2.1. Study design and transverse aortic constriction (TAC)-induced myocardial hypertrophy mouse model
Male C57BL/6 mice (aged 5 weeks old) used in this study were purchased from the Guangdong Medical Laboratory Animal Center (Guangzhou, China). The mice were fed a standard laboratory diet and housed under standard conditions. Two weeks later, mice were randomly divided into the following three groups: the sham group, TAC group and TAC + PUE group. The sham group mice received intraperitoneal (i.p.) injection of the saline and the surgical procedures without the constriction. TAC group mice received i.p. injection of the saline and the TAC procedures to induce cardiac hypertrophy. The TAC + PUE group mice received a daily i.p. injection of puerarin (Sigma Aldrich, MO, USA) 3 days before TAC and continued for 21 days after TAC. The doses administered for puerarin (100 mg/kg per day) were chosen based on previous studies[8].
TAC is widely used as a disease model of chronic ventricular hypertrophy[9]. Thereby, TAC was used to establish myocardial hypertrophy in mice as described in a previous study[10]. Briefly, following anesthetization with isoflurane (Henry Schein, Melville, NY, USA), the aortic arch was exposed after a midline incision in the anterior neck. The transverse aortic arch between the left common carotid artery and the brachiocephalic artery was chosen as the site of constriction. The aortic arch was constricted by tying a 6.0 nylon suture ligature against a 26-gauge needle. After rapid removal of the needle, an incomplete constriction was formed. The successful constriction of TAC was verified using trans-thoracic echocardiography. All procedures were carried out according to the Guide for the Care and Use of Laboratory Animals (National Institutes of Health, USA)[11].
2.2 Organ Weight
Body weight (BW) and tibia length (TL) of each mouse were measured 21 days after the TAC procedure. The mice were sacrificed using cervical dislocation under aesthesia, and hearts were arrested in diastole with injection of potassium chloride. And then, the hearts were gained and heart weight (HW) were measured. Heart weight to body weight ratio (HW/BW) and heart weight to tibia length ratios (HW/TL) were counted.
2.3. Echocardiography
After anesthetization with isoflurane, successful ligation was confirmed by color Doppler and pulsed-wave Doppler scanning. Left ventricular posterior wall dimension (LVPWd) and interventricular end-diastolic septum thickness (IVSd) were measured by two-dimensional transthoracic echocardiography. The transthoracic echocardiography was performed by an experienced technician who was blinded to the study groups using an IE33 echocardiographic system (Philips Medical Systems, Leiden, the Netherlands).
2.4. Hematoxylin-Eosin (HE) Staining
After fixation with 10% formalin, the heart tissues were dehydrated through a serial alcohol gradient and embedded in paraffin wax blocks. And then, heart sections were stained with HE solution (Beyotime, China). The sections were examined under a light microscope (Nikon Technology Co., Ltd., Japan).
2.5. Western Blot Analysis
Western blot analysis was performed as described previously [12–14]. Briefly, the whole protein of the heart was extracted using radio-immunoprecipitation assay (RIPA) lysis buffer (Kaiji Company, Shen Zhen, China) with protease and phosphatase inhibitors (Kaiji Company, Shen Zhen, China). Protein samples were separated by sodium dodecylsulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were then incubated at 4°C overnight with the following primary antibodies: β-MHC (Bioworld Technology Inc, Louis Park, MN; BS70815, 1:1000) and GAPDH (Cell Signaling Technology Inc., Danvers, USA; # 5174, 1:1000). After being washed three times with PBST, the membranes were incubated with the secondary antibodies for 1 hour at room temperature. Then, the signals were detected using the Imaging System (GE, Amersham Imager 600, GE, Piscataway, NJ, USA). The relative expression level of proteins was analyzed using Image-Pro Plus 6.0 (Media Cybernetics Inc., Bethesda, MD, USA).
2.6. RNA extraction
The mice were sacrificed at 21 days after TAC and hearts were harvested. Total RNA was isolated from heart tissues using Trizol reagent (TaKaRa, Tokyo, Japan). The concentration of the RNA samples was evaluated using a NanoDrop ND-1000 instrument (thermo fisher scientific, USA). The integrity of the RNA was assessed by electrophoresis on an agarose gel.
2.7. RNA sequencing analysis
Library preparation and Illumina sequencing analysis were performed as previous study[15]. Briefly, the RNA of heart tissue was used for library construction by KAPA Stranded RNA-seq library Prep Kit (Illumina, NEB, USA). Then, the library was sequenced by Illumina NovaSeq 6000 Sequencing system (Illumina, NEB, USA) according to the manufacturer’s protocol. The RAN-seq experiment was completed by Kangcheng Biotechnology Co., Ltd (Shanghai, China). Raw sequence files have been deposited at NCBI’s Gene Expression Omnibus (Accession code: GSE176244). Differentially expressed lncRNAs with statistical significance among the three groups were observed through Volcano Plot filtering. Hierarchical clustering was conducted to demonstrate the distinguishable lncRNAs expression pattern among the groups.
2.8. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis
The lncRNA-seq results were further validated by qRT-PCR analysis as previous study[16]. Briefly, total RNA isolated from heart tissues was reverse transcribed to synthesize cDNA. Then, the qRT-PCR was performed by the QuantStudio5 Real-time PCR System (Applied Biosystems) with the 2 × PCR Master Mix (Arraystar: AS-MR-006-5). Relative expression levels of lncRNAs were normalized with GAPDH. The sequences of primers used for amplification are shown in Table 1. The expression of lncRNAs was calculated using the 2−ΔΔCt method.
Table 1
Sequence of the primers for lncRNAs.
|
Forward and reverse primer
|
Tm
(℃)
|
Product length (bp)
|
GAPDH
|
F:5’ CACTGAGCAAGAGAGGCCCTAT3’
R:5’ GCAGCGAACTTTATTGATGGTATT3’
|
60
|
144
|
ENSMUST00000125726
|
F:5’TCTAGTGTCTGTTCCCTACTCGTG3’
R:5’GAGGGACACAGCCATCAACA3’
|
60
|
196
|
ENSMUST00000155474
|
F:5’CCGCCAGGAAGAAAGATGTT3’
R:5’CTCTCAGTGGCTCACCTTCTATG3’
|
60
|
264
|
ENSMUST00000143044
|
F:5’CATGGGCTTCAGGGTCACTA3’
R:5’CGGGGCTCCACATCCAAT3’
|
60
|
105
|
ENSMUST00000212795
|
F:5’CGTGCGGGCTCTTTAACTGT3’
R:5’GGCTCGGGACAACAACATTC3’
|
60
|
185
|
Tm: annealing-temperature. bp: base pair. |
2.9. Construction of the lncRNA-mRNA co-expression network
The coding/non-coding gene co-expression (CNC) network profile was constructed according to validated altered lncRNAs and their related mRNAs. The CNC was established through the weighted gene co-expression network analysis (WGCNA) using the R package WGCNA (v1.69) [17]. The co-expression network between mRNA and lncRNA was constructed utilizing Cytoscape version 2.8.1 software (The Cytoscape Consortium, San Diego, CA, USA) based on the Pearson correlation analysis of lncRNA and mRNA (r > 0.95 or r < − 0.95).
2.10. Gene function analysis
To explore the function of the selected genes in the co-expression network, Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis for the targets genes were implemented using Database for Annotation, Visualization and Integrated Discovery (DAVID)[18, 19].
2.11. Statistical analysis
All results were presented as the mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 7.0 software (San Diego, CA, USA). One-way ANOVA followed by Tukey's post hoc analysis was used to test the differences among groups. A P value less than 0.05 was considered statistically significant.