PLGF Knockdown Attenuates Hypoxia-Induced Stimulation of Cell Proliferation and Glycolysis of Lung Adenocarcinoma Through Inhibiting Wnt/β-Catenin Pathway

doi:10.21203/rs.3.rs-77354/v1

Download PDF

Primary research

PLGF Knockdown Attenuates Hypoxia-Induced Stimulation of Cell Proliferation and Glycolysis of Lung Adenocarcinoma Through Inhibiting Wnt/β-Catenin Pathway

https://doi.org/10.21203/rs.3.rs-77354/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 06 Jan, 2021

Read the published version in Cancer Cell International →

You are reading this latest preprint version

Background: Angiogenic placental growth factor (PLGF) plays a role in hypoxia-induced angiogenesis. Here, we aimed to investigate the biological roles of PLGF in cell proliferation and glycolysis of lung adenocarcinoma (LUAD) and the underlying molecular mechanisms.

Methods: PLGF was knocked down in H358 and H1975 cells by lentiviruses, which were then cultured under hypoxia (90% N₂, 5%CO₂ and 5%O₂) for 24 h. PLGF was overexpressed in PC9 cells treated with XAV939, inhibitor of Wnt/β-catenin signaling pathway. PLGF-silencing H1975 cells were implanted into mice, and tumor xenografts were harvested and analyzed.

Results: Hypoxia treatment led to up-regulation of PLGF, C-myc, lactate dehydrogenase A (LDHA), and β-catenin, promotion of cell proliferation and glycolysis inH358 and H1975 cells, which were obviously reversed by knocking down PLGF. In tumors, PLGF knockdown significantly prohibited cell proliferation and glycolysis, and decreased expression of C-myc, LDHA, and β-catenin. PLGF overexpression markedly strengthened cell proliferation and glycolysis, and increased β-catenin expressionin PC9 cells, which were abrogated by XAV939.

Conclusion: PLGF knockdown inhibited the stimulatory effect of hypoxia on cell proliferation and glycolysis of LUAD through deactivating Wnt/β-catenin pathway.

Cancer Biology

hypoxia

cell proliferation

glycolysis

β-catenin

C-myc

Hypoxia is a widely-accepted characteristic of cancer development with a significant mutagenic potential, which refers to a mismatch between oxygen demand and supply in tissues resulted from rapidly proliferating cancer cells¹^,². Hypoxia is critical for cancer progression, invasion and treatment resistance by regulating vascularization, metabolism, cell survival and apoptosis³^,⁴. Hypoxia-inducible factor-1 (HIF-1) is the critical mediator of the hypoxic condition and participates in regulating expression of a great number of oxygen-dependent proteins involved in angiogenesis and cell metabolism, such as vascular endothelial growth factor (VEGF), and placental growth factor (PLGF)⁵.

To adapt to hypoxic microenvironment, oxidative phosphorylation is switched to glycolysis in tumor cells, which not only provide cellular energy, but also foster macromolecular biosynthesis by the production of metabolic intermediates, thereby promoting tumor growth, and facilitating immune escape⁶^,⁷. Increased glycolysis, also known as the Warburg effect, has been widely accepted as a metabolic characteristic of tumor⁸. Oxygen consumption rates (OCR) is an indicator of oxygen consumption by the cells, while extracellular acidification rate (ECAR) is used as an marker of glycolytic respiration by evaluating the production of lactic acid in the medium outside the cells⁹. Glycolysis inhibition has been increasingly recognized as a novel strategy to combat cancer¹⁰. Previous studies have made considerable efforts to unravel the physiological and molecular mechanisms behind glycolysis enhancement in tumor and have unveiled a few transcription factors as central regulators, such as HIF-1 and C-myc¹¹^,¹². Oncogene MYC encodes C-myc of the Myc family, which is a transcription factor involved in cell proliferation, apoptosis and metabolism, contributing to tumorigenesis¹³. C-myc modulates the genes involved in the biogenesis of ribosomes and mitochondria, glucose and glutamine metabolism¹⁴. C-myc is a key regulator of glycolysis and can transcriptionally elevate expression oflactate dehydrogenase A (LDHA), hexokinase 2 and pyruvate kinase isoform 2, which are important players in glycolysis¹⁵.

PLGF is a proangiogenic protein belonging to the VEGF family, which is implicated in vasculogenesis and angiogenesis¹⁶. Increasing studies have proved that PLGF is involved in the control of metastasis and vascularization of lung cancer¹⁷^,¹⁸. Previously, we have found that PLGF promotes invasion of non-small cell lung cancer via matrix metalloproteinase-9¹⁹. However, the associations between PIGF and promotion of tumor growth and glycolysis by hypoxia remain poorly understood. Here, we attempted to investigate the biological action of PLGF in lung adenocarcinoma (LUAD) cells under hypoxic condition and decipher the underlying molecular mechanisms. In our study, up-regulation of PLGF was firstly observed in cancer tissue. We knocked down and overexpressed PLGF in LUAD cells by using lentivirus so as to explore its effects on cell proliferation and glycolysis in response to hypoxia. Tumor xenografts in nude mice were adopted to verify its biological role as well. This study would deepen our understanding of the involvement of PLGF in the pathogenesis of LUAD.

Bioinformatics analysis

Gene expression data of 515 primary LUAD samples and 59 paired normal lung samples were downloaded from The Cancer Genome Atlas (TCGA) (https://gdc-portal.nci.nih.gov/). Expression level of PLGF was compared by LUAD and normal samples by use of 3.34.7 limma package²⁰ of R language. Overall survival time of patients with high and low PLGF expression was analyzed and compared by using Kaplan-Meier survival analysis and log-rank t test. Pathway enrichment analysis was carried out using gene set enrichment analysis software²¹.

Immunohistochemistry

Immunohistochemistry (IHC) was performed on purchased tissue microarrays at room temperature as described previously²². Briefly, paraffin-embedded tissue microarrays were blocked in 1% BSA (A8010, Solarbio, China) for 1 h. Subsequently, the tissue slices were incubated in specific primary antibodies against PLGF (ab196666, Abcam, Cambridge, UK) and β-catenin (ab16051, Abcam, Cambridge, UK) for 1 h, followed by incubation in HRP-labeled secondary antibodies (D-3004, Changdao, China) for 30 min. The tissue slices were stained with DAB (FL-6001, Changdao, China) for 5 min, and stained with hematoxylin (714094, BASO, Wuhan, China) for 3 min. Finally, the slices were examined on a microscope (ECLIPSE Ni, NIKON, Japan).

Cell culture and hypoxic treatment

RPMI-1640 medium (Hyclone, Logan, UT, US) was used to culture lung cancer cells (A549, H1975, H1650, H358, PC9) and human bronchial epithelial cell (16HBE). H1975 and H358 cells were cultured in a hypoxic chamber mixed with anaerobic gas (90% N₂, 5% CO₂) and 5% O₂ (hypoxia treatment) or in an incubator of 5% CO₂and 95% air (normoxia treatment).

Quantitative real-time PCR (qRT-PCR)

According to the manufacturers’ instructions, briefly, RevertAid First Strand cDNA Synthesis Kit (Fermentas, USA) was applied to transcribe the RNA samples into cDNA through reverse transcription. SYBR Green qPCR Master Mixes (Thermo Fisher, USA) was applied to amplify the cDNA product. The primer sequences used for PLGF, HIF-1α and GAPDH were listed in Table 1.

Western blot analysis

The lysates were separated by electrophoresis and transferred onto a PVDF membrane.The membrane were then incubated with primary antibodies (1:1000) and second antibodies sequentially. The following antibodies were used, including Anti-PLGF (ab196666), anti-HIF-1α (ab51608), anti-C-myc(ab32072), anti-LDHA (ab125683), anti-Survivin (ab76424), anti-β-catenin (ab32572), anti-H3 (ab1791) from Abcam (Cambridge, UK), and anti-GAPDH (#5174) from Cell Signaling Technology (Beverly, MA, USA).

Plasmid construction

PLGF interference sequences (shown in Table 2) were cloned into the pLKO.1-puro plasmid to knockdown PLGF. The primers enclosing the cutting sites of EcoR I and BanH I were used to synthesize the coding sequence of PLGF (X54936.1) which was merge into pLVX-Puro to promote PLGF overexpression:

PLGF-F: 5’-CGGAATTCATGCCGGTCATGAGGCTG-3’ (EcoR I)

PLGF-R: 5’-CGGGATCCTTACCTCCGGGGAACAGC-3’ (BamH I ).

Cell transfection

An aliquot of 2 ml of suspension (1×10⁶cells/ml) was inoculated into 6-well plates for overnight culture. When 60-70% confluence was reached,lung cancer cells were transfected with shPLGF-1, shPLGF-2, shPLGF-3 (MOI=5, 5 µl) and shNC (MOI=5, 5 µl), or oePLGF (MOI=5, 5 µl)and empty plasmids (vector, MOI=5, 5 µl) using Lipofectamine 2000 reagent (Invitrogen, CA, USA). The cells incubated with medium served as a control.

Cell counting kit-8 assay

Cell counting kit-8 (CCK-8) assay was applied using a Cell Proliferation and Cytotoxicity Assay Kit (SAB,USA). Briefly, 100 ml cell suspension (2×10³) of lung cancer cells (H1975, H358 or PC9) was added to each well of a 96-well plate, followed by different cell treatments. Eventually, 10 ml of CCK-8 solution was added to each well and optimal density (OD) at 450 nm was measured.

Cell mito stress test assay and Glycolysis stress test assay

Mitochondrial respiration experiments were conducted using the Mito Stress Test Kit and Glycolysis Stress Test Kit (Seahorse Bioscience, Billerica, MA, USA). OCR and ECAR were measured using a Seahorse the XF24 analyzer (Seahorse Bioscience, Billerica, MA, USA).

Cell mito stress test assay was performed as previously described²³. Cells were seeded into 96-well cartridges and pre-equilibrated with the assay medium for 1 h. OCR was assayed under basal conditions followed by sequentially loading pre-warmed oligomycin, FCCP, rotenone & antimycin A into the sensor cartridge. ATP coupler oligomycin allows for measurement of oxygen consumption for ATP synthesis.Uncoupling FCCP reagent is used to measure maximal OCR level for evaluation of the spare respiratory capacity. Rotenone and antimycin A arrests mitochondrial respiration by prohibiting mitochondrial complexes Ⅰ and Ⅱ. Final concentrations of these reagents have been demonstrated in a previous study by Tan et al.⁹.

Glycolysis stress test assay was carried out following the vendor instructions (Seahorse Bioscience, Billerica, MA, USA). Briefly, cells were calibrated by the assay medium. Glucose, oligomycin and 2-deoxyglucose (2-DG) were then sequentially added in the assay medium. ECAR was detected under basal conditions and after separate treatments of glucose, oligomycin, and 2-DG. Glucose addition promotes glycolysis, oligomycin treatment suppresses oxidative phosphorylation and permits analysis of maximal cellular glycolytic capacity, and 2-DG treatment is used to inhibit glycolysis.

Stable cell lines and xenograft study

H1975 cells (6×10⁶) infected with shPLGF-2 or shNC were injected into male nude mice (4-5 week old, Shanghai Laboratory Animal Company, Shanghai, China) subcutaneously. After measurement of tumor volume every three days,mice were sacrificed at 33 days. Tumor xenografts were collected, weighed and analyzed, followed by immunofluorescence (IF) microscopy for detection of anti-Ki-67 (ab23345, Abcam and hematoxylin-eosin (HE) staining. All animal experiments were performed following the ethics guidelines, and were approved by the ethnical committee.

IF microscopy

Briefly, tissue sections of tumor xenografts harvested from mice were incubated with anti-Ki-67 antibody (Abcam; 1:1000 dilution), Goat anti-Rabbit IgG (H+L) antibody (Beyotime Biotechnology; 1:500 dilution) before nuclei staining with DAPI (C1002, Beyotime Biotechnology; 1:500 dilution). A Laser scanning confocalmicroscope (Leica Microsystems Inc., USA) was used to observe the stained cells.

HE staining

Briefly, after embedding and fixingthe tissue sections (4-7 µm thickness) were immersed in xylene (Shanghai Sinopharm) and ethanol sequentially. Staining in hematoxylin solution lasted for 5 min and staining in eosin solution lasted for 1-2 min followed by alcohol dehydration. Eventually, a NIKON microscope (ECLIPSE Ni) and MS image analysis system (DS-Ri2, NIKON, Japan) were used to observe and analyze the tissue sections.

Statistical analysis

Data was present as mean ± SD. Statistical analysis was performed using GraphPad Prism software (version 7.0, USA), and each experiment was repeated at least three times. One-way analysis of variance (ANOVA) was applied for comparing mean values between different groups. p < 0.05 suggested significance.

PLGF was up-regulated in primary tumor tissues and in lung cancer cells

Using gene expression data of 515 primary LUAD samples and 59 paired normal lung samples downloaded from TCGA database, we found that PLGF expression was remarkably higher in LUAD tissues relative to the paired normal lung tissue (Figure 1A). The patients with high PLGF expression had significantly better prognosis compared to the patients with low PLGF expression (HR=2 (1.58-2.52), log-rank P=3.7e^-09, Figure 1B). Enrichment analysis revealed that PLGF up-regulation in LUAD was associated with glycolysis (Figure 1C). Representative IHC photographs of positive expression of PLGF and β-catenin in LUAD tissues microarrays showed elevated expression of β-catenin in the cancer tissues with high PLGF expression, but was decreased in cancer tissues with low PLGF expression (Figure 1D). The patients with low PLGF expression had significant better survival compared to the patients with high PLGF expression (p < 0.001, Figure 1D). Clinical stage (HR (95% CI): 2.72 (1.46-5.19); p < 0.01), tumor size (HR (95% CI): 2.92 (1.54-5.73); p < 0.01) and PLGF expression (HR (95% CI): 0.41 (0.22-0.77); p < 0.01) were identified to be independent risk factors of prognosis (Figure 1D). Additionally, PLGF- and β-catenin-positive expression was obviously weaker in para-cancer tissues. We further detected mRNA and protein level of PLGF in 5 lung cancer cell lines (A549, H1975, H1650, H358, and PC9) and human bronchial epithelial cells (16HBE) by qRT-PCR and Western blot. As seen in Figure 1E-F, the two approaches achieved consistent results that significant elevations of PLGF mRNA and protein were found in H358 cells (p < 0.01; p < 0.05) and H1975 cells (p < 0.001; p < 0.01), while significant reductions of PLGF mRNA and protein were found in PC9 cells (p < 0.05; p < 0.01), when compared with 16HBE cells. Therefore, H358, H1975 and PC9 cells were selected to be used in further experiments.

Knockdown and overexpression of PLGF in lung cancer cells

The expression of PLGF in H358 and H1975 cells was knocked down by lentivirus-mediated RNA interference. As shown in Figure 2A-B, all the three shRNAs effectively repressed PLGF expression at mRNA level in H358 and H1975 cells (p < 0.01 vs. shNC), each with knockdown efficiency higher than 70%. At protein level the silencing efficiency of shPLGF-1, shPLGF-2 and shPLGF-3 was higher than 60% in H358 cells (Figure 2B, p < 0.01). Nevertheless, in H1975 cells, unlike shPLGF-1 and shPLGF-2 which decreased PLGF protein by more than 60% (p < 0.01), shPLGF-3 failed to knockdown 50% of PLGF protein (Figure 2A). Taken together, we decided to use shPLGF-1and shPLGF-2 to infect lung cancer cells for silencing PLGF in further experiments.

PC3 cells were transfected with oePLGF plasmid for overexpressing PLGF or empty plasmid. Figure 2C showed a more than 10-fold elevation of PLGF mRNA (p < 0.001) and a 1-fold elevation of PLGF protein (p < 0.01) in the oePLGF-transfected PC3 cells compared to the vector-transfected cells, indicating successful overexpression of PLGF in PC3 cells.

Hypoxia treatment led to up-regulation of HIF-1α and PLGF in H358 and H1975 cells

H358 and H1975 cells were cultured under hypoxia (5% O₂and 5% CO₂) or normoxia (5% O₂ and 95% air) for 48 h. mRNA and protein levels of HIF-1α and PLGF were examined, separately. Exposure of H358 and H1975 cells to hypoxia caused significantly increased mRNA levels of HIF-1α and PLGF at 12 h (p < 0.05), 24 h and 48 h (p < 0.01, Figure 3A-B) compared to the cells exposed to normoxia. Similarly, in H1975 cells HIF-1α and PLGF protein were obviously elevated in response to hypoxia treatment for 12 h, 24 h and 48 h ((p < 0.05; p < 0.01; p < 0.01, Figure 3A). In H358 cells hypoxia exposure for 24 h and 48 h (p < 0.05; p < 0.01) induced remarkable increases of HIF-1α and PLGF protein, yet, 12-h hypoxia exposure brought about significantly increased HIF-1α protein (p < 0.05) and insignificantly increased PLGF protein (p > 0.05, Figure 3B). Therefore, we selected hypoxia treatment for 24 h in further experiments. Moreover, increases of mRNA and protein levels of HIF-1α and PLGF showed a time-dependent trend in H358 and H1975 cells upon hypoxia treatment.

Knockdown of PLGF abrogated the impact of hypoxia on H358 and H1975 cells

We further investigated the effect of PLGF on hypoxia-induced cell proliferation, OCR and ECAR levels by knocking down PLGF in H358 and H1975 cells. CCK-8 assay was utilized for measurement of cell proliferation. We observed significant increases of OD values at 450 nm in shNC-infected H358 and H1975 cells exposed to hypoxia compared to the cells exposed to normoxia at 24 h and 48 h (p < 0.05; p < 0.01, Figure 4A). Furthermore, OD values were significantly decreased in the shPLGF-1-or shPLGF-2-infected cells in comparison with the shNC-infected cells under hypoxia at 24 h and 48 h (p < 0.05; p < 0.01, Figure 4A).

We performed cell mito stress test assay to evaluate mitochondrial respiration by measurement of OCR pattern. As shown in Figure 4B, hypoxia and shNC infection resulted in observable increases of OCR levels in H358 and H1975 cells after subsequent exposure to oligomycin, FCCP, and rotenone and antimycin A. Infection ofH358 and H1975 cells with shPLGF-1 or shPLGF-2 partly ameliorated the increases of OCR levels induced by hypoxia.

Glycolysis stress test assay was performed to assess glycolytic respiration by measurement of ECAR. When using the assay, cells were cultured in the medium sequentially injected with glucose, oligomycin and 2-DG. In H358 and H1975 cells ECAR levels were remarkably elevated in response to hypoxia treatment after injection of glucose and oligomycin, and before 2-DG treatment (Figure 4C). The hypoxia-induced elevations of ECAR levels were partly reversed inH358 and H1975 cells by shPLGF-1 or shPLGF-2 infection (Figure 4C).

The above results suggest that hypoxia promoted cell proliferation and increased OCR and ECAR levels in H358 and H1975 cells, which could be partly alleviated by PLGF knockdown. It reports that hypoxia augments lung cancer development through activating Wnt signaling²⁴. Activation of Wnt/β-catenin pathway advances tumor progression by promoting transcription of C-myc²⁵ which directly regulates LDHA¹⁴. In order to decipher the underlying molecular mechanisms of PLGF in cell proliferation and glycolysis, we further examined protein expression of PLGF, β-catenin, C-myc and LDHA in H358 and H1975 cells by using Western blot.Not unexpectedly, hypoxia exposure resulted in significant up-regulation of PLGF (p < 0.05), C-myc (p < 0.01), LDHA (p < 0.05), and β-catenin (p < 0.01) in H358 and H1975 cells at protein level (Figure 4D). Moreover, PLGF knockdown by shPLGF-1 or shPLGF-2 infection significantly compromised the stimulation of hypoxia (Figure 4D). These results revealed that hypoxia up-regulated PLGF, β-catenin, C-myc and LDHA in H358 and H1975 cells, which could be partly mitigated by PLGF knockdown.

Suppression of Wnt/β-catenin pathway abolished the enhancement of cell proliferation and glycolysis caused by PLGF overexpression in PC9 cells

In order to further determine whether Wnt/β-catenin pathway participated in mediating the impact of PLGF on lung cancer cells, we overexpressed PLGF in PC9 cells by transfection with oePLGF plasmid, which were then incubated with XAV939 (10 μmol/L), inhibitor of Wnt/β-catenin pathway, for 24 h. In PC9 cells, PLGF overexpression significantly stimulated cell proliferation (p < 0.05), elevated OCR and ECAR levels, and up-regulated β-catenin, C-myc and LDHA protein (p < 0.05, Figure 5). Incubation with XAV939 markedly reversed the induction of PLGF overexpression (Figure 5). These observations suggest that like hypoxia exposure, PLGF overexpression exerted a stimulatory effect on cell proliferation, glycolysis, protein expression of C-myc and LDHA, which was mediated via Wnt/β-catenin pathway.

PLGF knockdown induced a suppression of tumor growth in nude mice

We further analyzed the biological activity of PLGF in tumor xenografts by injecting H1975 cells infected with shPLGF or shNC into nude mice. The results showed that the shPLGF xenografts had lighter tumor weight (p < 0.01), smaller tumor volume (p < 0.05) and weaker positive staining for Ki-67, a biomarker of cell proliferation²⁶, compared to the shNC xenografts. Western blot analysis of PLGF, β-catenin, C-myc and LDHA in tumor tissues revealed that depletion of PLGF caused significant reductions of protein levels of C-myc, β-catenin, and LDHA in shPLGF xenografts, which were in accordance with the results in H358 and H1975 cells. It implied that PLGF was involved in modulating tumor growth by modulating protein expression of β-catenin, C-myc, and LDHA.

PLGF has been found to have a multifaceted role in cancer progression, angiogenesis and prognosis²⁷. PLGF participates in regulating invasion of several types of cancers, such as ovarian cancer²⁸^,²⁹ and cutaneous T-cell lymphoma³⁰. Moreover, there is evidence that PLGF expression in tumor tissue could be a promising biomarker of therapeutic efficacy of ramucirumab in patients with gastric cancer³¹. Based on TCGA data, bioinformatics analysis of the present study revealed that PLGF was up-regulated in tumor tissue and two LUAD cell lines (H358 and H1975). Moreover, in vivo data obtained in the current study suggested that PLGF silencing suppressed tumor growth as seen by lighter and smaller tumors with decreased Ki-67 expression after PLGF knockdown in nude mice. These results supported the significance of PLGF in promoting LUAD progression, which is in concordance with previous studies^17-19.

PLGF has been reported to be overexpressed as a result of up-regulation of HIF induced by hypoxia³². Similarly, in our study western blot and RT-PCR results consistently showed that PLGF and HIF-1α were markedly up-regulated in H358 and H1975 cells on exposure to hypoxia. Hypoxia is closely associated with angiogenesis, apoptosis, and treatment resistance of lung cancer, and has emerged as a promising target for therapies³³ . In our study, along with significantly increased OD values that were observed in H358 and H1975 cells after hypoxia exposure, we observed remarkable increases of OCR and ECAR levels, demonstrating that hypoxia stimulated cell proliferation and glycolysis in lung cancer. Moreover, PLGF knockdown successfully attenuated the stimulation of cell proliferation and glycolysis of lung cancer cells by hypoxia.

LDHA is a cytosolic enzyme primarily implicated in converting pyruvate into lactate in anaerobic glycolysis³⁴. Up-regulation of LDHA has been demonstrated in several cancers and associates with carcinogenesis and tumor progression³⁵. Results obtained from the current study showed that hypoxia exposure brought about elevations of expression of C-myc and LDHA in LUAD cells, which were alleviated by knocking down PLGF. Moreover, our study provided in vivo evidence that PLGF silencing caused down-regulation of C-myc and LDHA by examining tumor xenografts harvested from mice and in vitro evidence that PLGF overexpression resulted in up-regulation of C-myc and LDHA. These results further confirmed that the stimulatory effect of hypoxia on glycolysis could be successfully reversed by PLGF knockdown in LUAD. In light of above findings,we speculate that PLGF may be a promising therapeutic target for LUAD.

Wnt/β-catenin pathway has a profound role in proliferation, apoptosis of lung cancer cells, affecting tumorigenesis and prognosis³⁶^,³⁷. Targeting Wnt/β-catenin raises the possibility of developing novel drugs against lung cancer³⁸. Hypoxia activates Wnt/β-catenin pathway in non-small cell lung cancer and hepatocellular carcinoma³⁹^,⁴⁰. In the current study, hypoxia exposure and PLGF overexpression had similar stimulatory effect on expression of β-catenin in lung cancer cells. Moreover, PLGF silencing obviously reduced β-catenin expression in lung cancer cells and tumors xenografts. These findings imply that Wnt/β-catenin pathway may be a downstream target of PLGF in LUAD, which is in agreement with a report supporting involvement of PLGF in apoptosis of gastric cancer stem cells through Wnt signaling pathway⁴¹. Furthermore, our study revealed that inhibition of Wnt/β-catenin pathway effectively eliminated the stimulatory effect of PLGF overexpression on cell proliferation and expression of C-myc and LDHA. It implied that PLFG might modulate cell proliferation and glycolysis of LUAD via downstream Wnt/β-catenin pathway.

This study offers novel insights into the molecular mechanisms of PLGF in LUAD. Yet, PLGF is not overexpressed and Wnt/β-catenin pathway is not inhibited in mice models to validate the associations of PLGF and Wnt/β-catenin pathway. Further experiments are necessary to address this issue.

Taken together, this study suggests that PLGF knockdown ameliorates the stimulation of cell proliferation and glycolysis caused by hypoxia by suppressing Wnt/β-catenin pathway. This study presents PLGF as a potential therapeutic target for LUAD and aids in dissecting the detailed mechanisms underlying the biological functions of PLGF in LUAD.

PLGF: Angiogenic placental growth factor, LUAD: Lung adenocarcinoma, LDHA: Lactate dehydrogenase A, HIF-1: Hypoxia-inducible factor-1, VEGF: Vascular endothelial growth factor, OCR: Oxygen consumption rates, ECAR: extracellular acidification rate, TCGA: The Cancer Genome Atlas, IHC: Immunohistochemistry, 16HBE: Human bronchial epithelial cell, qRT-PCR: Quantitative real-time PCR, CCK-8: Cell counting kit-8, OD: Optimal density, 2-DG: 2-deoxyglucose, IF: Immunofluorescence, HE: Hematoxylin-eosin, ANOVA: One-way analysis of variance

Acknowledgements

Not applicable.

Funding

This work was supported by Roles and mechanisms of E-cadherin /β-catenin/PLGF axis for non-small cell lung cancer development and progression (81874037) and The role and mechanism of IL-10/miR-125b/IGF-1 axis in the initiation and development of Non-small Cell Lung Cancer (8180100783).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors’ contributions

J.L. and Y.Q.L. conceived and designed the study. W.Z., Y.W.Z., F.F.Q., W.S.Z., M.J.H., and Y.C. performed the experiments. J.L. and W.Z wrote the manuscript. Y.Q.L. reviewed and revised the manuscript. All authors read and approved the manuscript and agreed to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

All experiments conducted in this study were approved by the Ethics Committee of Shanghai Chest Hospital, Shanghai Jiao Tong University and written informed consent was obtained.

Patient consent for publication

Not applicable.

Conflicts of interest

The authors declare no conflicts of interest.

Daskalaki I, Gkikas I, Tavernarakis N. Hypoxia and Selective Autophagy in Cancer Development and Therapy. Front Cell Dev Biol 2018;6:104.
Bhandari V, Hoey C, Liu LY, Lalonde E, Ray J, Livingstone J, Lesurf R, Shiah Y, Vujcic T, Huang X. Molecular landmarks of tumor hypoxia across cancer types. Nature Genetics 2019;51(2):308-318.
Muz B, de la Puente P, Azab F, Azab AK. The role of hypoxia in cancer progression, angiogenesis, metastasis, and resistance to therapy. Hypoxia (Auckl) 2015;3:83-92.
Luo W, Wang Y. Hypoxia Mediates Tumor Malignancy and Therapy Resistance. Adv Exp Med Biol 2019;1136:1-18.
Rath G, Aggarwal R, Jawanjal P, Tripathi R, Batra A. HIF-1 Alpha and Placental Growth Factor in Pregnancies Complicated With Preeclampsia: A Qualitative and Quantitative Analysis. J Clin Lab Anal 2016;30(1):75-83.
Semenza GL. HIF-1 mediates metabolic responses to intratumoral hypoxia and oncogenic mutations. J Clin Invest 2013;123(9):3664-71.
Ganapathy-Kanniappan S. Linking tumor glycolysis and immune evasion in cancer: Emerging concepts and therapeutic opportunities. Biochim Biophys Acta Rev Cancer 2017;1868(1):212-220.
Shi Y, Liu S, Ahmad S, Gao Q. Targeting Key Transporters in Tumor Glycolysis as a Novel Anticancer Strategy. Current Topics in Medicinal Chemistry 2018;18(6):454-466.
Tan B, Xiao H, Li F, Zeng L, Yin Y. The profiles of mitochondrial respiration and glycolysis using extracellular flux analysis in porcine enterocyte IPEC-J2. Anim Nutr 2015;1(3):239-243.
Ganapathy-Kanniappan S, Geschwind JF. Tumor glycolysis as a target for cancer therapy: progress and prospects. Mol Cancer 2013;12:152.
Courtnay R, Ngo DC, Malik N, Ververis K, Tortorella SM, Karagiannis TC. Cancer metabolism and the Warburg effect: the role of HIF-1 and PI3K. Mol Biol Rep 2015;42(4):841-51.
Nagao A, Kobayashi M, Koyasu S, Chow CCT. HIF-1-Dependent Reprogramming of Glucose Metabolic Pathway of Cancer Cells and Its Therapeutic Significance. 2019;20(2).
Dejure FR, Eilers M. MYC and tumor metabolism: chicken and egg. The EMBO Journal 2017;36(23):3409-3420.
Dang CV, Le A, Gao P. MYC-induced cancer cell energy metabolism and therapeutic opportunities. Clin Cancer Res 2009;15(21):6479-83.
Hsieh AL, Walton ZE, Altman BJ, Stine ZE, Dang CV. MYC and metabolism on the path to cancer. Semin Cell Dev Biol 2015;43:11-21.
Nejabati HR, Latifi Z, Ghasemnejad T, Fattahi A, Nouri M. Placental growth factor (PlGF) as an angiogenic/inflammatory switcher: lesson from early pregnancy losses. Gynecol Endocrinol 2017;33(9):668-674.
Wang Z, Liu T. Placental growth factor signaling regulates isoform splicing of vascular endothelial growth factor A in the control of lung cancer cell metastasis. Mol Cell Biochem 2018;439(1-2):163-169.
He C, Zhu K, Bai X, Li Y, Sun D, Lang Y, Ning J, Sun F, Qu C, Xu S. Placental Growth Factor Mediates Crosstalk Between Lung Cancer Cells and Tumor-Associated Macrophages in Controlling Cancer Vascularization and Growth. Cell Physiol Biochem 2018;47(6):2534-2543.
Zhang W, Zhang T, Lou Y, Yan B, Cui S, Jiang L, Han B. Placental Growth Factor Promotes Metastases of Non-Small Cell Lung Cancer Through MMP9. Cellular Physiology and Biochemistry 2015;37(3):1210-1218.
Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 2015;43(7):e47.
Reimand J, Isserlin R, Voisin V, Kucera M, Tannus-Lopes C, Rostamianfar A, Wadi L, Meyer M, Wong J, Xu C and others. Pathway enrichment analysis and visualization of omics data using g:Profiler, GSEA, Cytoscape and EnrichmentMap. Nature Protocols 2019;14(2):482-517.
Thoren LA, Nørgaard GA, Weischenfeldt J, Waage J, Jakobsen JS, Damgaard I, Bergström FC, Blom AM, Borup R, Bisgaard HC and others. UPF2 is a critical regulator of liver development, function and regeneration. PLoS One 2010;5(7):e11650.
Curley SA, Palalon F, Sanders KE, Koshkina NV. The effects of non-invasive radiofrequency treatment and hyperthermia on malignant and nonmalignant cells. Int J Environ Res Public Health 2014;11(9):9142-53.
Hong CF, Chen WY, Wu CW. Upregulation of Wnt signaling under hypoxia promotes lung cancer progression. Oncol Rep 2017;38(3):1706-1714.
Shang S, Hua F, Hu ZW. The regulation of β-catenin activity and function in cancer: therapeutic opportunities. Oncotarget 2017;8(20):33972-33989.
Agboola AJ, Banjo A, Anunobi CC, Salami BA, Agboola MD, Musa AA, Nolan CC, Rakha EA, Ellis IO, Green AR. Cell Proliferation (KI-67) Expression Is Associated with Poorer Prognosis in Nigerian Compared to British Breast Cancer Women. International Scholarly Research Notices 2013;2013:675051-675051.
Albonici L, Giganti MG, Modesti A, Manzari V, Bei R. Multifaceted Role of the Placental Growth Factor (PlGF) in the Antitumor Immune Response and Cancer Progression. 2019;20(12).
Song N, Liu H, Ma X, Zhang S. Placental Growth Factor Promotes Ovarian Cancer Cell Invasion via ZEB2. Cell Physiol Biochem 2016;38(1):351-8.
Song N, Liu H, Ma X, Zhang S. Placental growth factor promotes metastases of ovarian cancer through MiR-543-regulated MMP7. Cell Physiol Biochem 2015;37(3):1104-12.
Miyagaki T, Sugaya M, Oka T, Takahashi N, Kawaguchi M, Suga H, Fujita H, Yoshizaki A, Asano Y, Sato S. Placental Growth Factor and Vascular Endothelial Growth Factor Together Regulate Tumour Progression via Increased Vasculature in Cutaneous T-cell Lymphoma. Acta Derm Venereol 2017;97(5):586-592.
Natsume M, Shimura T. Placental growth factor is a predictive biomarker for ramucirumab treatment in advanced gastric cancer. 2019;83(6):1037-1046.
Tudisco L, Orlandi A, Tarallo V, De Falco S. Hypoxia activates placental growth factor expression in lymphatic endothelial cells. Oncotarget 2017;8(20):32873-32883.
Salem A, Asselin M, Reymen B, Jackson A, Lambin P, West CML, Oconnor JPB, Faivrefinn C. Targeting Hypoxia to Improve Non-Small Cell Lung Cancer Outcome. Journal of the National Cancer Institute 2018;110(1):14-30.
Miao P, Sheng S, Sun X, Liu J, Huang G. Lactate dehydrogenase A in cancer: a promising target for diagnosis and therapy. IUBMB Life 2013;65(11):904-10.
Feng Y, Xiong Y, Qiao T, Li X, Jia L, Han Y. Lactate dehydrogenase A: A key player in carcinogenesis and potential target in cancer therapy. Cancer Medicine 2018;7(12):6124-6136.
Stewart DJ. Wnt signaling pathway in non-small cell lung cancer. J Natl Cancer Inst 2014;106(1):djt356.
Wang JY, Wang X, Wang XJ, Zheng BZ, Wang Y, Wang X, Liang B. Curcumin inhibits the growth via Wnt/β-catenin pathway in non-small-cell lung cancer cells. Eur Rev Med Pharmacol Sci 2018;22(21):7492-7499.
Jiang HL, Jiang LM, Han WD. Wnt/β-catenin signaling pathway in lung cancer stem cells is a potential target for the development of novel anticancer drugs. J buon 2015;20(4):1094-100.
Xu W, Zhou W, Cheng M, Wang J, Liu Z, He S, Luo X, Huang W, Chen T, Yan W and others. Hypoxia activates Wnt/β-catenin signaling by regulating the expression of BCL9 in human hepatocellular carcinoma. Sci Rep 2017;7:40446.
Wei H, Zhang F, Wang J, Zhao M, Hou T, Li L. Dehydroeffusol inhibits hypoxia-induced epithelial-mesenchymal transition in non-small cell lung cancer cells through the inactivation of Wnt/β-catenin pathway. Biosci Rep 2020;40(5).
Akrami H, Mehdizadeh K, Moradi B, Farahani DB, Mansouri K, Alnajar SGI. PlGF knockdown induced apoptosis through Wnt signaling pathway in gastric cancer stem cells. Journal of Cellular Biochemistry 2019;120(3):3268-3276.

Table 1 The primer sequences used for qRT-PCR

Primer	Sequences
PLGF-Primer F	5' CATGTTCAGCCCATCCTGTG 3'
PLGF-Primer R	5' ACCTTTCCGGCTTCATCTTC 3'
HIF-1α-Primer F	5' AGAGTTACCTGCCCTGTCCC 3'
HIF-1α-primer R	5' GCCAAAACCGTCCCGAAG 3'
GADPH-Primer F	5' AATCCCATCACCATCTTC 3'
GADPH-Primer R	5' AGGCTGTTGTCATACTTC 3'

Table 2 PLGF interference sequences

Name	Sequences
PLGF site 1 (583-601)	GGCGATGAGAATCTGCACT
PLGF site 2 (629-647)	CCATGCAGCTCCTAAAGAT
PLGF site 3 (636-654)	GCTCCTAAAGATCCGTTCT

Download PDF

Journal Publication

published 06 Jan, 2021

Read the published version in Cancer Cell International →

Editorial decision: Major revision
07 Oct, 2020
Review #4 received at journal
06 Oct, 2020
Review #5 received at journal
25 Sep, 2020
Reviewer #5 agreed at journal
23 Sep, 2020
Review #1 received at journal
23 Sep, 2020
Reviewers invited by journal
22 Sep, 2020
Reviewer #1 agreed at journal
22 Sep, 2020
Reviewer #2 agreed at journal
22 Sep, 2020
Reviewer #3 agreed at journal
22 Sep, 2020
Reviewer #4 agreed at journal
22 Sep, 2020
Review #2 received at journal
22 Sep, 2020
Review #3 received at journal
22 Sep, 2020
Editor assigned by journal
16 Sep, 2020
Submission checks completed at journal
15 Sep, 2020
Editor invited by journal
15 Sep, 2020
First submitted to journal
13 Sep, 2020

You are reading this latest preprint version

PLGF Knockdown Attenuates Hypoxia-Induced Stimulation of Cell Proliferation and Glycolysis of Lung Adenocarcinoma Through Inhibiting Wnt/β-Catenin Pathway

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

List Of Abbreviations

Declarations

References

Tables

Status:

Journal Publication

Version 1