Cell culture
Human NSCLC lines A549 and H460 were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS). Human embryonic kidney cells (HEK-293T) were cultured in 10% FBS in DMEM medium. These cell lines were all purchased from the Cell Resource Centre of the Chinese Academy of Sciences and cultured at 37 °C in 5% CO2.
Irradiation
X-rays were generated by a X-RAD generator (Faxitron, USA). The dose rate was 2.0 Gy/min (225 kV, 0.2 mm Al filter). Irradiations were also performed using the carbon ion beam (80.55 MeV/u) which were generated by the Deep Therapy Terminal, Institute of Modern Physics, Chinese Academy of Sciences (HIRFL-CSR). Ray parameters are as follow: dose rate of 2Gy/min and broadened Bragg peak of 5mm.
RNA extraction and PCR
RNA extraction, using TRIzol reagent (Sangon, China), was done at 24 h after transfection for RNA sequence. Reverse transcription of mature miRNA130a-3p was conducted with specific miRNA reverse transcriptase primers (Ribobio, China) and the internal reference was U6. For qRT-PCR of mRNA and lncRNA H19, cDNA was synthesized with Prime Script RT Mix (Takara, China). The level of each mRNA and lncRNA H19 was normalized to that of a GAPDH control. Changes relative to endogenous controls were calculated using the 2−ΔCT method.
The primers of H19 were as follows:
Fw: 5′TCCTGAACACCTTAGGCTGG3′
Rev: 5′TGATGTTGGGCTGATGAGGT3′
The primers of WNK3were as follows:
Fw: 5′TGTTGAAATGACGGAAGATGACA3′
Rev: 5′TCTGCCACTAGGAGAAGTAGC3′
siRNA knockdown and miRNA mimics experiments
NSCLC cells were plated at 50% confluency in 35-mm petri dishes. The riboFECTTM (Ribobio, China) was used as a transfection reagent. The concentration of both MiR-130a-3p mimic and si-H19 (Ribobio, China) was 50 nM and si-WNK3 (Ribobio, China) was 100 nM. After a further 24 h, cells were harvested. Knockdown or mininc efficiency was measured relative to housekeeping gene by RT-PCR.
lncRNAH19: siRNA: CCTCTAGCTTGGAAATGAA
WNK3: siRNA: GACCGACAGTTGTTTCACA
Dual-luciferase reporter assay
HEK-293T cells were seeded at 1.0 × 106 cells/well in 35-mm petri dishes 1 day before transfection. Cells were transfected with miR-130-3p mininc and WNK3 wild type plasmids/ mutation type plasmids(2.5mg) or lncH19 wild type plasmids/ mutation type plasmids(2.5mg). Transfection reagents were jetPRIME® and Polyplus-transfection (USA). Cells were incubated for 24 hours and, when indicated, were treated by the Dual-Luciferase Reporter Gene Assay Kit (Beyotime, China) following the manufacturer’s instructions. The vector of dual-luciferase reporter was pmiR-RB-Report (Ribobio, China), which included Renilla luciferase (Rluc) reporter gene and Firefly luciferase (Fluc) reporter gene. Rluc was used as an internal control.
CCK-8 assay
Cell viability was evaluated using a Cell Counting Kit-8 (CCK8, APExBIO, USA). Cells were seeded at 3 × 103 cells/plate in 96-well plates. Cells are irradiated 24 hours after transfection. After a 24h,48h,72h treatment, every plate was added with 10 mL CCK-8 reagent for two hours. Then, the optical density (OD) was read at 450 nm.
5-Ethynyl-20-deoxyuridine (EDU) assay
The EDU assay was performed using the Cell-Light EDU DNA Cell Proliferation Kit (RiboBio, China). Images were obtained from a fluorescence microscope (Olympus, Japan).
Colorogenic survival assay
After transfection and irradiation, the appropriate amounts of cells were seeded in triplicate in 60-mm petri dishes. After 2 weeks of culture, with a reagent of 4% polyformaldehyde and 1% crystal violet, the cells were fixed and stained. Clones contained at least 50 cells were counted.
Western blot analysis
Cells were lysed in RIPA buffer with protease and phosphorylase inhibitors. The protein concentration was measured by the BCA assay kit (Thermo Scientific, USA). Lysates were denatured at 100 °C for 10 minutes, and separated on a 10% or 15% SDS polyacrylamide gel. Protein was transferred to a PVDF membranes (Millipore, USA), then blocked with BSA (Solarbio, China) for 1.5 h. Antibodies used were phosphorylated p38 (Immunoway, YP0338 1:1000), Bcl-2 (Gene Tex, GTX50413 1:500), Bax (Gene Tex, GTX56246 1:500), GAPDH (Gene Tex, GTX100118 1:5000). Western blot gels for Fig4D, 4E.
Flow cytometry
Both A549 and H460 Cells were seeded in 35-mm petri dishes and then irradiated with 6 Gy, 24 hours after transfection. After a further 24h, 48h, 72h incubation, the cells were collected and stained with Annexin V and PI. In summary, cells were stained by apoptosis kit (Roche, USA) following the manufacturer’s instructions. Data was analyzed with FlowJo v10.1.
Statistics
Statistical analyses were performed using GraphPad Prism software v7.0. Changes in paired samples were assessed using paired t-tests. Comparisons between treatment groups were experimentally hypothesized or not were made by Student’s t-test or ANOVA. All the experiment was repeated three times. Significant difference was defined as p < 0.05.