Subjects
The subjects were recruited from the Periodontology Department of the Dental Hospital, Hasanuddin University, Indonesia. All methods were carried out in accordance with relevant guidelines and regulations. All experimental protocols in this study were reviewed and approved by Ethics Commission for Biomedical Research in Humans, Faculty of Medicine, Hasanuddin University. And informed consent was obtained from all subjects participate in this study. (Register Number UH09090137). The inclusion criteria for the subjects were age 25–60 years; no diabetes, tuberculosis (TBC), hepatitis, or human immunodeficiency virus (HIV); no smoking habit; no anti-inflammatory/contraception medications; and not pregnant/breastfeeding. Prior to the study, written informed consent was obtained from all subjects. A clinical examination, including the periodontal pocket depth (PPD) and clinical attachment loss (CAL) records, was performed on all subjects. The study group was divided into two groups: patients with CP (case group) and patients without CP (control group).
Laboratory analysis
The laboratory analysis was conducted in the Laboratory of Immunology and Molecular Biology, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia. Genomic DNA was isolated from peripheral leukocytes following a standard protocol. Polymorphisms were determined based on endonuclease restriction in exon 9 (TaqI) of the examined VDR gene using Restricted Fragment Length Polymorphism-Polymerase Chain Reaction (RFLP-PCR) and direct sequencing.
Examination method
A 0.5–1 mL sample of venous blood was withdrawn, and DNA was extracted and purified using the Boom method [24]. A 900 µL volume of L6 buffer solution was added to 1.5 mL tubes, followed by 100 µL of patient blood, and the mixture was homogenized for 30 min. A 20 µL diatomaceous earth suspension was added to the tube. The mixture was vortexed and stirred using a gyratory shaker at 100 rpm for 10 min. The mixture was vortexed again in an Eppendorf microcentrifuge for 15 seconds at 12.000 rpm.
The supernatant was washed twice with 1 mL of L2 washing buffer, and centrifuged for 15 seconds, then the supernatant was removed. The supernatant was washed twice with 1 mL 70% ethanol, vortexed, and centrifuged for 15 seconds. The acetone in the supernatant was separated by opening the vial cover and heating the vial at 56°C in a water bath or a dry block heater for 10 min. A 60 mL volume of TE elution buffer was added and vortexed to dissolve any sediment from the suspension. The tubes were incubated for 10 minutes at 56°C in a water bath.
Each tube was centrifuged at 12.000 rpm for 30 s and 40–50 µL of the supernatant was carefully transferred to a new vial, taking care not to touch the tip of the pipette to the sediment from the suspension. A 40 µL volume of TE elution buffer was added into the sediment and re-vortexed so that the sediment would dissolve in the TE elution buffer. The vials were incubated again in the water bath at 65°C for 10 min. At the end of the Boom procedure, a small amount of diatomaceous earth will be retained (about 1 µL of diatomaceous earth suspension in 100 mL TE elution buffer); this amount will have no effect on the PCR results of the sample. The extract was stored at -20°C or -80°C.
Amplification by PCR
Amplification by PCR was done in 32 cycles, consisting of denaturation for 1 min at 94°C, annealing for 1.5 min at 59°C and, extension for 2 min at 72°C. After completion of 30 cycles, chemidians were followed by heating at 72°C for 7 min. The amplification results were analyzed by agarose gel electrophoresis.
RFLP-PCR procedure
VDR gene polymorphisms were detected on exon 9 using specific primers: forward (CTGGGGAGCGGGGAGTATGAAGGA) and reverse (GGGTGGCGGCAGCGGATGTA). DNA amplification, conducted for RFLP, used the TaqI restriction enzyme. As much as 22.5 µL of PCR mix was combined with 2.5 µL of primer and 2.5 µL of DNA extraction reagent with a final volume of 25 µL. Paraffin was added to prevent evaporation and incubated at 37°C for 1 hour.
After amplification, 5 µL of PCR amplification results and 2 µL of loading buffer were mixed and loaded onto 1.5% agarose gels along with ethidium bromide. The gel was soaked in a container containing TBE buffer, and then electrophoresis was conducted at a steady voltage of 80 V for 1 h. The gel was removed and observed under UV light. Fragment bands at different distances from the sample indicated genotypic differences of the VDR gene polymorphisms. The differences were marked with the letter t (a restriction area is present) or the letter T (no restriction area is present). Genotypes based on the bands on agarose gels were classified as follows:
- (TT): no restriction area at 1398 bp
- (Tt): restriction areas are present at (946 + 452 bp) and 1398 bp.
- (tt): restriction areas are present at 946 bp and 452 bp.
DNA sequencing
Direct sequencing was carried out by Macrogen South Korea. Sequencing confirmed changes in the nucleotide base arrangement in exon 9 of the VDR gene. The Basic Local Alignment Search Tool (BLAST) and the NCBI database were used to analyze the sequencing results.
Statistical Analysis
SPSS version 11.5 was utilized for data analysis. Fisher's exact test was performed to determine the relationship between VDR gene polymorphisms and incidence of CP and to calculate the odds ratio (OR) variables as risk factors for CP. An independent t-test was conducted to detect phenotypic differences in CP.