Antibody and reagents
The following antibodies and reagents were purchased: Western blot used antibodys CD63 (Bioswamp, rabbit, PAB33929), CD81(abcam, rabbit, ab109201), TSG101 (Bioswamp, rabbit, PAB32949), Hhip (Bioswamp, rabbit, PAB40945), Ptch1 (Bioswamp, rabbit, PAB30041), Smo (Bioswamp, rabbit, PAB33618), GLi (Bioswamp, rabbit, PAB32098), GLiA (Bioswamp, rabbit, PAB30738), MRP1(Bioswamp, rabbit, PAB33537), ABCG2(Bioswamp, rabbit, PAB34152), P-gp (Bioswamp, rabbit, PAB30805), GAPDH(Bioswamp, rabbit, PAB36269), Goat anti-Rabbit IgG (Bioswamp, rabbit, PAB160011), flow cytometry used antibodys fluorescein isothiocyanate (FITC)-conjugated CD44 monoclonal antibody (eBioscience, 11-0441-82), allophycocyanin-conjugated CD29 (integrin beta 1) monoclonal antibody (eBioscience, 17-0291-82), FITC-conjugated CD11b monoclonal antibody (eBioscience, 11-0112-41), FITC-conjugated Ly-6A/E (Sca-1) monoclonal antibody (ebioscience,11-5981-82), immunofluorescence used Nano antibodys (rabbit, Mitaka, 14295-1-AP), OCT-4 antibody (rabbit, Abcam, ab181557), Alexa Fluor 594-conjugated goat anti-rabbit antibody (Bioswamp, PAB160018), SYBR Green PCR Kit (KAPA Biosystems, KM4101), Lipofectamine® RNAiMAX (Invitrogen, 13778030), RPMI-1640 (Hyclone, SH30809.01B), chemiluminescence kit (Millipore, WBKLS0010), Lipofectamine® RNAiMAX (Invitrogen, 13778030), Trizol (Ambion, 15596026), and reverse transcription kit (TAKARA, 639505).
Mice
The 4-week-old C57BL/6 mice (male) were from the Department of experimental animal, Harbin Medical University, weighing 16–18 g, and production license number SCXK(Hei)2019-001. The study was approved by the Second Affiliated Hospital of Harbin Medical University Ethics Committee and adhered to the “Guidelines for Animal Care and Use of the Ethics Committee at Hospital of Harbin Medical University” (approval number sydw-2018-083)
Mimics and inhibitors
The Cbfa1, OC, PPARγ2 et.al primers, miR-155- mimics and miR-155- inhibitors sequence was synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.
BMSC separation and identification
Male clean grade BALB/c mice (4–6 week) were housed at 22–26°C in a 12-hour light/dark cycle. According to the method of Yan et al.[13], the bilateral femurs were extractedom mice and the femoral bones were cut to expose the bone marrow cavity. The bone marrow cavity was repeatedly washed with the culture solution to collect and culture bone marrow cells. Hematopoietic stem progenitor cells were isolated from the cells at passage 3 using CD11b magnetic beads. The expression of cell surface antigens CD11b, CD44, CD29, and SCA-1 was detected by flow cytometry.
Exosome separation and identification and interaction with MPC-11 cells
The BMSCs were cultured in RPMI-1640 medium centrifuged at 500 × g for 10 min and the supernatant was collected and centrifuged at 2000 × g for 20 min. The supernatant was collected again and centrifuged at 100000 × g for 70 min. The precipitate was resuspended and centrifuged with a 40% sucrose gradient at 100000 × g for 70 min. The supernatant was collected and centrifuged at 100000 × g for 70 min, and the collected precipitate contained exosomes. 1×106 MPC-11 cells interact with 50 µg exosomes for 24 h. The expression of exosomal markers CD63, CD81, and TSG101 was detected using western blot [14].
Exosome morphological identification of electron microscope
Exosome were fixed with 2% glutaraldehyde (0.1M PBS, pH7.4) and integrated with nickel mesh and washing with PBS. The following is adding 1% glutaraldehyde dropwise to incubate for 5min and washing with ddH2O several times. Next is adding 4% uranium acetate to the sample and incubated for 5 minutes. After drying, the exosome morphology were observed under the electron microscope.
Cell transfection
The multiple myeloma cell line MPC-11 (Wuhan University Cell Bank, GDC300) and BMSCs was cultured in RPMI-1640 medium at 37°C in an incubator with 5% CO2. 3×105 cells in the logarithmic growth phase were seeded in 6-well plates with 2 mL cell culture medium.. For transfection, 100 pmol of miR and 5 µL of Lipofectamine® RNAiMAX were mixed with 250µL of Opti-MEM and added to 500µL cell culture medium,then mixed with 1.5 mL cell culture medium. The cells were divided into five groups: control, miR-155-mimics, miR-155-inhibitors, miR-155-mimics-NC, and miR-155-inhibitor-NC.
RNA extraction and quantitative reverse-transcription polymerase chain reaction (qRT-PCR)
Total RNA was extracted from cells using Trizol reagent and cDNA was generated using the reverse transcription kit. qRT-PCR was performed on a CFX-Connect 96 instrument (Bio-Rad) using the SYBR Green Master Mix. The reaction mixture for qRT-PCR consisted of 10 µL of SYBR Green Master Mix, 1 µL of primer mix, 1 µL of cDNA template, and 8 µL of double-distilled water. The conditions for qRT-PCR were as follows: pre-denaturation at 95°C for 3 min; 40 cycles of denaturation at 95°C for 5 s, annealing at 56°C for 10 s, extension at 72°C for 25 s; fluorescence signal acquisition between 65°C and 95°C. Using U6 as the internal reference gene, the primer sequences of each gene are shown in Table 1. 2−ΔΔCt method was used to calculate the relative miR expression. The primers are listed in Supplementary Table 1.
Table 1
Supplementary Table 1 Primer sequences for qRT-PCR
Primer | Sequence(5’-3’) |
Cbfa1-F | GTGTTCTAGCCAAATCCT |
Cbfa1-R | TTATGGGTGTTCCTCTGT |
OC-F | GGGCAATAAGGTAGTGAA |
OC-R | GTAGATGCGTTTGTAGGC |
PPARγ2-F | GCAGAGCAAAGAGGTGGC |
PPARγ2-R | TTTATTCATCAGGGAGGC |
adipsin-F | AGAATGCCTCGTTGGGTC |
adipsin-R | CGCAGATTGCAGGTTGTC |
GAPDH-F | CCTTCCGTGTTCCTAC |
GAPDH-R | GACAACCTGGTCCTCA |
miR-155-RT-F | CTCAACTGGTGTCGTGGAGTCGG |
miR-155-RT-R | CAATTCAGTTGAGACCCCTAT |
miR-155-F | GGGTTAATGCTAATTGTG |
miR-155-R | AACTGGTGTCGTGGAGTCGGC |
U6-F | CTCGCTTCGGCAGCACA |
U6-R | AACGCTTCACGAATTTGCGT |
Western blot
Cells were homogenized in protein lysate buffer and debris was removed by centrifugation at 12000 × g for 10 min at 4°C. After the addition of sample loading buffer, 50 µg of protein samples were electrophoresed and transferred to polyvinylidene difluoride membranes. The blots were blocked for 2 h at room temperature with fresh 5% non-fat milk in Tris-buffered saline/Tween 20 (TBST). The membranes were incubated with specific primary antibodies(CD63,CD81,TSG101, Hhip,Ptch1,Smo, Gli, GliA, MRP1、ABCG2、P-gp,GAPDH) in TBST overnight at 4°C. After three washes with TBST, the blots were incubated with secondary antibodies(Goat anti-Rabbit IgG) for 1 h, and the immunoreactive bands were visualized using an enhance chemiluminescence kit. The density of the immunoreactive bands was analyzed using TANON GIS software (TANON, China).
Flow cytometric analysis of cell cycle
The collected 105 cell suspension was centrifuged at 1000 × g for 5 min and the cell pellet was resuspended in 300 µL of phosphate-buffered saline (PBS) containing 10% fetal bovine serum. Absolute ethanol (700 µL) was added to fix the cells at -20°C for at least 24 h. The fixed sample was centrifuged at 3000 × g for 30 s and the cell pellet was suspended in 100 µL of 1 mg/mL RNase A solution and incubated for 30 min at 37°C. Propidium iodide (400 µL, 50 µg/mL) was added and the nuclei were stained for 10 min in the dark. Flow cytometry was performed to determine the DNA content of the cells and the proportion of cells in each phase of the cell cycle. The results were analyzed using NovoExpress software (ACEA, China).
Flow cytometry analysis of apoptosis
Ice-cold PBS (1 mL) was added to the collected cells, which were shaken gently and centrifuged at 4°C at 1000 × g for 5 min. The cells were resuspended in 200 µL of binding buffer. Then, 10 µL of annexin V-FITC and 10 µL of propidium iodide were added, mixed gently, and incubated at 4°C in the dark for 30 min. Binding buffer (300 µL) was added and flow cytometry was performed. The data were analyzed using NovoExpress software (ACEA, China).
Immunofluorescence
The cells were fixed with 4% paraformaldehyde at room temperature for 30 min, washed with PBS, then permeabilized with 0.5% Triton X-100 at room temperature for 20 min. After three washes with PBS, the cells were blocked with 5% bovine serum albumin at 37°C for 1 h, incubated with primary antibodies (Nanog, OTC-4) at room temperature for 1 h, and washed three times with PBS. Next, the cells were incubated with secondary antibody (Alexa Fluor 594 – cnjugated Goat Anti-Rabbit) at 37°C for 1 h and washed three times with PBS. Cell nuclei were stained with DAPI for 20 min and the cells were observed under a confocal laser scanning fluorescence microscope (Nikon, C2).
Cell Counting Kit 8 (CCK8) assay
Cells in the logarithmic growth phase were seeded in 96-well plate at 5 × 103 cells/well and transfected with mimics for 24 h. Then, 10 µL of CCK8 solution was added to each well and the cells were further incubated for 4 h. The absorbance of each well was measured at 450 nm using an enzyme-linked immunoassay detector (ALL FOR LIFE SCIENCE, AMR-100).
Statistical analysis
All experiments were performed in triplicate (n = 3) and the data are expressed as means ± standard error of the mean. All statistical analyses were performed using the GraphPad ProPrism 5.0 (San Diego, CA) software package. Student's t-test and two-way analysis of variance were employed to analyze the differences between treatment groups. P < 0.05 was considered to be statistically significant.