Cohort
Embryonic villi from miscarriage pregnant women(5-11 weeks of pregnancy, pregnant women aged 21-40 years old, no toxic and harmful substances contact experience) was collected and preserved at -80℃ refrigerator from May 2018 to May 2019 in the Central Laboratory of Birth Defects Prevention and Control, Ningbo Women & Children’s Hospital, Ningbo, Zhejiang, China. Villi tissues were obtained after operation of uterine cleanup. Based on the results of chromosomal aneuploidy (aneuploidy and euploidy) detection, 100 embryonic villi samples were divided into two groups: 50 cases with chromosomal abnormalities (abnormal group), and 50 cases without chromosomal abnormalities (normal group). This trial was approved by the Ethics Committee.
Aneuploidy detection by HLPA
The chromosomal abnormalities of 24 chromosomes were detected by a method of modified MLPA (Multiplex ligation-dependent probe amplification) assay named HLPA (High-throughput ligation-dependent probe amplification), which was carried out using CNVplex detection kit (Genesky Technologies (Suzhou) Inc.). The main principle of this method: Using the highly specificity of ligase to perform a set of hybridization and ligation reaction on the target regions to distinguish the ploidy of the target regions. At the step of ligation, sequence tags within different length and different fluorescein (PET, VIC, NED, and FAM) were introduced to the ends of the probes and then ligated to the target regions to get ligated products of different lengths. Then, universal primers labeled with fluorescent markers were used to amplify the concatenate products by PCR. After amplification, the PCR products were separated and detected by fluorescence capillary electrophoresis, then the copy number of target regions were calculated by analyzing the peak height of electrophoretogram, the detailed workflow refer to the study Chen, S et al reported 14. There were totally 170 (for Chr1-12 and Chr16-17, there 8 probes for each chromosome; for Chr13-15, Chr21-22 and ChrY, there 5 probes for each chromosome; for Chr18-Chr20 and ChrX, there 7 probes for each chromosome) pairs of probes targeting 24 chromosomes were designed for the aneuploidy detection. The experimental steps were as follows: First, 2 μL gDNA (30ng/μL) mixed with 1μL probe mix(10uM), 1.25 μL 4× DNA lysis buffer and 5.75 μL DNA diluent were denatured for 2 min at 98 °C and then put on ice immediately. Then, 2μL 10× ligation buffer, 0.5μL ligase and 7.5 μL double-distilled water were added to the first step products to start the ligation under the following the program: 5 cycles of 94°C for 1 min and 60°C for 3 h, then 94 °C for 2 min, and 72 °C for 10 min. Reactions were stopped by adding 20 μL of 20 mM EDTA. After ligation, 1 μL of ligation products, 10 μL 2× PCR Master Mix, 1 μL primer mix and 8 μL double-distilled water were mixed evenly to perform the multiplex PCR amplification. The PCR program was as follows: 95°C for 2 min;5 cycles of 94°C for 20 s, 62°C for 40s decreasing 1°C per cycle, and 72°C for 1.5 min; then 27 cycles of 94°C for 20 s, 57°C for 40 s, and 72°C for 1.5 min; then 68°C for 1h; Finally ,cooling the system to 4°C to stop the reaction. The last step was capillary electrophoresis and data analysis: PCR products were diluted 5-fold. 1μL diluted products mixed with 0.1μL LIZ 500 size standard (Applied Biosystems, Foster City, CA, USA) and 8.9 μL Hi-DiTM formamide (Applied Biosystems) were denatured at 95 °C for 5 min and fluorescently labeled products were separated by on an ABI3130XL genetic analyzer (Applied Biosystems). Data were analyzed with GeneMapper software v4.1 (Applied Biosystems).
Karyotype verification by FISH
To confirm the aneuploidy detection results by HLPA, Fluorescence in situ hybridization (FISH) was performed according to Escudero, Abdelhadi, Sandalinas, & Munné, 200315. The DNA probes used for this study were purchased from Beijing GP Medical Technologies, Inc., P.R. China. DLEU2:13q14, CSP18:18p11.1-q11.1, DSCR2:21q22, CSP X: Xp11.1-q11.1were used to detect chromosome 13, 18, 21, X and Y respectively. Fixation:Embryonic villi cells were fixed in methanol/acetic acid (3:1) for FISH analyses. To prepare the slides, eight drops of fixed villi cells were placed on each. Once dried, slides were then washed twice in 2×standard saline citrate (SSC, Vysis Inc.) at room temperature, for 3 min each. Then the slides were dehydrated in ethanol series (70%, 85% and 100%) for 2 min each, and dried at room temperature in a slanted position. Denaturing:When dry, slides were placed in 5-nmol/L dithiothreitol (DDT, Sigma) and 1% Triton X-100 solution (Sigma) at 37°C for 13 min. After that, the slides were denatured in 70% Formamide (Sigma) and 2×SSC solution for 5 min at 71°C. The slides were washed again in 2× SSC and dehydrated in ethanol series. Before hybridization, the DNA probes mixed with hybridization buffer were immersed in a water-bath for 5 minutes at 72°C to denature. Hybridization:The denatured probe was then applied to each glass slide containing the fixed villi cells and was hybridized overnight at 37°C. Then, slides were washed in 0.7× SSC at 71°C for 2 minutes, dried at room temperature, and counterstained with DAPI in antifade and covered with glass coverslips for analysis.
Quantitative real-time PCR.
Total RNA was isolated using TRIZOL (Invitrogen) according to manufacturer’s protocol. 5ug isolated RNA was treated with DNase (Promega, Madison, WI, USA) and 1ug of the DNase-treated RNA was used for cDNA preparation using random hexamer (Invitrogen) and MMLV-RT (Promega). For miRNAs, 200ng isolated RNA was used for cDNA preparation in a master mix containing stem-loop primers specific for the desired miRNAs (Sigma), dNTPs (Invitrogen) and MMLV-RT (Promega). Real-time PCR was performed in the 7500 Fast Real-Time PCR System (Applied Biosystems) using power SYBR Green PCR Master Mix (Applied Biosystems). The comparative threshold cycle method (△△Ct) was used to quantify relative amounts of product transcripts with GAPDH (for mRNAs) and U6 (for miRNAs) as endogenous reference controls. Primer sets for MAD1, BUB3 and GAPDH are listed in Supplementary Table 1. Fold activation values were calculated as mean of independent experiments.
Table 1: Primers of miRNA125b,MAD1 and BUB3
Primer name
|
Primer sequence
|
MAD1
|
F:GCCAGAAACAAAGAGCAGACAT; R:GACCTTCAACCTGAGCGTGT
|
BUB3
|
F:GAGTGGCGAGTAGTGGAAACG; R:AGGAGACAAGCAGGAACTGG
|
GAPDH
|
F:CCTCAACGACCACTTTGTCA; R:TCTTCCTCTTGTGCTCTTGCT
|
miRNA125b
|
F:TCCCTGAGACCCTA; R:CAGTGCGTGTCGTGGAGT
|
U6
|
F:CTCGCTTCGGCAGCACA; R:AACGCTTCACGAATTTGCGT
|
Western blotting and antibodies
Whole cell lysates having equal protein concentrations were resolved by SDS/PAGE (8–12% gel) and transferred onto a PVDF membrane (Millipore, Billerica, MA, USA). Various primary antibodies used are mouse monoclonal Mad1 (Millipore), mouse monoclonal BUB3 (Cell Signaling Technology, Beverly, MA, USA), mouse monoclonal b-actin (Sigma). Bands were detected using Super Signal West Pico chemiluminescent substrate (Thermo Scientific, Rockford, IL, USA) after treating with HRP-conjugated secondary antibody (Sigma).
Statistical analysis
SPSS 17.0 (SPSS Inc., Chicago, IL, USA; http://www.spss.com) was used to perform Mann-Whitney t-test in order to determine significant differences between individual groups (normal and abnormal) with respect to miR-125b、Mad1 and BUB3 expressions. Statistically significant differences were defined by two-sided P<0.05.