Photoprotective Effects of Sargassum Thunbergii on Ultraviolet B-Induced Mouse L929 Fibroblasts and Zebrafish

doi:10.21203/rs.3.rs-782603/v1

Download PDF

Research Article

Photoprotective Effects of Sargassum Thunbergii on Ultraviolet B-Induced Mouse L929 Fibroblasts and Zebrafish

https://doi.org/10.21203/rs.3.rs-782603/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: Chronic exposure to ultraviolet B (UVB) causes a series of adverse skin reactions, such as erythema, sunburn, photoaging, and cancer, by altering signaling pathways related to inflammation, oxidative stress, and DNA damage. Marine algae have abundant amounts and varieties of bioactive compounds that possess antioxidant and anti-inflammatory properties. Thus, the objective of this study was to investigate the photoprotective effects of an ethanol extract of Sargassum thunbergii.

Methods: Sargassum thunbergii phenolic-rich extract (STPE) was prepared, and its activity against UVB damage was evaluated using L929 fibroblast cells and zebrafish. STPE was extracted and purified by 40% ethanol and macroporous resin XDA-7. Reactive oxygen species (ROS) and antioxidant markers, such as superoxide dismutase (SOD), catalase (CAT) activities, and malondialdehyde (MDA) content were analyzed. The effect of STPE on UVB-induced inflammation was determined by inflammatory cytokine gene and protein expression. The expression of signaling molecules in the Nuclear Factor KappaB (NF-κB) pathway was determined by western blotting. DNA condensation was analyzed and visualized by Hoechst 33342 staining. In vivo evaluation was performed by tail fin area and ROS measurement using the zebrafish model.

Results: The total polyphenol content of STPE was 72%. STPE reduced ROS content in L929 cells, improved SOD and CAT activities, and significantly reduced MDA content, thereby effectively alleviating UVB radiation-induced oxidative damage. STPE inhibited the mRNA and protein expression of TNF-α, IL-6, and IL-1α. STPE reversed DNA condensation at concentrations of 20 and 40 μg/mL compared with the UVB control. Moreover, STPE inhibited NF-κB signaling pathway activation and alleviated DNA agglutination in L929 cells after UVB irradiation. Additionally, 1.67 μg/mL STPE significantly increased the tail fin area in zebrafish, and 0.8–1.6 μg/mL STPE effectively eliminated excessive ROS after UVB radiation.

Conclusions: STPE inhibited UVB-induced oxidative stress, inflammatory cytokine expression, and DNA condensation via downregulation of the NF-κB signaling pathway, suggesting that it prevents UVB-induced cell damage and photoaging, and has potential for clinical development for skin disease treatment.

Integrative & Complementary Medicine

Sargassum thunbergii

ultraviolet B

photoprotective

L929 fibroblast

zebrafish

Among the types of ultraviolet (UV) rays that are not absorbed by the ozone layer, ultraviolet B (UVB) (wavelength 280–315 nm) is a major environmental risk factor for the pathogenesis of skin damage [1]. UVB delivers more energy into the skin than UVA (320–400 nm). Many skin diseases, such as cancer, photoaging, sunburn, and pigmentation, are closely associated with UVB exposure. Owing to its short wavelength, UVB is mainly absorbed in the epidermis; however, it can also penetrate this skin layer to reach the dermis and affect the physiological functions of fibroblasts [2]. Studies on UVB-irradiated skin or dermal fibroblasts have mainly focused on DNA mutations [3], inflammation [4], and photoaging [1, 5].

Marine phenolic compounds exhibit a wide range of physiological properties, including antioxidant, anti-inflammatory, anti-tumor, and anti-microbial properties [6, 7]. Recently, the UV protection activity of marine polyphenols has been intensively focused upon owing to the growing demand for anti-aging, anti-allergic, and whitening natural products in the skin health industry. Fucodiphlorethol G extracted from Ecklonia cava increases the viability of human keratinized cells exposed to UVB radiation by absorbing UVB, removing intracellular reactive oxygen species (ROS), and reducing 8-isoprostane generation and DNA fragmentation [8]. The phlorotannin fucofuroeckol-A, derived from Ecklonia stolonifera, demonstrates protective effects against UVB-induced allergic reactions in RBL-2H3 mast cells by decreasing histamine release, increasing intracellular Ca²⁺, inhibiting IL-1β and TNF-α production, and scavenging ROS [9]. Diphlorethohydroxycarmalol extracted from Ishige okamurae exhibits strong protective properties against UVB radiation via reducing intracellular ROS levels, reducing damaged DNA tail length, and causing morphological changes in fibroblasts [10].

In the last decades, marine algae has been an important source of natural products to find new compounds with pharmacological and nutraceutical properties. Sargassum thunbergii, an economically important brown algae located on China and Japan seas, contains many bioactive compounds, such as indole derivatives, indolediketopiperazine alkaloids, quinone derivatives, polyphenols, and polysaccharides [11]. S. Thunbergii lives in the intertidal zone because of which they have to withstand multiple changes due to tidal changes, including high solar irradiances, desiccation, changes in salinity, and temperature. Therefore, we speculated that phenolic compounds from S. Thunbergii might possess UV protective activity. However, few studies were carried out to estimate the photoprotective activity of S. thunbergii.

The mouse L929 fibroblast cell line is reportedly an effective in vitro screening test system for the phototoxicity assessment of drugs/chemicals [12]. Zebrafish (Danio rerio) are increasingly being considered as a model system for evaluating the efficacy of UVB protective compounds against fin damage and ROS generation [13, 14]. In this study, we established a UVB-exposed L929 cell and zebrafish photodamage model to study the UVB photoprotective activity of S. thunbergii phenolic-rich extract (STPE).

Reagents

A PierceTM BCA Protein Assay Kit, RPMI1640 medium, DPBS/MODIFIED, Trypsin-EDTA Solution, fetal bovine serum, and dual antibodies were purchased from Thermo Fisher Scientific (Waltham, MA, USA). A CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay (MTS) kit was obtained from Promega (Madison, WI, USA) and phenazine methosulfate was purchased from Sigma-Aldrich (St. Louis, MO, USA). High Efficiency RIPA tissue/cell rapid lysis solution was acquired from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). All antibodies were purchased from Abcam (Cambridge, MA, USA) or Cell Signaling Technology (Beverly, MA, USA) as follows: Nuclear Factor KappaB (NF-κB) p65 (D14E12) XP Rabbit mAb (#8242, dilution 1/1000), p-NF-κB p65 (Ser536) (93H1) rabbit mAb (#3033, dilution 1/1000), anti-IκBα antibody (ab32518, dilution 1/1000), anti-SDHA antibody (ab137040, dilution 1/1000), and anti-Lamin B antibody (ab133741, dilution 1/1000).

Phenolic compound extraction and purification

Fresh S. thunbergii from Dongtou Island, Zhejiang Province, was collected, washed, and freeze-dried. Dried S. thunbergii was crushed and powdered using a grinding mill. After 100-mesh screening, the powder was immersed in 40% (v/v) ethanol-water solution (solid to liquid ratio 1:15) for 60 min at 70°C. After a double extraction, the extract was filtered using a Buchner funnel under vacuum. The supernatants were centrifuged at 12 000 rpm for 30 min and concentrated to remove ethanol using a rotary evaporator (Buchi, Flawil, Switzerland). The crude S. thunbergii extract was further purified to obtain the STPE.

To purify the STPE, an XDA-7 macroporous resin (Sunresin Park, Xi’an, China) was used. Prior to use, the resin was activated by soaking with 95% ethanol for 24 h and subsequently washing thoroughly with deionized water. The resin was successively treated with 5% HCl and 4% NaOH solutions to remove potential monomers and porogenic agents trapped inside the pores during the synthesis process.

The crude extract was centrifuged at 12 000 rpm for 30 min and filtered using a 0.45 µM filter. Subsequently, the extract was purified using a polystyrene column (Ø: 10 mm; h: 300 mm) packed with XDA-7 resin. For polyphenol adsorption, 3.2 mg/mL crude extract was passed through the resin at a flow rate of 1 mL/min. The loaded resin was washed with 3 BV deionized water prior to desorption. Desorption of phenolic compounds from the loaded XDA-7 macroporous resin was performed using 60% (v/v) ethanol solutions at a rate of 2 mL/min. The eluent was collected and concentrated under reduced pressure in a rotary evaporator. Finally, the purified extracts were stored at -80°C until further analysis.

The total polyphenol content was determined using the colorimetric Folin–Ciocalteu method with some modifications [15]. Gallic acid was used as a standard phenolic compound. One milliliter of extract solution contained 1 mg extract diluted with distilled water. Five milliliter of Folin-Ciocalteu reagent (10%) was added and the content was mixed thoroughly. After 3–8 min, 4 mL of 7.5% Na₂CO₃ was added and the mixture was allowed to stand for 1 h with occasional shaking. The absorbance was measured at 765 nm.

Cell culture and treatment

Murine L929 fibroblasts were grown in Dulbecco’s modified eagle medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) and 1% (v/v) penicillin/streptomycin at 37°C and 5% CO₂. Depending on the experiment, the cells were seeded in 96-well plates (1×10⁵ cells/mL), 24-well plates (1×10⁵ cells/mL), 6-well plates (1.5×10⁵ cells/mL), or 60 mm culture dishes (2×10⁵ cells/mL), and maintained in a tissue culture incubator overnight to allow adherent monolayer formation. After serum starvation, by culturing in a medium containing 3% FBS for 12 h, the cells were treated with different concentrations of STPE (0–1000 µg/mL) for 24 h. The culture medium was replaced with a thin layer of fresh Hank’s Balanced Salt Solution (HBSS) (Hyclone, Logan, UT, USA) and cells were irradiated with the appropriate UVB dose using a UV spectral radiometer (VLX-3 W, Vilber Lourmat, France). HBSS was subsequently replaced with culture medium cotaining 3% FBS and incubated until analysis.

Cell viability assay

Cell viability was evaluated using 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation assay (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Briefly, L929 cells were seeded in 96-well plates at a density of 10⁴ cells/well, and allowed to attach overnight. Cells were starved by culturing in a medium containing 3% FBS for 12 h. For the cytotoxicity profile evaluation, the cells were treated for 24 h with different concentrations of STPE. For the selection of the exposed dose, the cells were exposed to different doses of UVB (10, 20, 40, 80, 160, and 320 mJ/cm²) and incubated for 24 h. For the protective evaluation under UVB rays, the cells were treated for 24 h with STPE, washed twice with HBSS, exposed to radiation, and incubated for a further 24 h. After the respective treatment conditions, 20 µL of MTS solution was added to wells for another 45 min, and the absorbance at 490 nm was measured with a microplate reader (Tecan, Männedorf, Switzerland). At least three independent experiments were performed.

ROS production

The intracellular accumulation of ROS was detected by 2,7-dichlorodihydrofluorescein diacetate (H₂DCF-DA) (D6883, Sigma-Aldrich, St. Louis, MO, USA). The cells were treated with STPE for 24 h and then incubated with 20 µM H₂DCF-DA for 30 min at 37°C. Subsequently, the cells were washed three times with HBSS and exposed to 100 mJ/cm² UVB. Fluorescence was measured at 488/525 nm 1 h after UVB exposure using Tecan Infinite M200 PRO (Tecan).

Cellular antioxidant enzyme activity and lipid peroxidation

L929 cells were cultured in 60 mm tissue culture dishes at 1.6 × 10⁶ cells/dish. After treatment with different concentrations of STPE (0, 10, 20, and 40 µg/mL) for 24 h, the cells were exposed to 20 mJ/cm² UVB and incubated for a further 24 h. The cells were collected and resuspended in 400 µL of phosphate-buffered saline (PBS). The cells were disrupted using TissueLyser II (Qiagen, Hilden, Germany) and superoxide dismutase (SOD) and catalase (CAT) within the lysates were measured with appropriate assay kits (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. Intracellular lipid peroxidation was evaluated by measuring malondialdehyde (MDA) production using a commercial kit (Jiancheng Bioengineering Institute, Nanjing, China).

RNA isolation, reverse transcription, and quantitative PCR (qPCR) analysis

L929 cells were pretreated with different concentrations of STPE for 24 h. The total RNA sample was collected and extracted using an RNAprep Pure kit (Tiangen Biotech, Beijing, China) 24 h after the end of UVB exposure at 10 mJ/cm². Reverse transcription was performed with 1 µg of total RNA using a PrimeScript RT Master Mix (Takara Bio, Otsu, Japan), and real-time qPCR was performed using a FastStart Universal SYBRGreen Master kit (Roche, Basel, Switzerland). The primers used for amplification of the target genes (inflammation-related genes, such as TNF-α, IL-1α, and IL-6) and the reference gene (succinate dehydrogenase complex flavoprotein subunit A, SDHA) are listed in Table 1. Relative quantification of target gene expression levels was performed using the 2^−ΔΔCt method.

Table 1

Primers used for real-time qPCR
Gene	Primer sequence (5′→3′)	GenBank accession no. or reference
SDHA	GGAACACTCCAAAAACAGACCT	NM 023281
SDHA	CCACCACTGGGTATTGAGTAGAA	NM 023281
IL-1α	TCTATGATGCAAGCTATGGCTCA	NM 010554
IL-1α	CGGCTCTCCTTGAAGGTGA	NM 010554
IL-6	CCCAATTTCCAATGCTCTCC	[16]
IL-6	TCCACAAACTGATATGCTTAGG
TNF-α	ACAAGGCTGCCCCGACTAC
TNF-α	TGGAAGACTCCTCCCAGGTATATG

Enzyme-linked immunosorbent assay (ELISA)

The cell culture supernatant was collected and concentrated 20 times in an ultrafilter tube prior to cytokine measurement by ELISA, according to the manufacturer’s instructions. The ELISA kits for TNF-α, IL-6, and IL-1α were purchased from Novus Biologicals (Littleton, CO, USA) or ProteinTech (Wuhan, China). Absorbances were determined at 450 nm using a microplate spectrophotometer reader (Tecan), and the results are expressed as picograms (pg) of each cytokine/mL.

Western blotting

For NF-κB nuclear translocation analysis, after 24 h of UVB irradiation, the separation of cytosolic and nuclear components of L929 cells was performed using NE-PER nuclear and cytoplasmic extraction reagents (Thermo Fisher Scientific), according to the manufacturer’s instructions. The amount of protein was estimated using the PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific). Afterward, equal amounts of protein were collected and heated at 100°C for 5 min in a loading buffer. The proteins were electrophoresed on a 12% SDS-polyacrylamide gel and transferred to a polyvinylidene fluoride membrane (Pall Corporation, NY, USA) in a transfer buffer (25 mM Tris base, 250 mM glycine, 20% methanol). The membranes were blocked with 5% skim milk (BD Difco, NJ, USA) in PBS containing 0.05% Tween 20 buffer overnight at 4°C and incubated with primary antibodies (NF-κB p65 (D14E12) XP Rabbit mAb, p-NF-κB p65 (Ser536) (93H1) rabbit mAb, anti-IκBα antibody, anti-SDHA antibody, and anti-Lamin B antibody) for 2 h at room temperature. Membranes were washed and incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody for 1 h at room temperature. The antigen-antibody complex was detected by chemiluminescence using ECL detection reagent (Advansta, CA, USA) and analyzed using the ChemiDoc® XRS + Imaging System (Tanon-5200s, Tanon, Shanghai, China) (Additional file 1).

Hoechst 33342 staining

The intensity of nuclear condensation was examined using the cell-permeable DNA dye Hoechst 33342. The probe (2 µg/mL) was added after 24 h of UVB exposure, and cells were incubated for 20 min at 37°C and washed twice with PBS. The cells were then visualized under a fluorescence microscope (DMI8, Leica, Wetzlar, German).

Effects of STPE on zebrafish growth

Embryos of AB wild-type zebrafish developed at 2 d post-fertilization (dpf) were collected and randomly divided into 30 embryos per experimental group. Embryos were treated with STPE at concentrations of 5, 10, 25, 100, 250, 500, 1000, and 2000 µg/mL for 24 h, and exposed to UVB generated by an ultraviolet light therapy instrument (KN-4006, Xuzhou, China) at 3 dpf. For UVB exposure, each group was exposed five times separated by 30 min intervals. Each exposure delivered 8100 mJ/cm² of energy. After UVB exposure, all embryos were cultivated in 6-well cell culture plates and the survival rates were counted at 5 dpf.

Repairing effect of STPE on caudal fin damage in UVB-irradiated zebrafish

Embryos developed at 2 dpf were collected and randomly divided into 30 embryos per experimental group. Embryos were treated with different concentrations of STPE (0.56, 1.67, and 5 µg/mL) or epigallocatechin gallate (EGCG; 30 µg/mL) for 24 h. After UVB exposure at 3 dpf, all embryos were cultivated in 6-well cell culture plates at 28°C until 5 dpf. The culture medium was changed daily throughout the experiment. Ten zebrafish were randomly selected from each group to observe their tails under a dissecting microscope (SZX7, Olympus, Tokyo, Japan). Images were taken and analyzed using an image processing software (NIS-Elements D 4.30.00) to calculate the area of the caudal fin of the larva. The caudal fin area was used to evaluate the effect of STPE on the repair of UV irradiation-induced skin damage in zebrafish. Results were analyzed using one-way ANOVA with post-hoc Dunnett’s t-test. Differences were considered to be significant when p < 0.05. Treatment results are expressed as the mean ± SE. Skin damage repair of zebrafish was calculated using the following formula:

Effect of STPE on ROS scavenging in UVB-irradiated zebrafish

Embryos developed at 2 dpf were collected and randomly divided into 30 embryos per experimental group. Embryos were treated with different concentrations of STPE (0.8, 1.2, and 1.6 µg/mL) or EGCG (30 µg/mL) for 24 h. After 2 h of UVB exposure at 3 dpf, embryos were incubated with 500 ng/mL CM-H₂DCF-DA (Invitrogen, Waltham, USA) for 20 h. The embryos were subsequently placed in a 96-well blackboard (1 per well, 8 per group). The fluorescence intensity of the embryo (FI) was measured at excitation/emission = 485/535 nm (Tecan, Austria). The results were statistically analyzed using one-way ANOVA and Dunnett’s t-test. The effect of STPE on oxygen radical scavenging in zebrafish was calculated as follows:

STPE reverses the UVB-induced decrease in cell viability

S. thunbergii was extracted twice at 70°C with 40% anhydrous ethanol, and then purified with the macroporous adsorbent resin XDA-7 to obtain STPE. The total polyphenol content of STPE was 72% as determined using the colorimetric Folin–Ciocalteu method.

To determine STPE cytotoxicity, L929 cells were treated with various concentrations of STPE (0–320 µg/mL) for 24 h. STPE at concentrations of 10–40 µg/mL had no effect on cell viability relative to the untreated group (p > 0.05; Fig. 1a), although cytotoxicity was observed at 80 µg/mL (p < 0.05). Based on this, 10–40 µg/mL STPE was used in subsequent assays. Cells were treated with various doses of UVB (0–320 mJ/cm²) and cultured for 24 h to determine the appropriate irradiation dose to induce photodamage. UVB reduced cell viability in a concentration-dependent manner (Fig. 1b); 20 mJ/cm² UVB decreased cell viability by approximately 50% and was selected as the UVB dose in subsequent experiments. Cell viability was reduced to 60% following exposure to UVB alone compared with that of the experimental control (Fig. 1c). However, pretreatment of cells with STPE (10–40 µg/mL) reversed this effect in a concentration-dependent manner, and was significantly different at 40 µg/mL from that of the UVB model group.

STPE inhibits oxidative stress and lipid peroxidation

The intracellular ROS scavenging effects of STPE induced by UVB were assessed using H₂DCF-DA oxidant-sensitive fluorescent probes. The scavenging effect of STPE on the intracellular ROS generated by UVB exposure was measured using a microplate reader (Fig. 2a). The ROS level in UVB-exposed cells increased 2.35-fold compared with that in control cells. However, 24 h pretreatment of cells with increasing concentrations of STPE resulted in a concentration-dependent reduction of intracellular ROS.

SOD and CAT are important antioxidant enzymes that protect tissues from oxidative damage. MDA production is used to evaluate intracellular lipid peroxidation owing to oxidative stress. The protective mechanisms of STPE were evaluated by measuring the levels of SOD, CAT, and MDA. Compared with those in the control group, SOD levels decreased following UVB exposure; however, this was abrogated by STPE pretreatment at 20 and 40 µg/mL (Fig. 2c). CAT activity was elevated after STPE treatment at 40 µg/mL (Fig. 2d). The increase in MDA content (Fig. 2b) induced by UVB (p < 0.05) was reversed by pretreatment with 40 µg/mL STPE (p < 0.05).

STPE alleviates UVB-induced inflammation in L929 cells

To evaluate the effects of STPE on inflammatory cytokine production in UVB-exposed L929 cells, the mRNA and protein expression levels were measured by real-time qPCR (Fig. 3a) and ELISA (Fig. 3b), respectively. UVB exposure stimulated the expression of TNF-α, IL-1α, and IL-6 mRNA compared with control cells. However, treatment with 40 µg/mL STPE decreased TNF-α and IL-6 mRNA expression levels. STPE reduced UVB-induced TNF-α, IL-6, and IL-1α protein production in a dose-dependent manner.

STPE inhibits NF-κB activation in UVB-induced L929 cells

NF-κB plays an important role in immune responses, and dysregulation of NF-κB is associated with various diseases such as cancer, inflammation, and aging [17]. UVB increased both the protein levels of NF-κB p65 and p-p65 (Ser536) in the nucleus, whereas treatment with STPE decreased the nuclear p-p65 (Ser536) protein levels in a dose-dependent manner (Fig. 4). The protein expression levels of p65 did not decrease in the nucleus after STPE incubation. Additionally, STPE pretreatment significantly increased NF-κB (p65) expression in the cytoplasm. IκBα is degraded by ubiquitination; thus, NF-κB is translocated from the cytoplasm to the nucleus, causing an inflammatory response following UVB exposure [18]. Our results showed that treatment with STPE at 40 µg/mL significantly enhanced IκBα expression. The increased protein levels of cytoplasmic NF-κB (p65) and IκBα indicated that STPE prevents NF-κB from entering the nucleus.

STPE attenuates DNA condensation in UVB-treated L929 cells

To evaluate nuclear alterations, DNA condensation was analyzed and visualized by fluorescence microscopy (Fig. 5). The fluorescent probe, Hoechst, was used to evaluate DNA condensation. Cells with homogeneously stained nuclei were considered viable, whereas cells stained strongly with an intense blue color were indicative of apoptosis [19]. Untreated cells displayed intact nuclei, whereas UVB-irradiated cells exhibited significant nuclear condensation (bright blue staining), suggesting these cells were undergoing the apoptotic process. Pretreatment with 20 and 40 µg/mL STPE significantly reversed DNA condensation compared with the UVB control.

Repairing effect of STPE on caudal fin damage in UVB-irradiated zebrafish

Zebrafish have been widely used in recent years as an in vivo oxidative stress model to study the protective effects of UV radiation. This study first explored the effects of STPE on the growth of wild-type AB strain zebrafish, thereby providing data on the maximum safe STPE concentration for subsequent experiments (Additional file 1). STPE induced a large number of zebrafish deaths at concentrations of 10 µg/mL and above after UV irradiation. No significant abnormalities were observed at 5 µg/mL STPE; therefore, this was the maximum experimental concentration used in the zebrafish UV damage model.

The potential of STPE to repair skin damage in zebrafish exposed to UVB radiation is shown in Fig. 6a and c. Using a deconvolution microscope, the caudal fin of zebrafish displayed a rough and crinkled phenotype after exposure to UV radiation. Treatment of zebrafish with 30 µg/mL of EGCG showed 182115 ± 8402 pixels in the tail fin area of zebrafish, compared to only 141 544 ± 5864 pixels in the tail fin area of the control zebrafish model. The effect of tea polyphenols on the repair of zebrafish skin damage was 29%, indicating that the positive control treatment significantly repaired zebrafish skin damage. Treatment of zebrafish with 0.56, 1.67, and 5 µg/mL of STPE resulted in a caudal fin area of 145 518 ± 4608 (p > 0.05), 174 965 ± 3632 (p < 0.001), and 149 357 ± 5283 (p > 0.05) pixels, respectively, compared with that of the control model; the effects on skin damage repair were 3%, 24%, and 6%, respectively. Collectively, STPE showed a significant restorative effect on zebrafish skin damage.

ROS scavenging effect of STPE on UVB-radiated zebrafish

The effects of STPE on UVB-mediated ROS induction in zebrafish are shown in Fig. 6d. The fluorescence value of the UVB group was 6271 ± 264 (p < 0.001), which was higher than that of the normal controls (1169 ± 124), indicating successful model establishment. The fluorescence values of the 30 µg/mL EGCG-positive control group (1122 ± 39) were reduced by 82% (p < 0.001) compared with those of the UVB group. The fluorescence values of the STPE group at 0.8, 1.2, and 1.6 µg/mL concentrations were 1818 ± 78, 1834 ± 116, and 950 ± 30, respectively, at which the intracellular ROS accumulation decreased by 71%, 71%, and 85% (p < 0.001), respectively, compared with those of the UVB group. These findings demonstrated that STPE had a significant scavenging effect on ROS in this zebrafish model.

UVB radiation causes a series of adverse skin reactions, such as erythema, sunburn, photoaging, and cancer, by altering the signaling pathways related to inflammation and oxidative stress. Therefore, improving UVB-induced inflammation and oxidative stress is a potential tool for preventing and protecting against UVB-induced cellular and tissue photodamage [20]. In this regard, several edible and medicinal plants have been used to mitigate UVB-exposed skin damage. The present study demonstrates the inhibitory effect of S. thunbergii against UVB-induced oxidative stress and inflammation, suggesting the potential photoprotective effect of STPE in UVB-irradiated L929 cells in vitro, as well as zebrafish in vivo.

UVB induces ROS generation via the BLT2-Nox1-linked pathways, and leads to the depletion of antioxidant defenses either by exhausting their activity or directly damaging proteins [4, 21]. Excessive ROS attack the cell membrane and cellular organelles, resulting in lipid peroxidation and organelle damage, which further induce inflammation and apoptosis in human skin cells [22]. To reduce the negative impact of UV radiation, many marine organisms that photosynthesize have adapted to evolve multiple photoprotective mechanisms against UV radiation [23]. Under UVB radiation, plants alter their phenolic metabolism and provide phenolic compounds to shield against the UVB rays, and act as an antioxidant to decrease UVB-mediated ROS production [24]. In our study, in addition to the protective effect against UVB-induced damage, via ROS clearance in both L929 cells and zebrafish models, STPE enhanced SOD activity and suppressed MDA production in UVB-irradiated L929 cells. Previous studies have shown that the expression of several enzymes (CAT, SOD, glutathione transferase, nicotinamide adenine dinucleotide (phosphate) quinone oxidoreductase, and hemoxygenase-1) in skin is affected following exposure to UVB radiation [25]. MDA is a marker of lipid peroxidation and cell injury. Thus, we sought to measure the SOD, CAT, and MDA levels in L929 cells to evaluate the antioxidative effects of STPE. The antioxidative effects of brown algae polyphenol in relation to skin protection against UVB have been widely demonstrated. Heo et al. [26] demonstrated for the first time that dieckol extracted from E. cava possesses potential inhibitory effects on intracellular oxidative damage induced by UVB radiation. Eckstolonol from E. cava shows protective effects against UVB-induced ROS, lipid peroxidation, damaged DNA levels, and cell death in HaCaT cells [27]. Ko et al. [28]compared the protective effects of extracts from six species of brown seaweed. The results indicated that dieckol from E. cava exhibits a higher protective effect against UVB-induced cell damage in HaCaT cells. Moreover, ROS, nitric oxide, and cell death levels in live zebrafish induced by UVB radiation are reduced following the addition of dieckol.

Most UVB-associated diseases share inflammation-related characteristics, such as upregulated pro-inflammatory cytokine levels and the activation of transcription factors, including NF-κB [29, 30]. This, in turn, propagates inflammation-induced signals and aggravates skin aging or disease by inducing apoptosis and increasing ROS production [31]. Martinez et al. [4] reported that UVB irradiation increases the production of several pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6, as well as Th1, Th2, and Th17 cytokines, and anti-inflammatory cytokines (IL-10 and TGF-β) in the skin of hairless mice. Findings from our study demonstrated that UVB markedly induced the gene and protein expression of TNF-α, IL-6, and IL-1α in L929 cells, which was effectively suppressed by pretreatment with STPE. Phenolic compounds have been shown to be potentially useful to treat many inflammatory diseases. Brown algae polyphenol treatment inhibits the expression levels of inflammatory mediators (nitric oxide, iNOS, and COX-2) at the transcriptional level in a Propionibacterium acnes-induced HaCaT cell model [32] and macrophage-derived chemokine MDC/CCL22 production in an IFN-γ-induced skin inflammation model [33]. The expression of iNOS, COX-2, TNF-α, IL-6, and HMGB-1 is inhibited following phlorotannin treatment in a lipopolysaccharide-induced sepsis model [34]. NF-κB activation has been shown to regulate the production of a variety of pro-inflammatory cytokines. NF-κB is composed of p65 and p50 subunits and is sequestered in the cytoplasm by its inhibitory proteins, I-κBs. NF-κB p65 can be activated and rapidly transported from the cytoplasm to the nucleus during the phosphorylation and degradation of I-κBs. Herein, STPE inhibited the activation of NF-κB in UVB-irradiated L929 cells, which was supported by a decrease in the phosphorylation of the p65 subunit in the nucleus. Moreover, NF-κB (p65) expression in the cytoplasm and IκB expression were significantly increased by STPE, which also indicated the inhibition of NF-κB activation. Our data suggested that STPE inhibits the UVB-induced inflammatory process in L929 cells through the NF-κB signaling pathway. These results are corroborated by previous reports showing that the purified phlorotannins fucofuroeckol-A and 8,8ʹ-bieckol can reduce the production of pro-inflammatory cytokines via the suppression of NF-κB signaling [35, 36]. Diphlorethohydroxycarmalol (DPHC), isolated from the brown algae I. okamurae, suppresses intracellular ROS, collagenase, and elastase production and reduces the expression of MMPs and pro-inflammatory cytokines by regulating the NF-κB, AP-1, and MAPKs signaling pathways in UVB-irradiated human dermal fibroblasts [37].

The zebrafish, a small tropical freshwater fish, has become a useful vertebrate model organism owing to its small size, large clutches, transparency, low cost, and physiological similarity to mammals [38]. Previous studies have used zebrafish as a system for evaluating the efficacy of other UVB protective compounds by assessing fin damage and measuring ROS generation [13, 14]. Our results demonstrated that zebrafish fins in the UVB and STPE combined groups were more likely to phenotypically return to normal than fins in the UVB only-treated group. Additionally, STPE significantly reduced ROS production in the UV-exposed zebrafish embryos. The protective effect of phlorotannin extracts on UVB-radiated zebrafish has been previously reported. For example, DPHC isolated from I. okamurae confers in vivo protection against photodamage by decreasing cell death, as well as reducing lipid peroxidation and inflammatory responses by decreasing ROS levels in UVB-irradiated zebrafish [37]. The ethyl acetate fraction of 70% ethanol extracts of Spirogyra sp. reduces ROS generation in UVB-irradiated zebrafish [39]. Additionally, Guinea et al. [40] showed that the phenolic extracts from Macrocystis pyrifera and Porphyra columbina exhibit good photoprotective activity in zebrafish embryo models.

Acute and chronic exposure of skin cells to UVB can cause apoptosis [21], characterized by membrane blebbing and nuclear fragmentation. Skin cells exposed to UVB irradiation may respond by activating protective mechanisms or eventually undergo apoptosis [41]. To further study the protective effect of STPE against UVB radiation-induced apoptosis in L929 cells, apoptotic body formation was observed following Hoechst 33342 staining. Our results showed that UVB greatly enhanced DNA condensation; however, this was significantly decreased by STPE pretreatment. The inhibition of apoptosis by brown algae polyphenol has been previously reported. For example, the suppressive effect of fucodiphlorethol G on apoptotic body formation by UVB radiation has been observed using Hoechst 33342 staining methods [8]. Dioxinodehydroeckol, a phlorotannin from E. cava, prevents UVB-induced apoptosis in HaCaT cells [42]. Eckol and triphlorethol-A compounds, purified from E. cava, exhibit protective effects against UVB radiation-induced cell damage and apoptosis in human keratinocytes [43, 44].

In the present study, we isolated phenolic-rich extract from S. thunbergii, and evaluated its protective effects against UVB-induced photodamage, both in vitro using L929 cells and in vivo using zebrafish models. Our data suggest that the protective effects against UVB are mediated through the antioxidant, anti-inflammatory, and anti-apoptotic capacity of STPE by regulating NF-κB signaling pathways. This study helps to expand our understanding of the protective activity of STPE on skin, and may provide insight for the evaluation of STPE as a potential protective agent to treat skin damage caused by UVB in pharmaceutical and cosmeceutical industries.

CAT, catalase; dpf, days post-fertilization; EGCG, epigallocatechin gallate; ELISA, Enzyme-linked immunosorbent assay; FBS, fetal bovine serum; FI, fluorescence intensity of the embryo; HBSS, Hank’s Balanced Salt Solution; H₂DCF-DA, 2,7-dichlorodihydrofluorescein diacetate; MDA, malondialdehyde; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; NF-κB, Nuclear Factor KappaB; PBS, phosphate-buffered saline; qPCR, quantitative PCR; ROS, reactive oxygen species; SDHA, succinate dehydrogenase complex flavoprotein subunit A; SOD, superoxide dismutase; STPE, S. thunbergii phenolic-rich extract; UV, ultraviolet; UVB, ultraviolet B

Acknowledgments

We extend our special thanks to Yutian Pan (the Engineering Technological Center of Mushroom Industry, Minnan Normal University, China) for providing us with the L929 cell line. We would like to thank Editage (www.editage.cn) for English language editing.

Authors’ contributions

BC, HDQ and KQ carried out the UVB exposed experiment and drafted the manuscript. HHC and YCS performed collection and extraction of brown algae, and isolation of compound. MX and JNW carried out the antioxidant assay and contributed to data analysis. YS helped to designed the zebrafish experiment. ZYL and QW designed the experiment, participated in general coordination of the study and provided critical revision of the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by the Marine Economy Innovation and Development Project of Fujian (16CZP010SF07), Marine Economic Development Subsidy Program of Fujian (FJHJF-L-2019-3), Special Funds of Fujian Ocean and Fisheries Structure Adjustment (2020HYJG07), Natural Science Foundations of China (31870780), and Natural Science Foundation of Fujian Province (2019J01021).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics of approval and consent to participate

Not applicable

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

1. Dare RG, Oliveira MM, Truiti MCT, Nakamura CV, Ximenes VF, Lautenschlager SOS. Abilities of protocatechuic acid and its alkyl esters, ethyl and heptyl protocatechuates, to counteract UVB-induced oxidative injuries and photoaging in fibroblasts L929 cell line. J Photochem Photobiol B. 2020;203:111771.

2. Liu W, Otkur W, Zhang Y, Li Q, Ye Y, Zang L, He H, Hayashi T, Tashiro S, Onodera S et al. Silibinin protects murine fibroblast L929 cells from UVB-induced apoptosis through the simultaneous inhibition of ATM-p53 pathway and autophagy. FEBS J. 2013;280(18):4572-84.

3. Heo SJ, Jeon YJ. Protective effect of fucoxanthin isolated from Sargassum siliquastrum on UV-B induced cell damage. J Photochem Photobiol B. 2009;95(2):101-7.

4. Martinez RM, Pinho-Ribeiro FA, Steffen VS, Caviglione CV, Vignoli JA, Barbosa DS, Baracat MM, Georgetti SR, Verri WA, Jr., Casagrande R. Naringenin Inhibits UVB Irradiation-Induced Inflammation and Oxidative Stress in the Skin of Hairless Mice. J Nat Prod. 2015;78(7):1647-55.

5. Chung KW, Choi YJ, Park MH, Jang EJ, Kim DH, Park BH, Yu BP, Chung HY. Molecular Insights into SIRT1 Protection Against UVB-Induced Skin Fibroblast Senescence by Suppression of Oxidative Stress and p53 Acetylation. J Gerontol A Biol Sci Med Sci. 2015;70(8):959-68.

6. Yuan Y, Zhang J, Fan J, Clark J, Shen P, Li Y, Zhang C. Microwave assisted extraction of phenolic compounds from four economic brown macroalgae species and evaluation of their antioxidant activities and inhibitory effects on alpha-amylase, alpha-glucosidase, pancreatic lipase and tyrosinase. Food Res Int. 2018;113:288-97.

7. Aminina NM, Karaulova EP, Vishnevskaya TI, Yakush EV, Kim YK, Nam KH, Son KT. Characteristics of Polyphenolic Content in Brown Algae of the Pacific Coast of Russia. Molecules. 2020;25(17).

8. Kim KC, Piao MJ, Zheng J, Yao CW, Cha JW, Kumara MH, Han X, Kang HK, Lee NH, Hyun JW. Fucodiphlorethol G Purified from Ecklonia cava Suppresses Ultraviolet B Radiation-Induced Oxidative Stress and Cellular Damage. Biomol Ther (Seoul). 2014;22(4):301-7.

9. Vo TS, Kim SK, Ryu B, Ngo DH, Yoon NY, Bach LG, Hang NTN, Ngo DN. The Suppressive Activity of Fucofuroeckol-A Derived from Brown Algal Ecklonia stolonifera Okamura on UVB-Induced Mast Cell Degranulation. Mar Drugs. 2018;16(1).

10. Heo SJ, Ko SC, Kang SM, Cha SH, Lee SH, Kang DH, Jung WK, Affan A, Oh C, Jeon YJ. Inhibitory effect of diphlorethohydroxycarmalol on melanogenesis and its protective effect against UV-B radiation-induced cell damage. Food Chem Toxicol. 2010;48(5):1355-61.

11. Bao Y, He X, Wu W, Wang S, Dai J, Zhang Z, Jin W, Yan J, Mao G. Sulfated galactofucan from Sargassum thunbergii induces senescence in human lung cancer A549 cells. Food & function. 2020;11(5):4785-92.

12. Ray RS, Agrawal N, Sharma A, Hans RK. Use of L-929 cell line for phototoxicity assessment. Toxicol In Vitro. 2008;22(7):1775-81.

13. Chen YH, Wen CC, Lin CY, Chou CY, Yang ZS, Wang YH. UV-induced fin damage in zebrafish as a system for evaluating the chemopreventive potential of broccoli and cauliflower extracts. Toxicol Mech Methods. 2011;21(1):63-9.

14. Chen Y, Chen Y, Chou C, Wen C, Cheng C. UV-protective activities of pineapple leaf extract in zebrafish embryos. Res Chem Intermed. 2019;45(1):65-75.

15. Singleton VL, Orthofer R, Lamuelaraventos RM. Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. Methods Enzymol. 1999;299:152-78.

16. Yu D, Zhu H, Liu Y, Cao J, Zhang X. Regulation of proinflammatory cytokine expression in primary mouse astrocytes by coronavirus infection. J Virol. 2009;83(23):12204-14.

17. Wang Y, Wang L, Wen X, Hao D, Zhang N, He G, Jiang X. NF-kappaB signaling in skin aging. Mech Ageing Dev. 2019;184:111160.

18. Kuo YH, Wu PY, Chen CW, Lin P, Wen KC, Lin CY, Chiang HM. N-(4-bromophenethyl) Caffeamide Protects Skin from UVB-Induced Inflammation Through MAPK/IL-6/NF-kappaB-Dependent Signaling in Human Skin Fibroblasts and Hairless Mouse Skin. Molecules. 2017;22(10).

19. Kim SY, Kim EA, Kim YS, Yu SK, Choi C, Lee JS, Kim YT, Nah JW, Jeon YJ. Protective effects of polysaccharides from Psidium guajava leaves against oxidative stresses. Int J Biol Macromol. 2016;91:804-11.

20. Lee C, Park GH, Ahn EM, Park CI, Jang JH. Sargassum fulvellum Protects HaCaT Cells and BALB/c Mice from UVB-Induced Proinflammatory Responses. Evid Based Complement Alternat Med. 2013;2013:747846.

21. Ryu HC, Kim C, Kim JY, Chung JH, Kim JH. UVB radiation induces apoptosis in keratinocytes by activating a pathway linked to "BLT2-reactive oxygen species". J Invest Dermatol. 2010;130(4):1095-106.

22. Zhu X, Li N, Wang Y, Ding L, Chen H, Yu Y, Shi X. Protective effects of quercetin on UVB irradiationinduced cytotoxicity through ROS clearance in keratinocyte cells. Oncol Rep. 2017;37(1):209-18.

23. Cruces E, Huovinen P, Gomez I. Phlorotannin and antioxidant responses upon short-term exposure to UV radiation and elevated temperature in three south Pacific kelps. Photochem Photobiol. 2012;88(1):58-66.

24. Booij-James IS, Dube SK, Jansen MA, Edelman M, Mattoo AK. Ultraviolet-B radiation impacts light-mediated turnover of the photosystem II reaction center heterodimer in Arabidopsis mutants altered in phenolic metabolism. Plant Physiol. 2000;124(3):1275-84.

25. Svobodova AR, Galandakova A, Sianska J, Dolezal D, Ulrichova J, Vostalova J. Acute exposure to solar simulated ultraviolet radiation affects oxidative stress-related biomarkers in skin, liver and blood of hairless mice. Biol Pharm Bull. 2011;34(4):471-9.

26. Heo SJ, Ko SC, Cha SH, Kang DH, Park HS, Choi YU, Kim D, Jung WK, Jeon YJ. Effect of phlorotannins isolated from Ecklonia cava on melanogenesis and their protective effect against photo-oxidative stress induced by UV-B radiation. Toxicol In Vitro. 2009;23(6):1123-30.

27. Jang J, Ye BR, Heo SJ, Oh C, Kang DH, Kim JH, Affan A, Yoon KT, Choi YU, Park SC et al. Photo-oxidative stress by ultraviolet-B radiation and antioxidative defense of eckstolonol in human keratinocytes. Environ Toxicol Pharmacol. 2012;34(3):926-34.

28. Ko S, Cha S, Heo S, Lee S, Kang S, Jeon Y. Protective effect of Ecklonia cava on UVB-induced oxidative stress: in vitro and in vivo zebrafish model. J Appl Phycol. 2011;23(4):697-708.

29. Wang L, Lee W, Oh JY, Cui YR, Ryu B, Jeon YJ. Protective Effect of Sulfated Polysaccharides from Celluclast-Assisted Extract of Hizikia fusiforme Against Ultraviolet B-Induced Skin Damage by Regulating NF-kappaB, AP-1, and MAPKs Signaling Pathways In Vitro in Human Dermal Fibroblasts. Mar Drugs. 2018;16(7).

30. Park SH, Lee SS, Bang MH, Jo SK, Jhee KH, Yang SA. Protection against UVB-induced damages in human dermal fibroblasts: efficacy of tricin isolated from enzyme-treated Zizania latifolia extract. Biosci Biotechnol Biochem. 2019;83(3):551-60.

31. Subedi L, Lee TH, Wahedi HM, Baek SH, Kim SY. Resveratrol-Enriched Rice Attenuates UVB-ROS-Induced Skin Aging via Downregulation of Inflammatory Cascades. Oxid Med Cell Longev. 2017;2017:8379539.

32. Eom S, Lee EH, Park K, Kwon J, Kim P, Jung W, Kim Y. Eckol from Eisenia bicyclis Inhibits Inflammation Through the Akt/NF-κB Signaling in Propionibacterium acnes-Induced Human Keratinocyte Hacat Cells. J Food Biochem. 2017;41(2).

33. Kang NJ, Koo DH, Kang GJ, Han SC, Lee BW, Koh YS, Hyun JW, Lee NH, Ko MH, Kang HK et al. Dieckol, a Component of Ecklonia cava, Suppresses the Production of MDC/CCL22 via Down-Regulating STAT1 Pathway in Interferon-gamma Stimulated HaCaT Human Keratinocytes. Biomol Ther (Seoul). 2015;23(3):238-44.

34. Yang YI, Woo JH, Seo YJ, Lee KT, Lim Y, Choi JH. Protective Effect of Brown Alga Phlorotannins against Hyper-inflammatory Responses in Lipopolysaccharide-Induced Sepsis Models. J Agric Food Chem. 2016;64(3):570-8.

35. Lee SH, Eom S, Yoon N, Kim M, Li Y, Ha SK, Kim S. Fucofuroeckol-A from Eisenia bicyclis Inhibits Inflammation in Lipopolysaccharide-Induced Mouse Macrophages via Downregulation of the MAPK/NF-κB Signaling Pathway. Journal of Chemistry. 2016;2016(2016):1-9.

36. Yang YI, Jung SH, Lee KT, Choi JH. 8,8'-Bieckol, isolated from edible brown algae, exerts its anti-inflammatory effects through inhibition of NF-kappaB signaling and ROS production in LPS-stimulated macrophages. Int Immunopharmacol. 2014;23(2):460-8.

37. Wang L, Kim HS, Oh JY, Je JG, Jeon YJ, Ryu B. Protective effect of diphlorethohydroxycarmalol isolated from Ishige okamurae against UVB-induced damage in vitro in human dermal fibroblasts and in vivo in zebrafish. Food Chem Toxicol. 2020;136:110963.

38. Cha SH, Ko CI, Kim D, Jeon YJ. Protective effects of phlorotannins against ultraviolet B radiation in zebrafish (Danio rerio). Vet Dermatol. 2012;23(1):51-6, e12.

39. Wang L, Ryu B, Kim W, Kim GH, Jeon Y. Protective effect of gallic acid derivatives from the freshwater green alga Spirogyra sp. against ultraviolet B-induced apoptosis through reactive oxygen species clearance in human keratinocytes and zebrafish. Algae. 2017;32(4):379-88.

40. Guinea M, Franco V, Araujo-Bazan L, Rodriguez-Martin I, Gonzalez S. In vivo UVB-photoprotective activity of extracts from commercial marine macroalgae. Food Chem Toxicol. 2012;50(3-4):1109-17.

41. Muzaffer U, Paul VI, Prasad NR, Karthikeyan R. Juglans regia L. protects against UVB induced apoptosis in human epidermal keratinocytes. Biochemistry and biophysics reports. 2018;13:109-15.

42. Ryu B, Ahn BN, Kang KH, Kim YS, Li YX, Kong CS, Kim SK, Kim DG. Dioxinodehydroeckol protects human keratinocyte cells from UVB-induced apoptosis modulated by related genes Bax/Bcl-2 and caspase pathway. J Photochem Photobiol B. 2015;153:352-7.

43. Piao MJ, Lee NH, Chae S, Hyun JW. Eckol inhibits ultraviolet B-induced cell damage in human keratinocytes via a decrease in oxidative stress. Biol Pharm Bull. 2012;35(6):873-80.

44. Piao MJ, Zhang R, Lee NH, Hyun JW. Protective effect of triphlorethol-A against ultraviolet B-mediated damage of human keratinocytes. J Photochem Photobiol B. 2012;106:74-80.

No competing interests reported.

Additionalfiles1.pdf
Additional file 1

Download PDF

Editorial decision: Major revision
01 Nov, 2021
Reviews received at journal
08 Oct, 2021
Reviewers agreed at journal
07 Oct, 2021
Reviewers invited by journal
20 Aug, 2021
Editor assigned by journal
13 Aug, 2021
Editor invited by journal
13 Aug, 2021
Submission checks completed at journal
13 Aug, 2021
First submitted to journal
04 Aug, 2021

You are reading this latest preprint version

Photoprotective Effects of Sargassum Thunbergii on Ultraviolet B-Induced Mouse L929 Fibroblasts and Zebrafish

Status:

Version 1

Abstract

Figures

Background

Methods

Reagents

Phenolic compound extraction and purification

Cell culture and treatment

Cell viability assay

ROS production

Cellular antioxidant enzyme activity and lipid peroxidation

RNA isolation, reverse transcription, and quantitative PCR (qPCR) analysis

Enzyme-linked immunosorbent assay (ELISA)

Western blotting

Hoechst 33342 staining

Effects of STPE on zebrafish growth

Repairing effect of STPE on caudal fin damage in UVB-irradiated zebrafish

Effect of STPE on ROS scavenging in UVB-irradiated zebrafish

Results

STPE reverses the UVB-induced decrease in cell viability

STPE inhibits oxidative stress and lipid peroxidation

STPE alleviates UVB-induced inflammation in L929 cells

STPE inhibits NF-κB activation in UVB-induced L929 cells

STPE attenuates DNA condensation in UVB-treated L929 cells

Repairing effect of STPE on caudal fin damage in UVB-irradiated zebrafish

ROS scavenging effect of STPE on UVB-radiated zebrafish

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1