Patients
A cohort of 478 patients with chronic liver diseases including HCC (n = 298), liver cirrhosis (LC, n = 92), and chronic hepatitis (CH, n = 88) from the Hospital of Nantong University, China were investigated with written or verbal consent. Total 74 healthy people as normal controls (NC) were obtained from the Nantong Central Blood Bank, with negative viral markers (HBsAg, HBV-DNA, and anti-HCV antibody), normal ALT activity and liver B ultrasonic examination. Data of patients with chronic liver diseases & normal control are shown in Table 1. Total 5 mL of blood from each patient or d healthy control were collected in the morning, and serum α-fetoprotein (AFP) and biochemistries were detected at once. Diagnostic criteria of liver cancer and hepatitis were based on the Chinese National Collaborative Cancer Research Group and Viral Hepatitis Meeting, respectively. This study was approved by the Ethics Committee of Nantong University Hospital (TDFY2013008) of China and performed in line with medical ethics of the Helsinki Declaration.
Hepatocarcinogenesis Model
Rat models were approved by the guidelines of Animal Care and Use Committee of Nantong University, China. Total 48 Sprague-Dawley rats (SD) with 4 ~ 6-wk-old that obtained from the Experimental Animal Center of Nantong University were made for hepatocarcinogenesis model in clean environment, 12-h light/dark cycle, and 55% humidity, and schematic representation of the model and rat grouping are shown in Fig. 1. Control rats (n = 12) were fed normal diet, model rats (n = 36) was fed with containing 2-acetylaminofluorene (2-AAF, 0.05%, Sigma) diet, and checked every day. After rats sacrificed at different time, livers and blood were collected for analysis. Livers were used for pathology and total protein extraction. Liver pathological examination with Hematoxylin & Eosin (H. & E.) staining was diagnosed by independent pathologists, and histological grouping. Dynamic alterations of whole gene expression profiling were detected by Affymetrix GeneChip® Rat Genome 230 2.0 Array (total 28,000 gene, YESLAB., Shanghai, China) and levels of VEGF, Ang-2 and HIF-1α in liver tissue supernatant and sera of rats were quantitatively detected by enzyme-linked immunosorbent assays.
HIF-1α miRNA and Constructing Plasmid DNA (pDNA)
According to HIF-1α gene (NM_001530), short hairpin-expressing pDNAs were constructed from pcDNA™6.2-GW/EmGFPmiR vector and BLOCK-iT™ Pol II miR RNAi Expression Vector Kit (Invitrogen, USA). Targeting HIF-1α genes are as follows: 5'-TGCTGTAAAGCATCAGGTTCCTTCTTGTTTTGGCCACTGACTGACAAGAAG GACTGATGCTTTA-3' and 5'-CCTGTAAAGCATCAGTCCTTCTTGTCAGTCAGTG GCCAAAACAAGAAGGAACCTGATGCTTTAC-3'. HIF-1α gene fragments were purified and confirmed by the MegaBACE 1000 Sequencing and Analysis System using DYEnamic™ ET Dye Terminator Cycle Sequencing Kit (Amersham Biosciences, Little Chalfont, UK) according to manufacturer's instructions.
Cell Culture
Human HCC MHCC-97H, SMMC-7721, PLC/PRF/5, Bel-7402, Hep3B, HepG2 and Bel-7404 cell lines from the Chinese Academy of Sciences (Shanghai, China) were cultured in RPMI-1640 (Gibco BRL, Gaithersburg, MD) containing 10% FCS (Gibco BRL, USA), 2.0 mM L-glutamine, 100 U/mL penicillin and 100 µg/mL streptomycin in a constant environment (37℃, 10% CO2 and 10% humidity).
In Vitro Transfection
Human HepG2 or Hep3B cells (5 × 103) were cultured on six-well plates for overnight incubation. They were divided into blank control (Con), negative miRNA (Neg) and miRNA (MiR) groups. The MiR or Neg group was transfected with HIF-1α miRNA or negative miRNA according to the instructions of related-reagent kit (Roche, Germany).
Cell Migration or Invasion Assay
Quantitative and qualitative analysis of HepG2 or Hep3B cells migration were assessed by in vitro Transwell assay with modified Boyden Chambers and Transwell- coated Matrigel membrane filter (BD Biosciences, Bedford, MA, USA). Cells (5 × 103) from Con, Neg, and MiR groups (n = 3/per group) were plated onto the upper compartment in without FBS or 10% FBS in the lower chamber as a chemoattractant. Fluorescent images of nuclear Hoechst staining (10 µg/mL) were captured at 24 h of incubation in a 5% CO2 humidified at 37℃. Percentages of migrated cells in each group were counted from 10 random microscope fields for each sample in 3 independent experiments. For cell migration analysis, the modified Boyden Chambers without the Transwell-precoated Matrigel membrane filter in above method was performed.
Quantitative Real-time PCR
Total RNA (1 µg) that was extracted using Trizol reagent (MRC, Cincinnati, OH) were reverse-transcripted into cDNA using the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania). Each reaction well in a 25-µl final volume contains 2µL of template DNA, 9.5µL of ddH2O, 12.5µL of SYBR Premix Ex Taq (TaKaRa, Japan), 0.5µL of HIF-1α forward primer: 5'-CCACTGCCACCACTGATGA A-3' (nt 2254–2273), and 0.5µL of reverse primer: 5'-TTGGTGAGGCTGTCCGACT T-3' (nt 2412–2431) to generate amplified product of 178 bp. Cycling program of qRT-PCR was 2 min at 95℃ for hot-start enzyme activation, followed by 40 cycles of denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s and elongation at 72℃ for 45 s in ICycler (BIO-RAD).
Western Blot Analysis
Total proteins from HCC cells were lysed in RIPA buffer with protease and phosphatase inhibitors (Roche) and the concentrations were quantified with the Bicinchoninic acid Protein Assay Kit (Beyotime Institute of Biotechnology, Shanghai, China), and an equal amount of 50 µg protein was separated by 10% sodium dodecyl sulfate-polyacrylamide gels electrophoresis (SDS-PAGE) and then transferred onto polyvinylidine difluoride (PVDF) membranes (Millipore, Billerica, MA, USA), blocked with 5% bovine serum albumin (BSA) in blocking buffer (Solarbio, China) for 2 h at room temperature, and incubated with specific primary rabbit anti-human antibodies overnight at 4℃, and β-actin (CST, USA) was used as protein loading control. The HIF-1α primary antibody was obtained from Santa Cruz (Univ-Bio., Shanghai, China) and the antibodies against Ang-2, Vimentin, E-Cadherin, Twist, and Snail were purchased from Abcam (Cambridge, MA, USA). Then the membranes were incubated with horseradish peroxidase-conjugated secondary goat anti-rabbit antibody (Abbkine, China). Detection was performed by enhanced chemiluminescence kit (Beyotime Institute of Biotech., Shanghai, China). All images were taken by the Quantity One software (Bio-Rad, Laboratories, Inc., USA).
Enzyme-linked Immunosorbent Assay (ELISA)
Concentrations of VEGF, Ang-2, and HIF-1α in sera or supernatant were quantitatively detected according to the manufacturer’s instructions with ELISA kits. Their levels were calculated using a standard curve generated with specific standards provided by the manufacturer with inter and intra-assay variances under 10%. ELISA kits for VEGF, Ang-2 and HIF-1α detections were purchased from the R&D systems, Abingdon, UK; ADL Biotech Dev Co., USA; and Abcam Co., Shanghai, China, respectively.
Statistical Analysis
Patients were divided into HCC, CH, and LC groups, with healthy persons as a NC group. Rat livers by pathological examination (H&E staining) were divided into four groups of rHCC, Pre-C, Deg, and NC. Data were expressed as mean ± standard deviation (± SD), and analyzed by SPSS19.0. Pearson χ2 test, ANOVA and q test were performed to analyze the difference between different groups. A P value < 0.05 was considered to be statistically significant.