Breast cancer cell lines
MDA-MB-231 and T47D breast cancer cells (ATCC, USA) were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Invitrogen, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and antibiotics (100 units of penicillin/ml and 100 mg of streptomycin/ml, Invitrogen, USA).
Transfection
MDA-MB-231 and T47D cells were transfected with either miR-328-3p mimic or miR-328-3p inhibitor (Invitrogen, USA) using lipofectamine 2000 (Invitrogen, USA). The breast cancer cells were incubated with transfection medium for no more than 6 h, then washed with PBS and grown in complete medium for further analyses. The scramble miRNA was used as negative control (Invitrogen, USA).
Quantitative real-time polymerase chain reaction (qRT-PCR)
MiR-328-3p level in breast cancer cells after transfection was examined by qRT-PCR. Briefly, breast cancer cells were incubated with cold TRIzol reagent (Invitrogen, USA) and total RNA was extracted. Reverse transcription was performed using High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific, USA). The RT-PCR were performed as follows: 95°C for 60s, 35 cycles at 94°C for 35 s, 60°C for 30 s, followed by a dissociation stage. The primers were synthesized by Sigma (USA) and the sequences were as follow: miR-328-3p forward: 5’- TTCCTAATGTTAAGT-3’ and reverse 5’- TCAGCTGAAGCTGCCGTAAGA -3’. U6 was used as the endogenous control.
Cell proliferation assay
The impact of miR-328-3p on MDA-MB-231 and T47D cells growth was determined by MTT assay. Briefly, transfected MDA-MB-231 and T47D cells were cultured in complete culture medium overnight at 37°C in a humidified incubator. Then different doses of radiation (0, 1, 2 and 4 Gy) were used to treat these breast cancer cells. On every the other day, MDA-MB-231 and T47D cells were incubated with MTT solution for 4 hours. The OD value was measured on a microplate reader at 570nm following by adding DMSO.
Caspase 3/7 activity-based apoptosis assay
The impact of miR-328-3p on radiation-induced apoptosis was determined by detecting caspase 3/7 activities. Briefly, transfected MDA-MB-231 and T47D cells were treated with different doses of radiation. Then Caspase-Glo reagent (Promega, USA) was added into the 96-well plates and incubated at room temperature for 2 hours. The caspase 3/7 activities were measured by luminometer (ThermoFisher, USA).
Transwell assay
Transwell assays either with or without Matrigel were performed to evaluate invasion or migration in MDA-MB-231 and T47D cells. Breast cancer cells (20,000 cells/chamber) in upper chamber were cultured with serum free medium, the lower chambers were added 0.7 ml medium with FBS. The invaded breast cancer cells on the membrane were stained and counted at 5 random fields under light microscope (100 x) after removal of the cells in the upper chambers.
Western blotting
Protein expression in transfected breast cancer cells was examined by western blot assay. Briefly, cold RIPA buffer was used to extract total protein from transfected breast cancer cells. Then protein was separated based on molecular weights using sodium dodecyl sulfate polyacrylamide gel electrophoresis. Polyvinylidene difluoride (PVDF) membrane was used to bind these proteins and incubated with primary antibodies (Table 1) for 18 hours. The PVDF membrane was washed with PBS and reacted with secondary antibodies for 1 hour. The protein bands are developed and analyzed.
Luciferase assay
The possible binding gene of miR-328-3p was identified with miRDB online tool. 3’-UTR of PTEN was amplified from normal human cells to include the possible miR-328-3p binding site. PmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, USA) was used to detect the luciferase activity. MDA-MB-231 cells were transfected with both miR-328-3p and Luc-PTEN and Dual-Luciferase Reporter Assay system (Promega, USA) was used to detect luciferase activities.
MiR-328-3p levels on human breast cancer tissue
Breast cancer tissues from 131 patients from 2011 to 2019 were obtained from Jilin University Hospital. The Jilin University ethical committee approved the study protocol. All patients signed the research consents during surgical procedures. RNA was extracted from formalin-fixed paraffin-embedded breast cancer tissue and qRT-PCR was done to determine miR-328-3p expression levels.
Immunohistochemical analysis
PTEN and Ki-67 immunostains were performed on automated stainer (Bond RX, USA) using FFPE breast cancer tissue.
Statistical analysis
Statistical difference was analyzed by one-way analysis of variance (ANOVA) coupled with Tukey correction and student’s t test. Differences were considered significant at P<0.05.