Plant-parasitic nematodes associated with banana plants in Assiut Governorate:
Three sites (Assiut, Sahel-Selim and El-Fath) were selected for the nematode screening based on contrasting soil types and the availability of diverse Musa species under commercial cultivation. All sites had been commercial banana have favorable climatic conditions for Musa agricultural production.
Sampling and Collection:
Two to four banana plants were sampled for each accession at each site preferentially from recently flowering plants. Root and soil samples were collected from an approximately 30 cm x 30 cm area on two sides of each plant and placed into a plastic bag properly identified with the date, location, and cultivar name. All samples were transported in insulated boxes to protect samples from direct sunlight and temperature fluctuations. Samples were stored at 4°C until processing for nematode extraction.
Nematode extraction:
Cobb's decanting and sieving method [9] was used to extract the nematodes from a 100g combined soil sample, accompanied by amended Baermann procedure [10].
Taking 20g of pencil-thick banana feeder roots, gently wash them under tap water, cut them into little bits of 2-3 cm in length, split them longitudinally, and place them on double-layered facial tissue paper, then follow the amended Baermann procedure [10]. Keep this society to sit unmoved for 48 hours before collecting nematode suspension to examine under a microscope. After differential staining with NaOCl - acid fuchsin technique, the root samples were analyzed using a stereoscopic microscope (Carl Zeiss- Stemi 2000C) [11].
Estimate of nematode populations:
Flask containing stable nematode suspension was taking in a measuring cylinder to measurement the total quantity of nematode suspension acquired from 100g of soil. Nematodes stayed in the constant suspension were calculated under binocular microscope using multichambered counting plate. The nematode suspension from each location was spotted and mean of three aliquots was taken for calculating the population density per 100g of soil.
Processing of nematodes
The fixed nematode samples from each population were analyzed when using glycerol-ethanol method for morphological and morphometric studies [12]. The processed specimens were permanently placed in pure anhydrous glycerol. A small drop of glycerol was placed in the center of a clean glass slide (Borosil brand) that measured 76 mm 26 mm 1.25 mm. Approximately 8-10 processed nematode specimens were picked up and located in the middle of a glycerol drop with their heads leading in the same tren, ensuring that they were resting on the surface of the glass slide and not hovering on the surface of the drop. A microscopic cover glass measuring 18 mm was placed over the specimen and sealed with a paraffin wax ring [13].
Identification of Plant parasitic nematodes from different banana growing areas:
Important morphological and morphometric features of taxonomic significance have been studied in detail for each population of Plant parasitic nematodes obtained from different banana growing areas. The parameters used to characterize nematode species were developed initially by [14] and added to, modified and amended by [15,16] and others.
Identification of root-knot nematodes:
Morphometrical characterization:
Morphometric dimensions of Meloidogyne were specified on ten individual J2 from three center. J2 was tentatively mounted in water on glass slides before being spotted and measured at 100 magnifications with a compound light microscope (OMAX 40X-2000X digital binocular biological compound microscope) linked to a computer working Scope- Image- 9.0 Professional Imaging software. The optical microscope was used to measure five morphometric variables (stylet length, tail length, body length, hyaline terminus length, and the distance between the stylet base and the dorsal esophageal gland orifice (DEGO)).
Morphological characterization:
Sections of infected roots should be immersed in 0.9% NaCl. Using a dissecting microscope, separate females from roots by needle and a scalpel and transfer the females to a petri dish with a small drop of 45% lactic acid. Push a female body out of a drop in a small isthmus of lactic acid solution, so that surface tension holds it in place. Insert the razor blade fragment into the slide and use a paper cutter to cut off the nematode's posterior. Using a dissecting needle, gently remove body tissue from the posterior section. In a small drop of glycerin, place the perineal pattern on a microscope slide. The internal surface of the cuticle should place against the glass then, cover slip placed on the glycerin drop. [17].
Molecular characterization:
DNA extraction:
The CTAB (cetyltrimethylammonium bromide) method was used to extract DNA from nematode isolates [18] with some modifications. Many adult females gained from each isolate were frozen in liquid nitrogen then, crushed using a suitable pestle and mortar. 600μl of CTAB extraction buffer was added to each sample and the mixture was then transferred to 1.5 ml Eppendorf tube. A volume of 50μl β-mercaptoethanol was added and all tubes were well vortexed for 15 sec and then incubated for about 40 min at 65o C in a water bath. After incubation, the tubes were kept at room temperature for 5-10 min, and 600μl chloroform: isoamyl alcohol solution (24:1 v/v) was then added to each tube, and the solution was gently mixed. The tubes were then subjected to a centrifugation (8,000 rpm at 4° C for 15 min). After the centrifugation, approximately 500μl of the upper aqueous phase (without any solid material) was transferred to a new 1.5 tube and an equal volume (500 μl) of cold isopropanol was added to each tube. The tubes were then slowly inverted several times and stored in the refrigerator overnight. A centrifugation (13,000 rpm at 4° C for 10min) was performed for the tubes. After the centrifugation, the supernatant was discarded and the DNA pellet was then washed by adding 1 ml of 70% cold ethanol, and a centrifugation (13,000 rpm at 4° C for 5 min) was performed. The tubes were kept at room temperature to allow the DNA pellet to air-dry (approximately 15 min). The dried DNA pellet was then resuspended in 100 μl TE buffer. DNA concentration (μg/ml) was determined for each sample by using spectrophotometer, and required dilutions were then performed to be used later for PCR.
Species-specific PCR assay:
A species-specific SCAR primer collection Table 1, selected from previous studies [19] as a specific marker for Meloidogyne javanica, namely Fjav/Rjav, was used to confirm morphological identification of nematode isolates. Amplifications were carried out in 25μl reaction mixtures containing 5-10 ng of genomic DNA, 1X PCR buffer, 1.5 mM MgCl2, 200 μM of each dNTP, 0.8 μM of each primer, and 1 U Taq DNA-polymerase and using the following PCR software in a Senso Quest Lab Cycler (SensoQuest GmbH, Göttingen, Germany): 5 minutes at 95° C, then 35 intervals of 1 minute at 94° C, 1 minute at 58° C, and 1 minute at 72° C, followed by one final extension period at 72° C for 10 minutes. PCR products were separated on a 1.5 percent agarose gel stained with ethidium bromide in 0.5 X TBE buffer using a horizontal gel electrophoresis unit. The size of each amplified DNA fragment was determined using a DNA ladder. The gel was run for about an hour at a constant voltage of almost 80 V, and then photographed using a gel documentation device under UV light. For each SCAR marker, the same band with the predicted size was then detected separately.
Table 1
SCAR primers were used to identify M. javanica at the molecular level.
Name of Primer
|
Fragment size (bp)
|
Sequence (5'-3')
|
Reference
|
Fjav/Rjav
|
670
|
GGTGCGCGATTGAACTGAGC CAGGCCCTTCAGTGGAACTATAC
|
[19]
|
Susceptibility of certain banana cultivars to M. javanica:
This experiment was conducted at the greenhouse of Plant Pathology Department, faculty of Agriculture, Assiut University. Nematode free seedlings, of four rootstocks; (Hindi, Magraby, Williams and Grand Naine) were used for evaluating their susceptibility to the Root-Knot nematode, M. javanica. They were obtained from the Horticultural research Centre, Giza. Three - month old seedlings of each cultivar were grown in 40cm pots filled with sterilized sandy-clay soil (4 Kg soil to each pot).
Inoculation of root-knot nematode was taken from the stock culture and nematode eggs were extracted from the roots using sodium hypochlorite 0.5 % solution [20]. After 25 days of seedling transplanting inocula was added as 5000 J2 per plant according to [21] with modify. The inocula were added in three holes around plant roots with micropipette and pots were watered daily and fertilized every week with 1 g /plant of NPK salt (1:1:1).
Data were recorded after 90 days from nematode inoculation. Nematode population was estimated using Baermann pan technique [22] as previously mentioned.
Plants with 0-2 egg-masses/plant were considered resistant (R), 3-10 egg-masses/plant moderately resistant (MR), 11-30 egg-masses/plant moderately susceptible (MS), 31-100 egg-masses/ plant susceptible (S) and < 100 egg-masses/plant highly susceptible (HS), [23].