lu, Z.J., J.J. Wu, W.L. Jiang, J.H. Xiao, K.Z. Tao, L. Ma, P. Zheng, R. Wan, and X.P. Wang. 2017. MicroRNA-155 promotes the pathogenesis of experimental colitis by repressing SHIP-1 expression. World J Gastroenterol. 23(6), 976-985.
Wu, X., S. Chen, S.A. Orlando, J. Yuan, E.T. Kim, V. Munugalavadla, R.S. Mali, R. Kapur, and F.C. Yang. 2011. p85alpha regulates osteoblast differentiation by cross-talking with the MAPK pathway. J Biol Chem. 286(15), 13512-13521.
Liu, J., X. Wang, M. Zheng, and Q. Luan. 2018. Lipopolysaccharide from Porphyromonas gingivalis promotes autophagy of human gingival fibroblasts through the PI3K/Akt/mTOR signaling pathway. Life Sci. 211, 133-139.
Bhattacharyya, S., N.S. Balakathiresan, C. Dalgard, U. Gutti, D. Armistead, C. Jozwik, M. Srivastava, H.B. Pollard, and R. Biswas. 2011. Elevated miR-155 promotes inflammation in cystic fibrosis by driving hyperexpression of interleukin-8. J Biol Chem. 286(13), 11604-11615.
Chang, M.C., J.J. Lee, Y.J. Chen, S.I. Lin, L.D. Lin, E. Jein-Wen Liou, W. L. Huang, C. P. Chan, C. C. Huang, and J. H. Jeng. 2017. Lysophosphatidylcholine induces cytotoxicity/apoptosis and IL-8 production of human endothelial cells: Related mechanisms. Oncotarget. 8(63), 106177-106189.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

MicroRNA-155 Expression Is Associated With Pulpitis Progression By Targeting SHIP1

Archived Versions:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Archived Versions:

Version 1