Animals and groups
The protocols of animal usage were approved by the Institutional Animal care and Use Committee of the Second Xiangya hospital of Central South University in compliance with NIH guidelines. Sprague-Dawley adult male rats with 250 to 300g were employed in our study. Animals were kept at a constant temperature and a 12/12h light/dark cycle. Rats (n = 54, 2 sacrificed) is randomized divided into three groups: (1) ICH + Berberine (Beri group, n = 17), rats were administered with berberine intragastrically (sigma, 50mg/kg) daily for 10 consecutive days before ICH and 3 days after ICH; (2) ICH + vehicle (vehicle group,n = 17); (3) sham-operated group (sham group, n = 18).
ICH models
Rats were anaesthetized with chloral hydrate and placed on a stereotaxic frame. 0.2U in 2.0 µL collagenase type IV was injected into the right hemisphere at 3.0 mm lateral to the midline, 0.2 mm anterior to bregma and 6 mm deep by micro pump with 5 minutes. The needle was maintained in brain for 5 minutes after injection. The sham group carried out the same procedures with no collagenase type IV injection.
Behaviour analysis
Neurological deficit scores were evaluated by modified neurological severity score (mNSS, n = 8) 24 and 72 hours after ICH. The mNSS is an 18-point scale and maximal deficit is 18. Rats from each group were assessment.
Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining
Perihematomal paraffin section (4µm, n = 4) was dewaxed with xylene and ethyl alcohol. Apoptosis was examined with a TUNEL staining kit (Roche, Swit) according to the manufacture’s instructions. The slide was examined with a fluorescence microscope (Olympus, Japan).
Immunofluorescence
Perihematomal paraffin section (4µm, n = 4) was dewaxed with xylene and ethyl alcohol. Brain section was antigenically repaired with EDTA buffer, added with spontaneous fluorescence quenching reagent and serum. Primary and secondary antibody were added. Antibody were included LC3B (Proteintech Inc, US, 18725-1-AP). Cell nucleus was stained with DAPI. Immunofluorescence was observed with a fluorescence microscope (Olympus, Japan).
Enzyme-linked immunosorbent assay (ELISA)
Perihematomal cerebral tissue(sham group n = 5, vehicle and Beri group n = 4 ) was obtained 72 hours after ICH. The levels of TNF-α, IL-1β, IL-6, IL-10 were examined by a commercial ELISA kit (Cusabio, China) according to the manufacture’s instructions.
qPCR
Total RNA (n = 5) was collected from perihematomal brain tissue 72 hours after ICH. The specific primer was used to synthesize the complementary DNA. PCR conditions were performed according the manufacturer’s instructions. The analysis of qPCR was used by a PCR instrument. Data was normalized to actin. mRNA expression was relative to sham group. The primer sequences were as follows: iNOS (forward, 5’- AGGCACAAGACTCTGACACCC-3’, reverse, 5’- CGCACTTCTGTCTCTCCAAA
CCC − 3’), CD32 (forward, 5’- TCAATCCCCAAAGCCAACCAC − 3’, reverse, 5’- ATAACAATGGCAGCTACAGCAA-3’), CD206 (forward, 5’- TATCTCTC
CAACCACGGCACCA − 3’, reverse, 5’- AGTATTTCTCTGCTTCGTGCCAT − 3’), Arg1 (forward, 5’- CATATCTGCCAAGGACATCGT − 3’, reverse, 5’- TCCAT
CACTTTGCCAATTCCC − 3’). RT-qPCR analysis was undergone with a Bio-Rad iCycler using their SYBR Green PCR mix (Bio-Rad, USA). RT-qPCR conditions were performed as the manufacturer’s instructions. Data were normalized to ß-actin.
Western blot
Protein(n = 4) was obtained from perihematomal tissue 72 hours after ICH. Protein were separated by SDA-PAGE electrophoresis, transferred to PVDF membranes and then incubated with primary antibodies. Primary antibodies included LC3 (Proteintech Inc, US, 14600-1-AP) and Beclin 1(Proteintech Inc, US, 11306-1-AP). Densities were analysis with ImageJ software.
Statistical Analysis
GraphPad Prism 5.01 software was used for statistical analyses. All data were presented as the mean ± standard deviation (mean ± SD). Comparisons between two groups were analyzed with Mann-Whitney test or ANOVA followed by Bonferroni test. Statistical significance was set as P<0.05.