SLE patients and healthy controls (HCs)
Thirty-four patients fulfilling the American College of Rheumatology revised Criteria for SLE [18], 30 females and 4 males aged from 28 to 65 years (44.4 + 1.6), and age/sex-matched HCs were enrolled into this study. Their venous blood samples were collected for further examination. Medical records were reviewed for demographic, clinical and laboratory data, and the disease activity at the time of sample collection were assessed by SLEDAI-2K [19]. The diagnosis of LN was based on renal biopsy findings and/or a long-term follow-up of blood and urine examinations [20]. Seventeen patients in this study had LN, 15 females and 2 males aged from 28 to 60 years (44.0 + 2.3), including 8 with class IV, 4 with class III, 3 with class V histopathological findings, and 2 without renal biopsy. Notably, LN patients had significantly higher SLEDAI-2K scores than SLE without renal involvement (8.4 + 1.2 versus 3.5 + 0.7, P < 0.001). Fresh urine specimens were collected from all LN patients and age/sex-matched HCs. This study was approved by the Institutional Review Board of our hospital with the informed consent from each participant.
Pristane-induced LN mouse model
Eight-week old female BALB/c mice were purchased from the Laboratory Animal Center of our medical college, and housed under specific pathogen-free conditions. Animal experiments were approved by the Institutional Animal Care and Use Committee of our university. Mice were intraperitoneally (i,p,) injected with 0.5 ml pristane (Sigma-Aldrich) to induce LN, whereas the control group was i.p. injected with 0.5 ml of phosphate-buffered saline (PBS) [21]. Blood and urine samples were periodically collected for examining anti-dsDNA levels and proteinuria concentrations, respectively. Mice were sacrificed at different time periods after induction, and their kidneys and spleens were removed for further studies.
Purification of human and mouse cells
Human MNCs were isolated from blood samples by Ficoll-Paque PLUS (GE Healthcare), and incubated with CD14 microbeads. CD14+ cells were eluted from the positive selection column of Magnetic Cell Sorter (Miltenyi Biotec). CD14- cells were incubated with CD4 microbeads, and CD4+ cells were eluted from the column. Mouse spleens were homogenized by using syringe plunger and mesh strainer. Mouse MNCs, were further incubated with PE-Cy5 anti-CD4 (BD Pharmingen) or FITC anti-CD19 (BD Pharmingen), and sorted by Moflo XDP Cell Sorter (Beckman Coulter) to obtain CD4+ or CD19+ cells. Purity of cell subpopulation was confirmed to be up to 95 % by flow cytometric analyses. Human urine cells were isolated from urine specimens by centrifugation and washing procedures to obtain cell pellets [22]. After removing capsules, mouse kidneys were minced into tiny pieces to obtain cortex tissues, followed by incubation with digestion buffer with collagenase (Sigma-Aldrich), and centrifuged to collect cell pellets [23].
Quantitative real time polymerase chain reaction (qRT-PCR)
Total RNAs from human or mouse cells were extracted by TRIzol reagent (Invitrogen), and complementary DNAs were obtained by using reverse transcriptase (Applied Biosystems). qRT-PCR was performed to quantify the target RNAs levels by using the SYBR qPCR Mix Kit (TOOLS) [24]. The condition of PCR was: 95 0C for 5 min, 95 0C for 15 sec, primer-melting temperature (Tm) for 1 min with 40 cycles, and elongation at 72 0C for 20 sec. Primer sequences were as follows.
Human lincRNA-p21 (Tm 59 0C), forward 5'-GTGCAGAGCGTTTTGTTTGTCCAT-3'/reverse 5'-CCACAGCCTCTGGGAAG AAAATG-3'.
Human H19 (Tm 570C), forward 5'-GAAATGCTACCCAGCTCAAGC-3'/reverse 5'-CTGCTGTTCCGATGGTGTCTTTGA-3'.
Human Bax (Tm 580C), forward 5'-ATGCGTCCACCAAGAAGCTGAG-3'/reverse 5'-CCCCAGTTGAAGTTGCCATCAG -3'.
Human PUMA (Tm 580C), forward 5'-ACGACCTCAACGCACAGTACGA-3'/ reverse 5' CCTAATTGGGCTCCATCTCGGG -3'.
Human P53 (Tm 520C), forward 5'-CCCTTCCCAGAAAACCTACC-3'/reverse 5' CTCCGTCATGTGCTGTGACT-3'.
Human IL-2 (Tm 560 C), forward 5'-CATGCCCAAGAAGGCCACAG-3'/reverse 5'-T TGCTGATTAAGTCCCTGGGTC-3'.
Human TCR- chain (Tm 550C), forward 5'-CAGCCAGGGGATTTCCACCACTC-3' /reverse 5'-CCCTAGTACATTGACGGGTTTTTC-3’.
Human GADPH (Tm 540C), forward 5'-ACTTCAACAGCACACCCACT-3'/reverse 5' -GCCAAATTCGTTGTCATACCAG-3'.
Mouse lincRNA-p21 (Tm 57 0C), forward 5-'ccgacaggagtctcatgctcag-3'/ revers 5'-CTGACCCAGACCAGTCTGG GC -3'.
Mouse GADPH (Tm 560C), forward 5'-GTTGTCTCCTGCGACTTCAACA-3'/ reverse 5'-TTGCTGTAGCCGTATTCATTGTC-3'.
The relative abundance of a measured gene expression was normalized by GAPDH gene from each sample. The average levels of human HCs or PBS-injected control mice, and expression levels of cell lines without stimulation, CRISPRi-GFP-silenced transfectants, and LV-SFFV-Blast-overexpressed cells were determined as 100%.
For analyzing the expression levels of human and mouse miR-181a, total RNAs were reverse transcription (RT) by using the reverse transcriptase kit (Applied Biosystems) with 10 ng purified RNA, dNTP, MultliScribe reverse transcriptase, RT buffer, RNase inhibitor, random primers and gene-specific stem-loop RT primer with a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) in Smart Cycler (Cepheid) [24]. The reagents were incubated with 16 0C for 30 min, 42 0C for 30 min and 85 0C for 5 min. The condition of PCR was: 95 0C for 10 min, 95 0C for 15 sec and 60 0C for 1 min with 40 cycles. Quantitative expression levels of miR-181a were analyzed with RNU6B small RNA (Applied Biosystems) as an endogenous control. The average levels of human HCs or PBS-injected control mice, and expression levels of cell lines without stimulation and CRISPRi-GFP-silenced transfectants were determined as 100%.
Construction of LV-based CRISPRi targeting and overexpression of lincRNA-p21 CRISPRi guide RNA spacer sequences targeting human lincRNA-p21 were designed as 5'-GCAAGGCCGCATGATGATGC-3', 71 bp from transcription start site (TTS) to 5’ end of gRNAs in template (T) strand (71i) and 5’-GCTTGCTTTGCATGATTGTT-3’, 184 bp from TTS in non-template (NT) strand (184i) [25]. The LV pALL-dCas9-KRAB.pPuro containing the catalytically dead Cas9/KRAB domain was obtained from the National RNAi Core Facility (Academia Sinica, Taipei, Taiwan), and a 1.9 kb stuffer was removed from this vector for cloning of guide RNA spacer sequences targeting lincRNA-p21. LincRNA-p21 was generated from HEK 293T cells cDNA by PCR amplification and further cloned into LV-SFFV-Blast. To obtain CRISPRi-lincRNAp21 and LV-lincRNA-p21, the created guide RNA and lincRNA-p21 expressing vectors were transfected into sub-confluent HEK 293T cells, along with the packaging psPAX2 and envelope pMD2.G plasmids by using calcium phosphate precipitation to acquire recombinant LV [24,26]. After transfection for 48 to 72 hr, cell supernatants were harvested and stored at -800C until use. CRISPRi-GFP and LV-SFFV-Blast vectors were used as the control vector in this study.
Production of stable transfectants
Jurkat T-lymphocyte and HEK 293T kidney cells (American Type Culture Collection) with 5 × 105 cells/mL in 6-well plate, were transfected with LV-CRISPRi-lincRNA-p21 or LV-CRISPRi-GFP for 48 hr in the presence of polybrene (8 µg/ml, Sigma-Aldrich), and were incubated with 5 µg/ml and 0.5 µg/ml of puromycin, respectively [26]. The puromycin selection process was up to one month in order to select successfully transduced stable transfectants confirmed by qRT-PCR analyses.
Doxorubicin (Dox)-induced cell apoptosis
HEK 293T, HK-2, Jurkat cells or transfectants were seeded with 1 106 cells/mL in 6-well plate in the presence of Dox (TTY Biopharm) for 24 hr under 37 ℃, 5 % CO2 incubation [11]. These cells were further stained with Annexin V and 7-AAD (BD Pharmingen) to detect apoptotic and dead cells, respectively, by flow cytometric analyses. Apoptotic cells were defined as Annexin V+ and 7-AAD- in this study.
Immunoblotting assessment
Cell lysates from human cell lines, transfectants or mouse cells were separated by electrophoresis on 10-15 % SDS-PAGE, transferred on PVDF membranes (Merck Millipore), blocked in 5 % of non-fat dry milk and incubated with primary antibodies anti-caspase 3 (Cell signaling), anti-procaspase 3 (Cell signaling), anti-p21 (Santa Cruz), or anti--actin antibodies (Sigma-Aldrich) at 4℃ for 16-18 hr [24,26]. After washing, the membranes were incubated with secondary antibodies (Jackson Immunoresearch) at room temperature for 2 hr. Signal expression of protein-antibody complexes was detected by ECL system (Amersham) and visualized with Biospectrum imaging system (UVP). The relative protein expressions were measured by Image J (NIH).
Enzyme-linked immunosorbent assay (ELISA)
After pristane induction, serum samples from BALB/c mice were periodically examined for the presence of anti-dsDNA levels with an ELISA kit (Alpha Diagnosis).
Proteinuria detection
Urine samples from BALB/c mice were collected at different time periods, and proteinuria was detected by urine testing strips (Arkray). The results were determined by the semi-automated urine chemistry analyzer (Arkray RT-4010), and urine protein concentration (UPC) quantification data was transferred into 5 ranking including 0, 0.5, 1, 2 and 3.
Histopathological and immunofluorescence analyses
Paraffin-embedded sections were de-paraffinized in xylene, dehydrated in ethanol and rehydrated in distilled water. To determine glomerulonephritis (GN), mouse kidney sections were analyzed by Periodic acid-Schiff (PAS) staining. For terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay to detect in situ apoptosis, antigens in the kidney sections were reactivated by proteinase K for 10 min, re-fixed by 4 % formaldehyde for 25 min, incubated with equilibrate buffer for 7 min, and finally labelled by the TUNEL detection cocktail (Promega) [26].
Statistical analyses
Data are expressed as the mean + standard error of the mean (SEM). The expression levels of mRNA between patients and HCs or different groups of patients were analyzed by Mann-Whitney U test. Correlation analysis was analyzed by Spearman correlation coefficient test with linear regression analysis. The significant differences in other in vitro analyses were determined by Student’s t test. The differences at different time points in in vivo study were analyzed by repeated-measures analysis of variance. P values less than 0.05 is considered to be significant in this study with the symbols presenting as * for P < 0.05, ** for P < 0.01 and *** for P < 0.001.