Animals and drugs
Eight-week-old male Sprague-Dawley (SD) rats, weighing approximately 190 g-210 g, were purchased from SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The rats had free access to food and water and maintained at 23 ±3℃,relative humidity of 55 ± 15% with a 12 h light/12 h dark cycle. SSR consists of Salvia miltiorrhiza bge 15 g, Codonopsis pilosula 15 g, Angelica sinensis 15 g, Rheum palmatum 15 g, Folium perillae 15 g, Epimedium 15 g, Peach kernel 15 g, Ligusticum chuanxiong 15 g and Coptis chinensis 6 g. The preparation of SSR was consistent with the previous standard protocol and the gavage dose (10 mL/kg, containing 6 g/mL of the original drug) in this study was determined on the basis of the previous studies[7,8]. Losartan tablets (100 mg/tablet) were purchased from MSD Pharmaceutical Co., Ltd.(Hangzhou, China). Losartan was dissolved and diluted by saline with a concentration of 5 mg/mL of solution.
Rat 5/6 (A/I) model and animal study protocol
The 5/6 (A/I) hypoxia model was established as described in our previous work[7-10]. Four weeks after 5/6 (A/I) operation, 30 rats were randomized into three groups: 5/6 (A/I) group, 5/6 (A/I) + SSR group (treated with 10 mL/kg of SSR daily by gavage, n=10) and 5/6 (A/I) +Losartan group (5/6 (A/I) +LOR, treated with 6mL/kg of losartan daily by gavage, n=10). This study also included a group of 10 sham-operated rats. After 8 weeks of administration, the rats were anaesthetized with sodium pentobarbital (40 mg/kg, i.p.) and the kidney tissues were collected for molecular detection.
Isolation of cytosolic and mitochondrial fractions
Using tissue mitochondria isolation kit (Inventbiotech, Beijing, China), the cytosolic and mitochondrial fractions were extracted at 4℃ by centrifugal column filter and multiple centrifugation method. About 30mg of tissue was placed in a filter cartridge. The tissue was ground with a plastic rod for one minute by pushing the tissue against the surface of the filter repeatedly. The filter cartridge was centrifuged at 16,000 g for 30 seconds. The pellet was resuspend by vortexing briefly. The homogenates were first centrifuged at 700 g for one minute to remove cell debris and nuclei and then centrifuged at 16,000 g for 10 min to collect the supernatant as cytosolic fraction. The pellet was resuspend in 200μl buffer B and then centrifuged at 8,000 g for 5 min. The supernatant was further centrifuged at 16,000g for 30 min to collect the pellet as mitochondrial fraction.
Isolation of cytosolic and nuclear fractions
The cytosolic and nuclear fractions were extracted at 4℃ by the multiple centrifugation method, using nuclear and cytoplasmic protein extraction kit (Beyotime, Shanghai, China). About 50 mg of tissue was cut into pieces and homogenized gently in the cytoplasmic protein extraction reagent with a glass tissue grinder. The homogenates were centrifuged at 1500 g for 5 min to collect the supernatant as cytosolic fraction. The pellet was resuspend in 50 μl nuclear protein extraction reagent and then centrifuged at 16,000 g for 10 min to collect the supernatant as nuclear fraction.
Caspase3 activity analysis
The caspase3 activity was detected by caspase 3 activity assay kit (Jiancheng Bioengineering Institute, Nanjing, China). About 50mg of tissue was ground in lysis buffer with a glass homogenizer and then centrifuged at 12,000 g for 15 min. The supernatant protein was collected and quantified by Bradford method. The supernatant containing 200 μg protein was incubated with 50 μL reaction buffer and 5 μL caspase-3 substrate at 37 ℃ for 4 h. The caspase3 activity was measured at absorbance of 405nm.
Immunoprecipitation analysis
Immunoprecipitation analysis was performed as previously described[7]. Briefly, Kidney tissues were lysed on ice for 15 min in lysis buffer. Approximately 300 μg of total protein was incubated overnight at 4 °C with anti-P53 (Santa Cruz, USA) followed by precipitation with 70 μl of protein A/G-Plus-Agarose (Santa Cruz, USA) for 4 h at 4 ℃. Non-specific IgG (Proteintech) was used as the control. The precipitated complexes were washed in immunoprecipitation buffer and then, resuspended in 30 μl of 2× loading buffer and boiled for 5 min.
Hoechst 33,342 assay
The Hoechst 33,342 staining (Beyotime, Shanghai, China) was used to identify the morphology of apoptotic nuclei. The three-micrometer-thick sections were deparaffinized and then exposed to the Hoechst 33,342 solution for 5 min at 37℃ in the dark. The positive nuclei were observed by fluorescence microscope (Nikon Eclipse80i, Japan) at 200× magnification.
Western blot
Immunoblotting detection was performed as previously described[7,8]. In the present study, the primary antibodies used were anti-cytochrome c (1:1000, Abcam, UK), anti-Bcl2 (1:500, Genspan, USA), anti-Bax (1:1000, Abcam, UK), anti-SDHB (1:1000,Abcam, UK), anti-parp (1:1000,CST,USA), anti-Puma (1:500, Santa Cruz, USA), anti-ATPB (1:1000, Proteintech, USA), anti-caspase9 (1:1000, Abcam,UK) ,anti-P53 (1:1000,CST,USA), anti-P-p53(1:1000, Abcam, UK) and anti-Bcl-xL (1:1000,Abcam, UK). Lamin B1 (1:1000, Abclonal, China), VDAC1 (1:1000, Abcam,UK) and Gapdh(1:2000, Proteintech, USA) were used as the controls. The antigens on the blots were visualized by using the enhanced chemiluminescence kit (Thermo Fisher Scientific, USA).
Real-time PCR
Total RNA was extracted from kidney tissue using Trizol reagent (Beyotime, Shanghai, China) and reverse transcribed to cDNA using a TaqMan RNA Reverse Transcription Kit (Takara, Dalian, China) according to manufacturer’s instructions. Then, qPCR was performed on an ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, USA) with SYBR Green Master Mix (Yeasen, Shanghai, China) according to the instructions provided with the kit. Relative expression was determined by the 2−ΔΔCT method. β-actin was used as an internal control. The PCR reaction conditions were as follows: 95℃for 5min, followed by 40 cycles of 10s at 95 ℃ and 30s at 60 ℃. Primer sequences for Puma were: forward ACTGCCAGCCTTGCTTGTC and reverse AGTCCTTCAGCCCTCCCTTC; Bax primer sequences were: forward GGCGATGAACTGGACAAC and reverse CCGAAGTAGGAAAGGAGG; Noxa primer sequences were: forward GTTACCGCCTGAATTCGCAG and reverse AGTTATGTCCGGTGCACTCC; β-actin primer sequences were: forward GAGAGGGAAATCGTGCGT and reverse GGAGGAAGAGGATGCGG.
Statistical analysis
All data were presented as mean ± SEM and analyzed by one-way analysis of variance with LSD-t’s multiple comparison, using SPSS software (version 18.0, SPSS Inc., Chicago, USA). P < 0.05 was considered statistically significant.