SSR Marker-Based Genetic Resource Assessment of The Rainbow Clam Moerella Iridescens Along The Coasts of China: Implications for Strategy of Conservation Management

doi:10.21203/rs.3.rs-769531/v1

Download PDF

Research Article

SSR Marker-Based Genetic Resource Assessment of The Rainbow Clam Moerella Iridescens Along The Coasts of China: Implications for Strategy of Conservation Management

https://doi.org/10.21203/rs.3.rs-769531/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Feb, 2022

Read the published version in Frontiers in Marine Science →

Version 1

posted

You are reading this latest preprint version

This study aims to determine the genetic structure and diversity of rainbow clam Moerella iridescens in different sea areas of China. Seventeen pairs of microsatellite primers (SSR) were used to amplify the SSRs of rainbow clam in Lianyungang of Haizhou Bay, Chongming of Shanghai, Ningde in Fujian, Cixi and Wenzhou in Zhejiang. A total of 1146 alleles were detected in 310 individuals from the 17 SSR loci. The average observed heterozygosity of six populations was 0.4381–0.6139, the average expected heterozygosity was 0.5897–0.7325, and the average Shannon diversity index was 1.2655–1.7998. The clams exhibited rich genetic diversity and the F_ST of the genetic differentiation index of the six populations was 0.0470, indicating low genetic differentiation amongst the populations. The results indictated that rainbow clam along China coasts exhibited high diversity and low population differentiation.

Molecular Biology

Moerella iridescens

SSR

Genetic diversity

China coasts

Conservation management

The rainbow clam Moerella iridescens is an economically important small-sized marine clam due to delicious taste and high nutritional value. The clam mainly is distributed in the West Pacific coast and northern Australia. In recent years, rainbow clam has been increasingly used as high-valued seafood and as feed for shrimps and crabs in some mariculture industry of China. Deterioration of the ecological environment has led to a sharp decline in the natural resources of rainbow clams due to overfishing and increases in shrimp and crab farming. Thus, protection of rainbow clam resources is of great importance. Several authors have explored the biological characteristics and morphological differences of rainbow clam (Ji et al. 2007; Lv et al. 2012). To date, however, reports on the genetic diversity and relationships amongst clam populations are limited (Xu et al. 2016).

Microsatellites, also known as simple repetitive sequences (SSR), present the advantages of co-dominance, single locus, high polymorphism and easy operation and can be screened from different populations to complete genetic diversity studies (Cui et al. 2011). Microsatellite marker technology has been widely used in the structural analysis of the population genetics of aquatic animals, e.g. the rainbow trout (Zhao et al. 2010), the scallop Patinopecten yessoensis (Chang et al. 2007) and triangle pearl Hyriopsis cummingii (Bai et al. 2015). So far, few reports are available on the genetic diversity of the population of rainbow clam. In the present study, the genetic diversity of six populations of rainbow clams in Lianyungang, Chongming Island, Ningde, Zhoushan, Cixi and Wenzhou was analysed by using microsatellite markers. The results obtained can provide a scientific basis for assessing germplasm resources and genetic diversity protection of rainbow clam.

Materials

Rainbow clams were collected from the six coastal mud flats, Lianyungang Haizhou Bay (LYG), Chongming Island Dongtan (CM), Ningde Fu’an (ND), Zhoushan Daishan (ZS), Hangzhou Bay Cixi (CX) and Wenzhou Yueqing Bay (WZ). Fifty samples were obtained randomly from each population. Information on the samples collected is presented in Table 1 and Fig. 1. The sampled rainbow clams were stored at − 70°C until analysis.

Table 1

Sampling time, place and sample size of rainbow clam
Stock	LYG	CM	ND	ZS	CX	WZ
Sampling time	2012·10	2012·10	2012·10	2012·10	2012·10	2012·10
Number of samples	50	50	50	50	50	50
Sampling site	Sanyang harbor, Haizhou Bay	East beach, Chongming Island	Xiabaishi, Sansha Bay in Fu'an	Datian Bay, Daishan, Zhoushan	Cixi Sanbei shoal,Hangzhou Bay	Simon Island, Yueqing Bay,
GPS	E119.2835 N34.7996	E122.0058 N31.5316	E119.6263 N26.7948	E122.2095 N30.2888	E121.4337 N30.2998	E121.2031 N28.3229

Microsatellite Primer

The M13 (-21) universal primer sequence of 5′-TGTAAAACGACGGCCAGT-3′ reported by Schuelke (2000) was adopted in this study to elongate short primers in for economic consideration in genotyping. We used two fluorescent labels FAM and HEX for forward primes which were abbreviated as FAM-M13 and HEX-M13. Totally, 19 SSRs were used for PCR and these primer information was shown in Table 2.

Table 2

Microsatellite primer information. *Primers of forward sequence tailed with universal M13 (− 21) sequences (5′-TGTAAAACGACGGCCAGT-3′) at their 5′ ends.
SSR	Repeat motif	Sequence (5′–3′)*	Size of original fragment /bp	(Tm)/°C
HGZ2	(AC)17(CA)11	F:TGAGGTGGAATGAGTTAC R:TAAGTTCGGATGACAAAG	124	45
HGZ3	(GT)22	F:ATGGGAGACAACTCGCTAC R:CTGTCACAACGGCAATCT	353	52
HGZ6	(TG)4	F:GGGCCAAATCAGGGAATG R:AGCAGGAAACGCAGCACA	103	58
HGZ9	(AC)9(AC)7(CA)7	F:CAGCCTGGGCAACATAGT R:TAGGACCACAGGTAAGCATC	116	53
HGZ10	(GT)6(GT)8(GT)6	F:AGGTAGGGCGTGAAGGAA R:GCAAAATCGACCCTACTACATA	193	55
HGZ14	(CA)6	F:ACTAGTACGTGAAGATTAGCCAA R:GAGGCGATACTCATAATGTTCA	338	55
HGZ17	(AC)26(CA)21	F:ATGAGAGAGCGACAGAATG R:TAGAGGCTCCCTAAATGG	150	50
HGZ22	(GA)19(AG)12	F:TTTCCACTTCGCACATTG R:CTCGCACAAACAAATGAAC	196	52
Mir8	(GT)15	F:GTAGGTTTGGCATGGCTTTGTAGC R:ACCATTGAGGGCTCGTCTGAATTAT	124	64
Mir12	(AG)16	F:TCACCAGAAAGGAGACCGTAAAAGT R:CTACGGATTTCGCAGTGAAAATGT	120	63
Mir13	(AC)15	F:GCAACACAACGAGAGTG R:ACAACAAACAACAAAGAAAT	116	47
Mir14	(CT)4	F:ATCGTTGGGGCATTCTAGTTTTCT R:GGGTATAATAATTTTGAAACGCAGC	83	62
MH19A	(TG)28	F:GTGAGCAGGAATCAAAGGTG R:CTCCGCTCTGTTTGCCTAT	105–145	55
Mi44A	(TG)61	F:CCTCGGAGACCATTCGCTAC R:TGCTTTTCTATGACAACCCT	85–101	52
MW33A	(TG)13TA(TG)5(CG)2TGCG	F:TTCCTATCCTTACCCTTG R:CTGACTGGAAACTCAACAC	111–171	48
MW15A	(CA)24	F:GATCAAAATTGACAAGGCT R:AAGACAAACACGGATGGT	88–150	46
MX39C	TGTT(TG)6(GG)4GT	F:CCCAACCAGAATAATACCA R:TCCAACAAAGGAATACGATA	200–220	48
MY36B	(TG)7(GG)3	F:CCGTTGGTAAAGACGATAT R:TGGTTGCGAGTTGGACAC	251–283	58
MZT46B	(TG)75	F:GACATAAAGGTTGTAGGGA R:ATGGTAGTGATGATGCTTG	151–283	46

</table>

Method

Total DNA was extracted with SDS–phenol chloroform method. The PCR system used consisted of 1 µL of template DNA (about 30 ng), 2 µL of primer mix, 1 µL of universal fluorescent primers, 10 µL of 2× Taq PCR MasterMix and 6 µL of ddH₂O to form a total volume of 20 µL. PCR program was as follows: pre-denaturation at 90°C for 5 min, 30 cycles, denaturation at 94°C for 3 min, annealing at 53°C for 1 min and at 72°C for 30 s and a final extension at 72°C for 10 min at the end of the cycle. The PCR products were subjected to capillary electrophoresis, and the electrophoresis patterns were genotyped by GeneMapper 3.7 and Peak Scanner software.

Data Processing

Pop32 software was utilised to calculate the number of effective alleles (Ne), expected heterozygosity (He), observed heterozygosity (Ho) and gene flow (Nm), genetic distance (Ds) and Shannon diversity index. Population clustering was analysed using the unweighted pair-population method with arithmetic means (UPGMA) of the MEGA 3.0 software. Analysis of molecular variance (AMOVA) was performed using Arlequin 3.11 software, and the genetic diversity and genetic differentiation index (F_ST) were computationally analysed.

Genetic diversity of the rainbow clam

There were 1146 alleles successfully detected in the six populations through 17 SSR loci scanning the genomes of rainbow clam populations, except in the HGZ22 in the Wenzhou population failed to amplified by PCR. Except for the alleles detected at the two loci of HGZ2 and HGZ14, the remaining alleles were highly polymorphic loci, which indicated that the 17 microsatellite loci can be used to study the population genetics of rainbow clam (Table 3).

Table 3

Analysis of Molecular Variance among Six Populations of Rainbow Clam
pop	SSR	MH19A	Mi44A	MW15A	MX39C	MY36B	MZT46B	HGZ3	HGZ6	HGZ9	Mir8	Mir12	Mir14	HGZ10	HGZ17	HGZ22	Mir13	MW33A	Mean
ZS	Sample No.	96	100	100	98	84	96	100	100	100	96	96	94	96	92	10	14	34	83
	Na	17	7	20	18	27	6	19	3	10	10	21	21	5	7	5	9	13	12.8235
	Ne	7.5789	3.3003	4.1391	3.2035	17.9086	2.3226	8.7260	1.1064	5.6243	5.8701	7.1888	4.3829	1.6317	2.0564	3.8462	6.5333	9.6333	5.5913
	Ho	0.8542	0.9600	0.6200	0.8980	0.2619	0.8958	0.0400	0.0600	0.8800	0.8125	0.9583	0.8085	0.0000	0.2174	0.2000	0.4286	0.1765	0.5336
	He	0.8772	0.7040	0.7661	0.6949	0.9555	0.5754	0.8943	0.0972	0.8305	0.8384	0.8700	0.7801	0.3912	0.5194	0.8222	0.9121	0.9234	0.7325
	I	2.3251	1.3946	1.9772	1.8728	3.0815	1.0159	2.5069	0.2322	1.9486	1.9286	2.4370	2.0440	0.8046	1.0947	1.4708	2.0449	2.4172	1.7998
ND	Sample No.	78	92	96	98	78	86	98	98	98	100	96	94	100	96	54	50	50	86
	Na	18	8	30	10	15	24	8	14	2	8	9	10	21	5	5	7	7	9
	Ne	11.7000	2.9782	11.1036	2.7805	18.2156	2.3012	5.5514	1.0416	5.2082	3.6928	3.3932	3.8518	1.3951	1.4908	4.7032	4.4326	5.6306	5.2630
	Ho	0.7692	1.0000	0.8333	0.8163	0.4615	0.9767	0.0204	0.0408	1.0000	0.9800	0.9583	0.7447	0.0000	0.1042	0.0000	0.0000	0.0000	0.5121
	He	0.9264	0.6715	0.9195	0.6470	0.9574	0.5721	0.8283	0.0404	0.8163	0.7366	0.7127	0.7483	0.2861	0.3327	0.8022	0.7902	0.8392	0.6839
	I	2.6503	1.3328	2.8777	1.6638	3.0326	1.0217	2.0495	0.0996	1.7543	1.5876	1.4903	2.0490	0.6114	0.7219	1.7032	1.6550	1.9249	1.6603
CX	Sample No.	90	100	100	96	82	88	98	100	100	94	100	98	100	94	58	96	26	89
	Na	22	5	30	18	28	5	11	4	15	11	6	18	7	5	14	8	9	12.7059
	Ne	11.3764	4.0750	6.7843	5.2364	15.0089	1.9979	2.4984	1.3369	6.8871	7.1143	2.9656	3.0703	1.8997	2.0771	8.7604	2.7560	6.1455	5.2935
	Ho	0.9111	1.0000	0.9400	0.9167	0.6585	0.7045	0.7755	0.0000	0.9400	0.9362	0.9600	0.6735	0.0600	0.4255	0.1034	0.3542	0.0769	0.6139
	He	0.9223	0.7622	0.8612	0.8175	0.9449	0.5052	0.6059	0.2545	0.8634	0.8687	0.6695	0.6813	0.4784	0.5241	0.9014	0.6439	0.8708	0.7162
	I	2.7154	1.4715	2.5566	2.2264	2.9907	0.8671	1.3413	0.5388	2.2126	2.0765	1.2420	1.7969	0.9429	1.0515	2.3665	1.2693	2.0008	1.7451
CM	Sample no	108	120	114	112	90	116	116	120	120	120	118	92	110	118	36	48	28	99
	Na	21	5	17	15	25	9	11	5	11	8	22	10	4	4	10	17	9	11.9412
	Ne	12.7615	2.3614	4.3995	2.1261	8.8621	2.3168	1.4771	1.4682	3.9067	5.1173	6.0592	1.6067	2.0481	1.6927	7.0435	14.0488	7.6863	4.9989
	Ho	0.9815	1.0000	0.3333	0.4464	0.4667	0.5690	0.1207	0.3500	0.9167	0.9500	0.7797	0.0870	0.0000	0.0678	0.1111	0.1250	0.1429	0.4381
	He	0.9303	0.5814	0.7795	0.5344	0.8971	0.5733	0.3258	0.3216	0.7503	0.8113	0.8421	0.3817	0.5164	0.4127	0.8825	0.9486	0.9021	0.6701
	I	2.7482	0.9969	1.9305	1.4246	2.6834	1.1756	0.8329	0.6585	1.6460	1.7885	2.3283	0.9337	0.9241	0.7746	2.1073	2.7358	2.1138	1.6355
WZ	Sample no	100	98	96	56	82	76	96	100	100	100	100	56	96	94		12	12	85
	Na	23	12	18	10	9	8	2	5	8	9	10	3	4	2		5	5	12.3648
	Ne	11.5207	3.6051	7.1331	1.6049	1.4038	2.3442	1.6528	1.5494	4.3365	5.3022	3.1250	1.1979	2.0907	1.2605		4.5000	4.8000	3.8135
	Ho	1.0000	1.0000	0.8333	0.3214	0.1220	1.0000	0.0000	0.3200	0.9600	0.9000	0.9600	0.0357	0.0000	0.0638		0.0000	0.1667	0.5102
	He	0.9224	0.7301	0.8689	0.3838	0.2912	0.5811	0.3991	0.3582	0.7772	0.8196	0.6869	0.1682	0.5272	0.2089		0.8485	0.8636	0.6266
	I	2.7197	1.6343	2.2915	0.9778	0.7424	1.0546	0.5841	0.7232	1.6415	1.7577	1.3815	0.3456	0.8837	0.3609		1.5607	1.5890	1.6135
LYG	Sample No.	98	100	94	100	72	86	94	100	100	92	100	100	100	90	48	88	30	88
	Na	21	5	20	16	29	5	4	2	17	18	4	20	3	10	13	13	14	12.5882
	Ne	12.0957	3.9777	4.6456	2.0080	18.6475	1.9091	1.5314	1.0202	10.0402	10.2470	2.5316	2.7397	2.0358	3.1395	7.0675	2.7172	11.8421	5.7762
	Ho	0.8571	1.0000	0.8085	0.5200	0.8056	0.3488	0.3830	0.0200	0.7000	0.6957	0.9600	0.6600	0.0000	0.2000	0.0417	0.2727	0.1333	0.4945
	He	0.9268	0.7562	0.7932	0.5071	0.9597	0.4818	0.3507	0.0200	0.9095	0.9123	0.6111	0.6414	0.5139	0.6891	0.8768	0.6392	0.9471	0.6786
	I	2.7247	1.4155	2.0706	1.3773	3.1140	0.9262	0.6279	0.0560	2.5136	2.5504	1.0406	1.7503	0.8030	1.4816	2.2518	1.5439	2.5520	1.6941
Mean	Sample No.	95	101.7	100.0	93.3	81.3	91.3	100.3	103.0	103.0	100.3	101.7	89.0	100.3	97.3	41.2	51.3	30.0	88.3
	Na	20.3333	7.0000	22.5000	14.5000	22.1667	9.5000	9.1667	5.5000	10.5000	10.6667	12.0000	13.6667	7.3333	5.5000	9.4000	9.8333	9.5000	11.9039
	Ne	11.1722	3.3830	6.3675	2.8266	13.3411	2.1986	3.5729	1.2538	6.0005	6.2240	4.2106	2.8082	1.8502	1.9528	6.2842	5.8313	7.6230	5.1287UE!
	Ho	0.8955	0.9933	0.7281	0.6531	0.4627	0.7491	0.2233	0.1318	0.8995	0.8791	0.9294	0.5016	0.0100	0.1798	0.0912	0.1968	0.1161	0.5171
	He	0.9176	0.7009	0.8314	0.5975	0.8343	0.5482	0.5674	0.1820	0.8245	0.8312	0.7321	0.5668	0.4522	0.4478	0.8570	0.7971	0.8910	0.6847
	I	2.6472	1.3743	2.2840	1.5905	2.6074	1.0102	1.3238	0.3847	1.9528	1.9482	1.6533	1.4866	0.8283	0.9142	1.9799	1.8016	2.0996	1.6914

The average number of alleles among the 17 loci in 6 populations was 5.5000–22.5000 (17 loci average, 11.9039), the Ne was 1.2538–13.3411 (average, 5.1287), the Ho was 0.0100–0.9933 (average, 0.5171), the He was 0.1820–0.9176 (average, 0.6847) and the Shannon diversity index was 0.3847–2.6472 (average, 1.6914).

The average number of alleles of the six populations was 8.3125–12.8235, the Ne was 3.8135–5.7762, and the Ho was 0.4381–0.6139 (average, 0.5121). Amongst the populations studied, the Ho of CX was the highest, whereas the Ho of CM was the lowest. The average He was 0.6266–0.7325 (average, 0.6847). The Zhoushan population was the highest, whereas the Wenzhou population was the lowest. The average Shannon diversity indices were 1.7998 (ZS), 1.7451 (CX), 1.6603 (ND), 1.6941 (LYG), 1.6355 (CM) and 1.2655 (WZ). These results showed that, although the genetic diversities of the six wild populations of rainbow clam were different, the overall genetic diversity was high (Table 3).

Phylogenetic Relationships Of The Six Populations Of Rainbow Clams

AMOVA

AMOVA of the six different geographical populations of rainbow clams showed that 4.70% of their genetic variation could be derived from the population, whilst 95.30% of their variation was from within the population. The F_ST of the populations was 0.0470, indicating that the degree of genetic differentiation amongst the populations was low (Table 4).

Table. 4 Analysis of Molecular Variance among Six Populations of Rainbow Clam

Source of variation	d.f.	Sum of square	Variance component	Percentage of variation（%）
Among populaions	5	100.815	0.16327 Va	4.70
within populations	614	2031.833	3.30917 Vb	95.30
Total	619	2132.648	3.47245
Fixation Index	F_ST : 0.04702（P＜0.05）

Genetic Distance

The Ds amongst the six populations of rainbow clam was 0.0668–0.3020. The Ds between the Wenzhou and Zhoushan populations was the largest (0.3020), and their genetic relationship was far. By contrast, the Ds between the Lianyungang and Cixi populations was the smallest (0.0668), and their genetic relationship was relatively close (Table 5).

Table. 5 Nie’s unbiased genetic distance of 6 populations of rainbow clams

Populations	ZS	ND	CX	LYG	CM	WZ
ZS
ND	0.1196
CX	0.1680	0.1921
LYG	0.2157	0.2540	0.0668
CM	0.2297	0.1986	0.1160	0.1140
WZ	0.3020	0.2292	0.2204	0.2185	0.1228

Table 6. Genetic similarity coefficient and gene flow between 6 populations of rainbow clams Genetic similarity coefficient above the diagonal, gene flow below the diagonal.

Populations	ZS	ND	CX	LYG	CM	WZ
ZS	****	10.4019	6.0283	3.7538	2.9146	3.4532
ND	0.0235	****	4.9507	3.3291	3.6003	6.2250
CX	0.0398	0.0481	****	13.2635	6.1635	7.1116
LYG	0.0624	0.0699	0.0185	****	5.4267	5.7052
CM	0.0790	0.0649	0.0390	0.0440	****	9.2629
WZ	0.0675	0.0386	0.0340	0.0420	0.0263	****

Genetic Differentiation Index And Gene Flow

Amongst those of the different populations, the F_ST between the Chongming and Zhoushan populations was the highest (0.0790), whereas that between the Cixi and Lianyungang populations was the lowest (0.0185). The Nm values between the Lianyungang and Cixi populations and that between the Ningde and Zhoushan populations were 13.2635 and 10.4019, respectively; the Nm between the Chongming and Zhoushan populations was 2.9146. The total F_ST between populations was 0.04702; F_ST < 0.05 indicates a low degree of genetic differentiation, which, in turn, reveals rich genetic diversity. The overall differentiation degree amongst populations was low.

Cluster Analysis

On the basis of the genetic distances amongst the populations, a clustering map was constructed using the UPGMA method of MEGA3.0 software. The six populations of rainbow clam could be divided into the following three branches: LYG and CX in the first branch, CM and WZ in the second branch and ZS and ND in the third branch.

F _ST is an important parameter for measuring the degree of genetic differentiation in a population. A large F_ST value indicates a high degree of differentiation between populations. No differentiation exists when F_ST is 0–0.05, moderate differentiation is observed when F_ST is 0.05–0.15, high differentiation is obtained when F_ST is 0.15–0.25 and great differentiation is found when F_ST > 0.25 (Hartl and Clark 1997). In this study, the F_ST of the six populations under study was 0.047 (< 0.05). Overall, the differentiation between the populations was minimal at best. However, the F_ST values of the ZS–LYG, ZS–CM, ZS–WZ, LYG–ND and CM–ND populations were in the range of 0.0624–0.0790 (0.05), which indicates that moderate genetic differentiation existed between the Zhoushan and each of the Lianyungang, Chongming and Wenzhou populations and between the Ningde and each of the Lianyungang and Chongming populations of rainbow clams. Nm can indicate the degree of genetic differentiation in a population. If Nm < 1, genetic differentiation occurs amongst populations. If Nm > 1, genetic differentiation is relatively low. If Nm > 4, genetic differentiation is very low (Ratnaningrum et al. 2017). The results of AMOVA showed that the Nm values amongst the six populations of rainbow clams lay between 2.9146 and 13.2635, and the Nm values amongst the ZS–LYG, ZS–CM, ZS-WZ, LYG–ND and CM–ND populations were greater than 1 and less than 4. These results indicate low genetic differentiation amongst these populations. In the present study, the sampling area of rainbow clam was distributed in Yellow Sea and East China Seas. LYG and CM are in Yellow Sea, with a geographical distance (about 1000 km coastline), and no differentiation between these populations was observed (F_ST = 0.0040 < 0.05). Although the geographical distance between the Chongming and Zhoushan populations is close, the Yangtze estuary is situated between them. Inflow of the Yangtze River lowers the salinity of the sea water and, hence, obstructs the passage of larvae and hinders gene communication to some extent (the Nm for CM–ZS is 2.9146); therefore, moderate genetic differentiation occurs between the CM and ZS populations (F_ST = 0.0790). Xu (2016) analysed the population morphology and genetic diversity of rainbow clams from Zhejiang and revealed that the Zhoushan population have a great variation from the Yueqing, Taizhou and Wenling populations(G_ST = 0.2479). Present study also indicated genetic differentiation occurred in the Zhoushan population (F_ST = 0.2479) which was consistent with Xu (2016), who showed that the Zhoushan population of rainbow clam presents moderate genetic differentiation.

This study also found that the degree of genetic differentiation between rainbow clam populations is not related to the geographical distance. Although the geographical distance between LYG and CX was relative far away, the F_ST value between the LYG and CX populations of rainbow was very low, only 0.0180 (< 0.05), which indicated a lack of genetic differentiation between the two populations. Gene exchange between the two populations occurred very frequently (Nm = 13.2635 > 4). The inconsistency of the relationship between degree of genetic differentiation and geographical distance has previously been observed in different populations of Coelomactra antiquata. Meng (2013) showed that the population genetic differentiation between the C. antiquata from the Southeastern Sea and that from the Yellow Sea in Lianyungang and Rizhao is not obvious basing on the results of ITS2 and 16SrRNA for six populations of C. antiquata in the coasts of China. By contrast, the difference between the Guangxi and Fujian populations, which have a relatively close geographical distance, reached the interspecies level. The real reason may be from human activity such as artificial farming and introduction, but more detailed reasons still were unknown so far.

Genetic diversity, including the degree of genetic variation and the genetic structure of the population, is an important basis for evaluating the status of a genetic resources. A higher genetic diversity of a population results in a stronger adaptability to the living environment and a greater potential for evolution (Tian et al. 2013). The genetic diversity of a population is mainly manifested in two aspects: heterozygosity and number of alleles (Yu et al. 2012). Many reports have explored the genetic diversity of aquatic animals by using SSR markers. Li et al. (2011) studied the population genetics of Portunus trituberculatus by microsatellite markers and found an average Ho of 0.2222–1.0000 and an average He of 0.4367–0.9099. Li et al. (2009) used SSR technology to measure the average Ho (0.32–0.49) of wild and cultured populations of scallops and found an average He 0.37–0.55. Chang et al. (2007) analysed the genetic diversity of five populations of scallops P. yessoensis in China and abroad and found an average Ho of 0.2708–0.3292 and average He of 0.3620–0.4595 for the five populations. Tian et al. (2013) used 20 microsatellite markers to determine the Ho and He of four populations of Tetranychus quinquefasciatus found ranges of 0.667–0.9667 and 0.6198–0.9318, respectively. An et al. (2012) studied the genetic structure of five wild-type populations of C. philippinarum in two sea areas of Korea by using seven SSR markers and noted high genetic diversity amongst the clams (total He = 0.813). The results of the present study revealed that the average Ho of the six populations of rainbow clam was between 0.4381 and 0.6139, and the He was 0.6266–0.7325 and the value of He was as follows: ZS (0.7325), CX (0.7162), ND (0.6839), LYG (0.6786), CM (0.6701) and WZ (0.6266). The average number of alleles of the 17 loci in the six populations ranged from 5.5000 to 22.500, and the Ne was between 1.2538 and 13.3411. The genetic diversity of the rainbow clams was higher than those of bay scallop Argopecten irradians and scallop P. yessoensis; this genetic diversity is similar to the He of four populations of clams T. quinquefasciatus and lower than that of five populations of clam C. philippinarum. Generally, in present study He (0.7325) and Shannon diversity index (1.7998) were the highest in the Zhoushan population which indicated the Zhoushan population has the richest genetic diversity amongst the clam populations studied.

The six populations of rainbow clams all presented high genetic diversity, which reflects the good protection and development prospects of rainbow clam resources in China. These results would be useful to genetic breeding practice and resources management.

Acknowledgments

We greatly acknowledge following colleagues for their great help and support in the process of investigation and sampling for rainbow clam: Dr. Feng Zhao from East China Sea Fisheries Institute of CAFS for the specimen in East Beach of Chongming Island, Pro. Binlun Yan from Huaihai Institute of Technology for the specimen in Sanyang harbor of Haizhou bay, Dr. Zehui Hu from Marine Fisheries Research Institute of Zhejiang of China for the specimen in Datian Bay at Daishan of Zhoushan,

Mr. Chen from Xiabaishi at Sansha bay in Fu'an for the specimen in the site, Pro. Meizheng Wang from Institute of Cixi Fisheries for the specimen in Cixi Sanbei shoal at Hangzhou Bay, Dr. Weicheng Lui from Zhejiang Mariculture Research Institute for the specimen in Simon Island at Yueqing Bay.

Funding

This study was supported in part by grants from the Modern Agricultural Industry Technology System of China Key (No. CAR49), the National Natural Science Foundation of China (No. 31101900 ) and the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Compliance with ethical standards

Conflict of interest

All authors declare that they have no conflict of interest in the publication.

Ethical approval

All applicable international, national and/or institutional guidelines for the care and use of animals (invertebrates) were followed.

Sampling and field studies

The necessary permit for sampling and observational field studies have been obtained by the authors from the competent authorities and are mentioned in the acknowledgements.

An HS, Kwang KJ, Cho KC, Han HS, Myeong JI (2012) Genetic structure of Korean populations of the clam Ruditapes philippinarum inferred from microsatellite marker analysis. Biochem Syst Ecol 44:186–195
Bai Z, Han X, Luo M, Lin J, Wang J, Li J (2015) Constructing a microsatellite-based linkage map and identifying QTL for pearl quality traits in triangle pearl mussel (Hyriopsis cumingii ). Aquaculture 437:102–110
Cui HY, Ma HL, Ma CY (2011) Genetic diversity among different families of mud crab Scylla paramamosain by microsatellite markers. Mar Fish 33:274–281
Chang YQ, Chen XX, Ding J (2007) Genetic diversity in five scallop populations of the Japanese scallop (Patinopecten yessoensis). Ecol J 27:1145–1152
Hartl DL, Clark AG (1997) Principles of population genetics. 3rd edition, Sunderland, MA: Sinauer Associates Inc
Ji YB, Li TW, Su XR (2007) Preliminary study on biological characteristics of rainbow clam in Zhejiang coast. Fish Sci 26:494–496
Lv GT, Zhang XM, Zhao J (2012) The Effect of Phenotypic and Morphometric Traits on Body Weight of Moerella iridescens. J Zhejiang Ocean Univ: Nat Sci Edit 31:487–491
Li X, Liu P, Song X (2011) Construction on enriched microsatellite library and characterization of microsatellite markers from swimming crab. J Fish Sci China 18:194–201
Li HJ, Liu X, Du XD, Song R, Zhang GF, Hu JJ, Bao ZM (2009) Development and isolation of microsatellite markers in bay scallop. Mar Sci 33:3–8
Meng XP, Shen X, Zhao NN, Tian M, Zeng Y, Chen JA, Dong ZG, Cheng HL, Tian JT, Liu ZH, Yang AG, Wu B, Zhou LQ (2013) Microsatellite analysis of genetic diversity in four geographic populations of Sca parc brughtonii. Prog Fish Sci 34:59–67
Ratnaningrum YWN, Indrioko S, Faridah E, Syahbudin A (2017) Gene flow and selection evidence of sandalwood (Santalum album) under various population structures in gunung sewu (Java, Indonesia), and its effects on genetic differentiation. Biodiversitas 18:1493–1505
Tian JT, Liu ZH, Yang AG, Wu B, Zhou LQ (2013) Microsatellite analysis of genetic diversity of 4 geographic populations of clam. Prog Fish Sci 6:59–67
Xu H, Hu YL, Xu YP, Jin K, Chen P (2016) The analysis of genetic diversity and morphology of Moerella iridescens in Zhejiang Province. J Shanghai Ocean Univ 4:508–514
Yu ZF, Yan XC, Zhang YH, Yang F, Yang F, Zhang GF (2012) EST-SSR diversity of Philippines clam in different age groups in Dalian. Acta Ecol Sin 1:4673–4681
Zhao Y, Zhu X, Sun X (2010) Microsatellite diversity in cultured populations of rainbow trout Oncorhynchus mykiss in China. J Fish Biol 73:1249–1255

Download PDF

Journal Publication

published 23 Feb, 2022

Read the published version in Frontiers in Marine Science →

Version 1

posted

You are reading this latest preprint version

SSR Marker-Based Genetic Resource Assessment of The Rainbow Clam Moerella Iridescens Along The Coasts of China: Implications for Strategy of Conservation Management

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Materials

Microsatellite Primer

Method

Data Processing

Results

Genetic diversity of the rainbow clam

Phylogenetic Relationships Of The Six Populations Of Rainbow Clams

Genetic Distance

Genetic Differentiation Index And Gene Flow

Cluster Analysis

Discussion

Conclusions

Declarations

References

Status:

Journal Publication

Version 1