RNA m6A demethylase ALKBH5 regulates the development of γδ T cells

doi:10.21203/rs.3.rs-79739/v1

Download PDF

Article

RNA m6A demethylase ALKBH5 regulates the development of γδ T cells

https://doi.org/10.21203/rs.3.rs-79739/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

γδ T cells are abundant T cell population at the mucosa and are important in providing immune surveillance as well as maintaining tissue homeostasis. However, despite γδ T cells origin in thymus, detailed mechanisms regulating γδ T cell development remain poorly understood. N⁶-methyladenosine (m⁶A) represents one of the most common post-transcriptional modifications of mRNA in mammalian cells, but whether it plays a role in γδ T cell biology is still unclear. Here we show that depletion of m⁶A demethylase ALKBH5 in lymphocytes specifically induces an expansion of γδ T cells, which confers enhanced protection against gastrointestinal S. typhimurium infection. Mechanistically, loss of ALKBH5 favors the development of γδ T cell precursors by increasing the abundance of m⁶A RNA modification in thymocytes, which further reduces the expression of several target genes including Notch signaling components Jagged1 and Notch2. As a result, impairment of Jagged1/Notch2 signaling contributes to enhanced proliferation and differentiation of γδ T cell precursors, leading to an expanded mature γδ T cell repertoire. Taken together, our results indicate a checkpoint role of ALKBH5 and m⁶A modification in the regulation of γδ T cell early development.

Immunology

RNA m6A modification

ALKBH5

γδ T cell development

Jagged1/Notch2 signaling

developmental checkpoint

Lymphocytes in the thymus are subdivided into two major populations based on their surface marker of αβ and γδ T cell antigen receptors (TCR)¹. γδ T cells belong to the innate immune lymphocytes, and represent a link between innate and adaptive immunity². Similar to conventional αβ T cells, γδ T lymphocytes can produce different chemokines and various cytokines, such as interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), Interleukin-4 (IL-4), IL-17, IL-21, IL-22 and so on, and differentiate into different effector profiles based on their ability to produce either IFN-γ (γδT1), IL-17 (γδT17) or both IL-4 and IFN-γ (γδNKT)^3,4. In addition, some γδ T cells also produce particular cytokines, such as keratinocyte growth factor (KGF), connective tissue growth factor (CTGF) and macrophage colony-stimulating-factor (M-CSF), or antimicrobial peptides^5,6. Accordingly, γδ T cells show great promise to develop novel immunotherapies for mucocutaneous infections, autoimmune diseases and malignancies^6–8.

It has been shown that αβ T and γδ T cells originate from a common thymic progenitor, which is a CD4/CD8 double-negative (DN) lymphocyte⁹. The decision between αβ T and γδ T cells occurs at the DN stage, when pre-commitment-selection and signal strength models can determine αβ/γδ lineage commitment¹⁰. Different from αβ T lymphocytes, γδ T cells are abundant during the embryonic stage, and the functions of some γδ T cells are programmed during thymic development^3,11. The development and function of γδ T cells does not only depend on antigen recognition mode, and they have the inherent ability to produce cytokines such as IFN-γ and IL-17. It is well identified that development of these cytokine-producing γδ T subsets is largely pre-programmed in the thymus. During the development of both the αβ T and γδ T lineages, the αβ/γδ selection is mainly dependent on Zap70/Syk-mediated signaling, which is regulated by protein tyrosine kinase p56 (Lck)^12–15. TCR-γδ signaling strength exerts a critical role in thymic acquisition of γδ T cell effector fate^16,17. Strong TCR-γδ signaling induces a general IFN-γ-producing γδ T phenotype^17–19, while weak or no TCR-γδ signaling promotes the development of the γδT17 subset^19–22. Additionally, Notch signaling pathways play an important role in T cell lineage commitment and function²³. It is now clear that thymocyte progenitors that receive a strong Notch1 signal preferentially enter the αβ T cell lineage at the expense of γδ T cells²⁴; however the stages through which Notch signaling, and the underlying developmental checkpoints that regulate murine γδ T cell lineage commitment events in the thymus, are still unresolved.

N ⁶-methyladenosine (m⁶A) is the most prevalent and abundant mammalian RNA modification. m⁶A can modulate almost every aspect of mRNA metabolism, and its comprehensive roles are mediated by specific RNA binding protein complexes including ‘writers’ (mainly METTL3 and METTL14), ‘erasers’ (ALKBH5 and FTO), and ‘readers’^25,26. m⁶A RNA methylation is involved in a variety of physiological and pathological processes, such as maintenance of pluripotency in embryonic stem cells^27,28, sex determination²⁹, energy metabolism³⁰, antiviral immunity³¹, DNA damage response³², tumorigenesis^33,34, and anti-tumour immunity³⁵. Our previous work demonstrated that m⁶A RNA methylation controls αβ T cell homeostasis and differentiation³⁶, and sustains Treg suppressive functions³⁷. However, γδ T cells as another important T cell subset, are also critically in maintaining T cell homeostasis and immunoregulation and whether m⁶A RNA modification govern the development and function of γδ T cells is unclear.

Lck kinase is expressed in the earliest thymic immigrants and in all T cell subsets, bot not in B and NK cells^38,39. Lck-Cre transgenic mice have been widely used to study the involvement of different genes in T cell development and function^40,41. Here, using Alkbh5^f/f Lck-Cre conditional knockout mice, we identified that loss of ALKBH5 specifically expands the γδ T cell population, but has little impact on the αβ T cell compartment; this confers an enhanced immune protection against S. typhimurium infection. We observed that loss of ALKBH5 is a specific driver for the development of γδ T cell progenitors, and is responsible for a significant expansion of γδ T cells starting at the embryonic stage. Furthermore, we discovered that ALKBH5 deficiency-mediated m⁶A RNA modification induces the suppression of Jagged1/Notch2 signaling environment in which γδ T precursors can acquire a strengthened capacity to proliferation and differentiation. This study demonstrates that m⁶A RNA modification plays a vital role in regulating the early development of murine γδ T cells, serving as a potential developmental checkpoint in the decision between αβ T and γδ T cells.

ALKBH5 deficiency leads to an expanded γδ T cell population and enhanced protection against S. typhimurium infection. Dynamic removal of the m⁶A modification on mRNA is a likely mode of regulation of T cell development but its contribution is unknown. Further, ALKBH5 is highly expressed across different subsets of T lymphocytes (Extended Data Fig. 1a), implying it plays important roles in regulating T cell biology. We therefore crossed Alkbh5^f/f mice with Lck-Cre transgenic mice to assess the function of ALKBH5 and m⁶A RNA modification in developing T cell populations (Extended Data Fig. 1b–d). Interestingly, loss of ALKBH5 resulted in a significant expansion of γδ T cells in both thymus and peripheral tissues including spleens, peripheral lymph nodes (pLNs), mesenteric lymph nodes (mLNs), intestinal epithelial lymphocyte (IEL) and lamina propria lymphocyte (LPL) of colons (Fig. 1a,b and Extended Data Fig. 2a,b). On the other hand, αβ T cells were unchanged between Alkbh5^f/f wild-type (WT) and Alkbh5^f/f Lck⁺ (KO) mice. To further confirm this observation in αβ T cells, we examined the frequencies and counts of different αβ T cell subsets in peripheral lymphoid tissues. Although we observed a slight reduction of CD8 T cells and a slightly skewed naïve/memory balance in the spleen and pLN of Alkbh5^f/f Lck⁺ mice (Extended Data Fig. 3), the total populations were comparable (Extended Data Fig. 4). We measured whether deficiency in ALKBH5 affected the composition and proportion of different γδ T cell subsets. γδ T cells have previously been categorized into three subpopulations based on CD8 expression: CD8αβ⁺, CD8αα⁺ and CD8⁻ cells⁴². Of note, loss of ALKBH5 did not alter the frequencies of these three subpopulations (Extended Data Fig. 5a,b), but the numbers of all subsets were markedly increased due to expansion of total γδ T cells (Extended Data Fig. 5c). These results suggest that loss of ALKBH5 selectively expands γδ T cells.

Since γδ T cells have important roles in controlling mucocutaneous infections^6,7, we next performed a Salmonella typhimurium (S. typhimurium) model of colonic infection to determine the functional consequences of the expanded γδ T cells. Strikingly, Alkbh5^f/f Lck⁺ mice were better protected from infection than their WT littermates, manifested in significantly reduced weight loss and delayed fatality (Fig. 1c,d). Moreover, Alkbh5^f/f Lck⁺ mice had a lower bacterial burden in their feces (Fig. 1e), caecum, spleen and liver (Fig. 1f) than WT littermate mice, altogether suggesting that S. typhimurium infection and dissemination were better controlled in Alkbh5^f/f Lck⁺ mice. To further confirm that the protective phenotype observed in Alkbh5^f/f Lck⁺ mice during infection was mediated by γδ T cells rather than other lymphocyte populations, we crossed Alkbh5^f/f, Alkbh5^f/f Lck⁺ mice onto TCRδ deficient (TCRδ^−/−) mice for targeted deletion of γδ T cells. Of note, Alkbh5^f/f TCRδ^−/− Lck⁺ mice showed similar pathological outcomes compared to Alkbh5^f/f TCRδ^−/− mice upon S. typhimurium infection, including comparable weight loss, survival rate, and fecal bacterial burden (Fig. 1g–i). Taken together, these results indicate that expanded γδ T cells in Alkbh5^f/f Lck⁺ mice lead to a more efficient immune response against S. typhimurium.

Loss of ALKBH5 has no impact on IFN-γ and IL-17 production, proliferation and apoptosis of mature γδ T cells. Similar to αβ T cells, γδ T cells can exert their immune functions by secreting pro-inflammatory cytokines such as IL-17A and IFN-γ^17–19. To further address the phenotype of S. typhimurium infection whether it was only attributable to increased number of γδ T cells or also to their enhanced function, we next assayed the cytokine changes secreted by γδ T cells in WT and ALKBH5 KO mice. γδ T cell effector fate is largely dependent on TCR-γδ signaling strength in the thymus^16,17. We confirm no big changes in the percentage of IFN-γ or IL-17-producing γδ T cells between Alkbh5^f/f and Alkbh5^f/f Lck ⁺ mice in the thymus and peripheral immune tissues (Fig. 2a,b and Extended Data Fig. 6), suggesting that the quality of γδ T cells and the strength of TCR-γδ signaling are not affected by ALKBH5 deficiency.

To better understand the quantitative increase of γδ T cells in Alkbh5^f/f Lck⁺ mice, we tested whether proliferation and apoptosis of mature γδ T cells had changed in those mice. Surprisingly, we did not observe enhanced proliferation or impaired apoptosis in mature γδ T cells isolated from the thymus of Alkbh5^f/f Lck⁺ mice (Fig. 2c–f). Together, these findings imply that loss of ALKBH5 neither changes the cytokine profile, nor alters proliferation or apoptosis of mature γδ T cells.

Depletion of ALKBH5 in thymocytes promotes the expansion of γδ T cell precursors. To further explore mechanistically how ALKBH5 deficiency facilitates the expansion of γδ T cells, we next investigated whether loss of ALKBH5 affected the proportion and number of γδ T progenitors at early developmental stages. Since αβ T cells and γδ T cells are both derived from thymic DN cells, we first evaluated these cells isolated from Alkbh5^f/f Lck⁺ mice and WT littermates. Interestingly, Alkbh5^f/f Lck⁺ mice had significantly more DN lymphocytes than WT mice in the thymus (Fig. 3a–c). It is well known that the DN population can be further sub-divided into four subsets according to their expression of surface markers CD44 and CD25: CD44⁺CD25⁻ (DN1) cells, CD44⁺CD25⁺ (DN2) cells, CD44⁻CD25⁺ (DN3) cells and CD44⁻CD25⁻ (DN4) cells⁴³. In Lck-Cre transgenic mice, the ALKBH5 deletion is initiated at the DN2 stage and completed by the DN3 stage^40,44. In accordance to this, we observed that the frequency of DN3 cells, and the numbers of DN2 and DN3 cells were markedly increased in the absence of ALKBH5 (Fig. 3d–f), suggesting that ALKBH5 is involved in the development of early γδ T cell precursors.

Until now, few surface markers have been identified on developing γδ T cells, and most studies have used CD73⁺ TCRγδ⁺ DN lymphocytes as γδ T progenitors that are committed to the γδ lineage^18,45. Human γδ T cells are usually characterized based on the features of their TCRδ variable region (Vδ), while mouse γδ T cell subsets are distinguished by the Vγ chain they bear, most of which are either Vγ1.1 or Vγ2^46–48. Therefore, we next analyzed whether loss of ALKBH5 affects CD73-expressing TCRδ⁺, Vγ1.1⁺ and TCRδ⁺, Vγ2⁺ progenitors (Fig. 3g). We observed that ALKBH5 deletion slightly affected the frequency of TCRδ⁺ Vγ1.1⁺ and TCRδ⁺ Vγ2⁺ cells at the DN stage, as well as their progenitor subsets (Extended Data Fig. 7). Of note, compared to Alkbh5^f/f mice, Alkbh5^f/f Lck⁺ mice had more immature TCRδ⁺ Vγ1.1⁺ cells, TCRδ⁺ Vγ1.1⁺ precursor cells and γδNKT Vγ1.1⁺ progenitors at the DN stage (Fig. 3h). Similarly, increased number of immature TCRδ⁺ Vγ2⁺ cells, TCRδ⁺ Vγ2⁺ precursor cells and γδNKT Vγ2⁺ progenitors at the DN stage (Fig. 3i) were found in the absence of ALKBH5. Finally, we further determined the number of mature γδ T cell subsets in the thymus, and found highly increased counts in all these subpopulations in Alkbh5^f/f Lck⁺ mice compared to control Alkbh5^f/f mice (Extended Data Fig. 8), indicating that the increased number of mature γδ T cells observed above is due to the expansion of γδ T cell precursors.

Absence of ALKBH5 promotes the proliferation of γδ T cell precursors and expands γδ T cell repertoire during embryonic stage. These above findings prompted us to hypothesize that ALKBH5 deficiency might increase the proliferation rate of γδ T cell progenitors. Therefore, we labelled the cells in vivo with BrdU, a thymidine analogue used to identify proliferating cells. As expected, the frequency of BrdU positive γδ T cell progenitors was significantly higher in Alkbh5^f/f Lck⁺ mice compared to WT littermates (Fig. 4a,b). On the other hand, no obvious changes were observed regarding the apoptotic rate of these γδ T cell progenitors (Fig. 4c,d), suggesting that γδ T cell precursors in Alkbh5^f/f Lck⁺ mice were expanded because of increased proliferation rather than reduced cell death.

From a developmental point of view, it has been shown that murine γδ T cells begin to appear during the middle and late period of embryonic development (~ E13.5)¹⁷. We then analyzed the quantity of γδ T cells in the thymus of Alkbh5^f/f Lck⁺ mice at different fetal stages. Surprisingly, the increased frequency of γδ T cells was observed in Alkbh5^f/f Lck⁺ mice as early as day E14.5 (Fig. 4e,f), suggesting that ALKBH5 affected the γδ T cell population during midterm fetal development. Taken together, these data indicate that loss of ALKBH5 promotes the proliferation of γδ T cell precursors and leads to expanded γδ T cell repertoire during embryonic development.

Loss of ALKBH5 results in altered Jagged1/Notch2 signaling pathway in γδ T cell precursors. To explore the molecular mechanisms underlying the expanded γδ T cell progenitors in the absence of ALKBH5, we performed RNA-seq on γδ T cell precursors isolated from thymus in Alkbh5^f/f and Alkbh5^f/f Lck⁺ cohoused independent littermates. Overall, about 698 genes (P < 0.05) were differentially expressed in ALKBH5-deficient γδ T cell progenitors, including 339 downregulated genes and 359 upregulated genes (Extended Data Fig. 9a). Since m⁶A RNA modification is mainly involved in mRNA decay, we reasoned that removing its ‘eraser’ ALKBH5 likely would promote the degradation of certain mRNA transcripts with increased m⁶A levels. Among those differentially expressed genes identified from Alkbh5^f/f Lck⁺ mice, Jagged1 was the most markedly downregulated gene (Fig. 5a). Jagged1 is a key ligand for Notch, a pathway which is both necessary and sufficient for T cell lineage commitment²³. In line with down-regulated Jagged1 gene expression, pathway analysis revealed that Notch signaling was one of the most substantially reduced signaling cascades in the γδ T cell progenitors isolated from Alkbh5^f/f Lck⁺ mice (Fig. 5b). In depth analysis further showed that Jagged/Notch signaling genes and their target genes were indeed down-regulated, suggesting that Jagged1/Notch2 signaling pathway was functionally suppressed in ALKBH5-deficient γδ T cell precursors (Fig. 5c and Supplementary Table 1). In addition, pathway analysis implied that most of the genes up-regulated in the absence of ALKBH5 are involved in regulating cell cycle (Extended Data Fig. 9b and Supplementary Table 2), which is also consistent with our flow cytometric analysis on γδ T cell progenitors mentioned above (Fig. 4a,b). Next, we validated by qPCR that the expression of Jagged1 and Notch2 was down-regulated at both mRNA and protein levels in the γδ T cell progenitors of Alkbh5^f/f Lck⁺ mice (Fig. 5d,e). Besides, downstream components of Notch signaling such as its effector genes Hey1 and Hes1^23,49 were also confirmed to be markedly decreased, while cell cycle factor Cdkn1a⁵⁰ was significantly increased in the absence of ALKBH5 (Fig. 5c,f). Taken together, these evidences suggest that ALKBH5 regulates the development of γδ T cells through Jagged1/Notch2 signaling thereby regulating the proliferation of γδ T cell precursors.

We next sought to understand whether impaired Jagged1-Notch2 signaling in the absence of ALKBH5 occurs only in γδ T cell progenitors, but not in mature γδ T cells. Therefore, we performed RNA-seq on mature γδ T cells isolated from three independent Alkbh5^f/f Lck⁺ as well as WT littermates. We found much fewer up- and down-regulated genes in Alkbh5 KO mature γδ T cells comparing to precursor T cells. Surprisingly, the dysregulation of Jagged1/Notch2 signaling and related gene expression observed in ALKBH5 KO γδ T cell progenitor cells was absent in ALKBH5 KO γδ T mature cells (Extended Data Fig. 10 and Supplementary Table 3). Of note, the level of Jagged1 mRNA markedly decreased in WT mature γδ T cells compared with WT γδ T progenitors (Supplementary Tables 1,3), indicating that Jagged1 expression in γδ T cell may have temporospatial characteristics. Taken together, this evidence indicates that ALKBH5 regulates the development of γδ T cells by influencing the expression of Jagged1 and Notch2 mRNAs, and through this other Notch-related genes in γδ T cell progenitors.

ALKBH5 deficiency enhances m ⁶ A RNA modification on Jagged1 and Notch2 mRNAs to decrease their stability and expression. To address mechanistically how ALKHB5 affects Jagged1 and Notch2 mRNA levels, we first confirmed that the m⁶A levels in total mRNA of thymus lymphocytes increased in Alkbh5^f/f Lck⁺ mice than in Alkbh5^f/f mice (Fig. 6a). Based on our previous m⁶A-seq data from murine T cells³⁶, we found highly enriched and specific m⁶A peaks on Jagged1 and Notch2 mRNAs (Supplementary Table 4). m⁶A–RNA immunoprecipitation (RIP) combined with qPCR revealed that Jagged1 and Notch2 m⁶A enrichment was markedly increased in Alkbh5^f/f Lck⁺ mice than in the WT littermates (Fig. 6b). RNA m⁶A methylation is understood to mainly affect RNA stability. To further prove that increased m⁶A led to more rapid degradation of Jagged1 and Notch2 mRNAs, we performed RNA decay analysis and identified that Jagged1 transcription was more rapidly degraded in Alkbh5^f/f Lck⁺ mice than the WT littermates (Fig. 6c,d). Although the degradation of Notch2 transcription was slightly accelerated in the absence of ALKBH5 (Fig. 6e), it was enough to reduce the expression level of Notch2 mRNA compared to WT littermates (Fig. 6f). These data suggest that ALKBH5 deletion enhances m⁶A modification on Jagged1 and Notch2 mRNAs to decrease their stability and expression in γδ T cells. Collectively, loss of ALKBH5-mediated m⁶A RNA modification increase promotes the development of γδ T cell progenitors through targeted suppression of Jagged1/Notch2 signaling (Fig. 6g).

In this study, we discovered that ALKBH5 in thymic lymphocytes plays a critical role in the cell fate decision between αβ T and γδ T cell lineages by targeting the Jagged1/Notch2 signaling pathway. We observed that loss of ALKBH5 results in a marked expansion of γδ T cells, with a minor effect on αβ T cells in both the thymus and periphery. It is well demonstrated that γδ T cells are required to combat invasive bacterial infection, and may have great promise for the development of novel immunotherapies^6,7. Surprisingly, expanded γδ T cells led to a more efficient immune response against S. typhimurium infection, while the depletion of γδ T cells eliminated this the protective role in Alkbh5^f/f Lck⁺ mice, together suggesting that loss of ALKBH5 specifically affects the expansion of γδ T cells. ALKBH5 deletion had no impact on cytokine profiles, and affected neither proliferation nor apoptosis of mature γδ T cells; it did however expand the pool of developing γδ T-cell progenitors and enhanced their proliferative capacity during embryonic development. Previously, the Notch signaling pathway was shown to be necessary and sufficient for T cell lineage commitment²³. However, whether specific Notch receptor–ligand interactions influence the later cell fate decision by early thymocyte progenitors to become γδ T cell in mice is still unknown^51,52. Here, our data demonstrate that loss of ALKBH5-mediated RNA m⁶A levels promotes the proliferation and differentiation of γδ T precursors through targeting the Notch signaling genes, and shows which specific Notch receptor–ligand interaction controls the development of murine γδ T-cell progenitors in the thymus.

Our findings raise the intriguing question of how ALKBH5 affects the proportion and number of γδ T cells in the thymus. Although αβ and γδ T cells originate from a common thymic lymphocyte progenitor⁹, γδ T cell precursors are believed to branch off from the αβ T cell development pathway before or at the time of TCR-α rearrangement at the DN2 stage⁴⁰. We observed that the frequency of DN3 cells, and the number of DN2 and DN3 cells are significantly increased in the thymus at the absence of ALKBH5. Our data also show that ALKBH5 deficiency results in a significant expansion of γδ T cell progenitors in the thymus, including TCRδ⁺ Vγ1.1⁺, TCRδ⁺ Vγ2⁺ and γδNKT subsets. However, the generation of γδ T cell subpopulations is developmentally regulated during ontogeny, such that Vγ5 cells develop during the fetal period, Vγ6 cells around birth, Vγ4 cells in the neonatal period, and Vγ1 and Vγ7 cells at the adult stage^39,53. Therefore, we do not rule out other subsets of γδ T cell precursors that may have changed during ontogeny in the absence of ALKBH5. Further studies will address which population of other γδ T cell precursors are differentially induced by the loss of ALKBH5 during ontogeny.

Notch signaling is involved in the regulation of lymphocyte development and function²³. In mammals, this pathway is composed of 4 Notch receptors (Notch1–Notch4), and five ligands: Jagged1 and Jagged2, and Delta1, Delta3 and Delta4. Recent evidence indicates that Notch receptor–ligand interactions have been implicated in governing cell fate decisions during T-lymphocyte differentiation^24,51,54,55. By RNA-seq and m⁶A epigenomic analysis, we confirm that loss of ALKBH5-mediated m⁶A RNA modification directly suppresses Jagged1/Notch2 signaling in γδ T-cell progenitors, which in turn promotes the development of immature γδ T cell. Interestingly, murine bone marrow–derived stem cells do not respond to Jagged1 signals, while Jagged1 signals can influence the differentiation of T-cell progenitors along γδ T-cell lineages during a brief window of their development between the DN1 and DN3 stages of thymic development⁵². Out of curiosity, we compare the expression of Jagged1 in mature and immature γδ T cells based on RNA-seq data, and were surprised to find that the level of Jagged1 expression in mature γδ T cells is very low, and significantly decreased compared with γδ T cell precursors, pointing to a potential role of Jagged1 in γδ T cell development. Recent studies have shown critical roles of RNA m⁶A ‘eraser’ ALKBH5 in acute myeloid leukemia stem cells by specifically regulating a limited number of genes in leukemia cells^56,57. Here, we observe that loss of ALKBH5 only markedly reduces the expression of Jagged1 and Notch2, without detectable changes in any other receptors or ligands. Furthermore, the Notch signaling downstream effectors, such as Hey1 and Hes1 are significantly decreased at the absence of ALKBH5. Taken together, these data indicate that RNA m⁶A modification may serve as one checkpoint in the development of γδ T cells, by at least controlling Notch signaling strength.

Collectively, we show for the first time that RNA m⁶A modification ‘eraser’ ALKBH5 regulates the development of murine γδ T cell precursors in the thymus mainly through a specific interaction between Jagged1 and Notch2 (Fig. 6g). Further investigation is needed to characterize the regulation of the m⁶A checkpoint and identify more downstream ‘responders’ that control the development of γδ T cell precursors.

Miller, J. F. The golden anniversary of the thymus. Nat. Rev. Immunol. 11, 489–495 (2011).
Guo, X. J. et al. Lung γδ T Cells Mediate Protective Responses during Neonatal Influenza Infection that Are Associated with Type 2 Immunity. Immunity 49, 531–544 (2018).
Bonneville, M., O’Brien, R. L. & Born, W. K. γδ T cell effector functions: a blend of innate programming and acquired plasticity. Nat. Rev. Immunol. 10<bi>,</bi> 467–478 (2010).
Sutton, C. E. et al. Interleukin-1 and IL-23 Induce Innate IL-17 Production from γδ T Cells, Amplifying Th17 Responses and Autoimmunity. Immunity 31<bi>,</bi> 331–341 (2009).
Mamedov, M. R. et al. A Macrophage Colony-Stimulating-Factor-Producing γδ T Cell Subset Prevents Malarial Parasitemic Recurrence. Immunity 48<bi>,</bi> 350–363 (2018).
Wu, Y. L. et. al. γδ T cells and their potential for immunotherapy. Int. J. Biol. Sci. 10<bi>,</bi> 119–135 (2014).
Cho, J. S. et al. IL-17 is essential for host defense against cutaneous Staphylococcus aureus infection in mice. J. Clin. Invest. 120<bi>,</bi> 1762–1773 (2010).
Silva-Santos, B., Serre, K. & Norell, H. γδ T cells in cancer. Nat. Rev. Immunol. 15<bi>,</bi> 683–691 (2015).
Kreslavsky, T., Gleimer, M. & von Boehmer, H. Alphabeta versus gammadelta lineage choice at the first TCR-controlled checkpoint. Curr. Opin. Immunol. 22, 185–192 (2010).
Pennington, D. J., Silva-Santos, B. & Hayday, A. C. Gammadelta T cell development–having the strength to get there. Curr. Opin. Immunol. 17<bi>,</bi> 108–115 (2005).
Shiromizu, C. M. & Jancic, C. C. γδ T Lymphocytes: An Effector Cell in Autoimmunity and Infection. Front. Immunol. 9<bi>,</bi> 2389 (2018).
van Oers, N. S., Lowin-Kropf, B., Finlay, D., Connolly, K. & Weiss, A. αβ T Cell Development Is Abolished in Mice Lacking Both Lck and Fyn Protein Tyrosine Kinases. Immunity 5<bi>,</bi> 429–436 (1996).
Negishi, I. et al. Essential role for ZAP-70 in both positive and negative selection of thymocytes. Nature 376<bi>,</bi> 435–438 (1995).
Prinz, I. et al. Visualization of the earliest steps of gammadelta T cell development in the adult thymus. Nat. Immunol. 7<bi>,</bi> 995–1003 (2006).
Muro, R. et al. γδTCR recruits the Syk/PI3K axis to drive proinflammatory differentiation program. J. Clin. Invest. 128<bi>,</bi> 415–426 (2018).
Muñoz-Ruiz, M. et al. TCR signal strength controls thymic differentiation of discrete proinflammatory γδ T cell subsets. Nat. Immunol. 17<bi>,</bi> 721–727 (2016).
Sumaria, N., Martin, S. & Pennington, D. J. Developmental origins of murine γδ T-cell subsets. Immunology 156<bi>,</bi> 299–304 (2019).
Buus, T. B., Ødum, N., Geisler, C. & Lauritsen, J. P. H. Three distinct developmental pathways for adaptive and two IFN-γ-producing γδ T subsets in adult thymus. Nat. Commun. 8<bi>,</bi> 1911 (2017).
Turchinovich, G. & Hayday, A. C. Skint-1 Identifies a Common Molecular Mechanism for the Development of Interferon-γ-Secreting versus Interleukin-17-Secreting γδ T Cells. Immunity 35<bi>,</bi> 59–68 (2011).
Haas, J. D. et al. Development of Interleukin-17-Producing γδ T Cells Is Restricted to a Functional Embryonic Wave. Immunity 37<bi>,</bi> 48–59 (2012).
Sumaria, N., Grandjean, C. L., Silva-Santos, B. & Pennington, D. J. Strong TCRγδ Signaling Prohibits Thymic Development of IL-17A-Secreting γδ T Cells. Cell Rep. 19<bi>,</bi> 2469–2476 (2017).
Spidale, N. A. et al. Interleukin-17-Producing γδ T Cells Originate from SOX13⁺ Progenitors that Are Independent of γδTCR Signaling. Immunity 49<bi>,</bi> 857–872 (2018).
Radtke, F., Wilson, A., Mancini, S. J. & MacDonald, H. R. Notch regulation of lymphocyte development and function. Nat Immunol. 5<bi>,</bi> 247–253 (2004).
Washburn, T. et al. Notch Activity Influences the αβ versus γδ T Cell Lineage Decision. Cell 88<bi>,</bi> 833–843 (1997).
Frye, M., Harada, BT., Behm, M. & He, C. RNA modifications modulate gene expression during development. Science 361<bi>,</bi> 1346–1349 (2018).
Yang, Y., Hsu, PJ., Chen, Y. S. & Yang, Y. G. Dynamic transcriptomic m⁶A decoration: writers, erasers, readers and functions in RNA metabolism. Cell Res. 28<bi>,</bi> 616–624 (2018).
Aguilo, F. et al. Coordination of m⁶A mRNA Methylation and Gene Transcription by ZFP217 Regulates Pluripotency and Reprogramming. Cell Stem Cell 17<bi>,</bi> 689–704 (2015).
Bertero, A. et al. The SMAD2/3 interactome reveals that TGFbeta controls m⁶A mRNA methylation in pluripotency. Nature 555<bi>,</bi> 256–259 (2018).
Haussmann, I. U. et al. m⁶A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. Nature 540<bi>,</bi> 301–304 (2016).
Fischer, J. et al. Inactivation of the Fto gene protects from obesity. Nature 458<bi>,</bi> 894–898 (2009).
Liu, Y. et al. N⁶-methyladenosine RNA modification-mediated cellular metabolism rewiring inhibits viral replication. Science 365<bi>,</bi> 1171–1176 (2019).
Xiang, Y. et al. RNA m⁶A methylation regulates the ultraviolet-induced DNA damage response. Nature 543<bi>,</bi> 573–576 (2017).
Zhang, S. et al. m⁶A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell 31<bi>,</bi> 591–606 (2017).
Li, Z. et al. FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N⁶-Methyladenosine RNA Demethylase. Cancer Cell 31<bi>,</bi> 127–141 (2017).
Han, D. et al. Anti-tumour immunity controlled through mRNA m⁶A methylation and YTHDF1 in dendritic cells. Nature 566<bi>,</bi> 270–274 (2019).
Li, H. B. et al. m⁶A mRNA methylation controls T cell homeostasis by targeting the IL-7/STAT5/SOCS pathways. Nature 548<bi>,</bi> 338–342 (2017).
Tong, J. et al. m⁶A mRNA methylation sustains Treg suppressive functions. Cell Res. 28<bi>,</bi> 253–256 (2018).
Shimizu, C. et al. Progression of T cell lineage restriction in the earliest subpopulation of murine adult thymus visualized by the expression of lck proximal promoter activity. Int. Immunol. 13<bi>,</bi> 105–117 (2001).
Muro, R., Takayanagi, H. & Nitta, T. T cell receptor signaling for γδT cell development. Inflamm. Regen. 39<bi>,</bi> 6 (2019).
Tanigaki, K. et al. Regulation of αβ/γδ T Cell Lineage Commitment and Peripheral T Cell Responses by Notch/RBP-J Signaling. Immunity 20<bi>,</bi> 611–622 (2004).
Carow, B., Gao, Y., Coquet, J., Reilly, M. & Rottenberg, M. E. lck-Driven Cre Expression Alters T Cell Development in the Thymus and the Frequencies and Functions of Peripheral T Cell Subsets. J. Immunol. 197<bi>,</bi> 2261–2268 (2016).
Kadivar, M., Petersson, J., Svensson, L. & Marsal, J. CD8αβ + γδ T Cells: A Novel T Cell Subset with a Potential Role in Inflammatory Bowel Disease. J. Immunol. 197<bi>,</bi> 4584–4592 (2016).
Rodewald, H. R. & Fehling, H. J. Molecular and cellular events in early thymocyte development. Adv. Immunol. 69<bi>,</bi> 1–112 (1998).
Wolfer, A. et al. Inactivation of Notch 1 in immature thymocytes does not perturb CD4 or CD8T cell development. Nat. Immunol. 2<bi>,</bi> 235–241 (2001).
Coffey, F. et al. The TCR ligand-inducible expression of CD73 marks γδ lineage commitment and a metastable intermediate in effector specification. J. Exp. Med. 211<bi>,</bi> 329–343 (2014).
Adams, E. J., Gu, S. & Luoma, A. M. Human gamma delta T cells: Evolution and ligand recognition. Cell Immunol. 296<bi>,</bi> 31–40 (2015).
Carding, S. R. & Egan, P. J. Gammadelta T cells: functional plasticity and heterogeneity. Nat. Rev. Immunol. 2<bi>,</bi> 336–345 (2002).
Garman, R. D., Doherty, P. J. & Raulet, D. H. Diversity, Rearrangement, and Expression of Murine T Cell Gamma Genes. Cell 45<bi>,</bi> 733–742 (1986).
Iso, T., Kedes, L. & Hamamori, Y. HES and HERP families: multiple effectors of the Notch signaling pathway. J. Cell. Physiol. 194<bi>,</bi> 237–255 (2003).
Rangarajan, A. et al. Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J. 20<bi>,</bi> 3427–3436 (2001).
Van de Walle, I. et al. Specific Notch receptor-ligand interactions control human TCR-αβ/γδ development by inducing differential Notch signal strength. J. Exp. Med. 210<bi>,</bi> 683–697 (2013).
Lehar, S. M., Dooley, J., Farr, A. G. & Bevan, M. J. Notch ligands Delta 1 and Jagged1 transmit distinct signals to T-cell precursors. Blood 105<bi>,</bi> 1440–1447 (2005).
Vantourout, P. & Hayday, A. Six-of-the-best: unique contributions of γδ T cells to immunology. Nat. Rev. Immunol. 13<bi>,</bi> 88–100 (2013).
Hozumi, K. et al. Delta-like 4 is indispensable in thymic environment specific for T cell development. J. Exp. Med. 205<bi>,</bi> 2507–2513 (2008).
Koch, U. et al. Delta-like 4 is the essential, nonredundant ligand for Notch1 during thymic T cell lineage commitment. J. Exp. Med. 205, 2515–2523 (2008).
Shen, C. et al. RNA Demethylase ALKBH5 Selectively Promotes Tumorigenesis and Cancer Stem Cell Self-Renewal in Acute Myeloid Leukemia. Cell Stem Cell 27, 64–80 (2020).
Wang, J. et al. Leukemogenic Chromatin Alterations Promote AML Leukemia Stem Cells via a KDM4C-ALKBH5-AXL Signaling Axis. Cell Stem Cell 27, 81–97 (2020).

Competing interests

The authors declare no competing interests.

Author contributions

C.D., H.-B.L. and R.A.F. initiated the study. C.D., H.X. and H.-B.L. designed the experiments. C.D. performed most of the experiments and analyzed data. C.D., H.X., H.-B.L. and R.A.F. wrote and revised the manuscript. R.Q. conducted bioinformatics analysis. Z.Y., H.X. and J.Z. helped to perform the FACS analysis. M.R., A.J., R.J., Z.W., G.Y., M.S., E.S., Z.Y., Q.Z., B.S. and Q.X. contributed to key discussions. H.-B.L., R.A.F. and Q.X. supervised research, coordination, and strategy.

Acknowledgements

We want to thank L. Yang for support in m⁶A-RIP-qPCR analysis. We also thank all members of the Li laboratory and Flavell laboratory for technical and administrative support. This work is supported by grants from National Natural Science Foundation of China (grant no. 91753141 to H.-B.L.), the Program for Professor of Special Appointment (Eastern Scholar) at Shanghai Institutions of Higher Learning (H.-B.L.), the start-up fund from the Shanghai Jiao Tong University School of Medicine (H.-B.L.), the fund from China Scholarship Council (grant no. 201806090232 to C.D) and the Howard Hughes Medical Institute (R.A.F.).

Mice. Alkbh5 conditional knockout mice (Alkbh5^f/f) were generated as previously described with CRISPR–Cas9 technology by insertion of two loxp sites into Alkbh5 genome loci⁵⁸. The gRNA and donor oligonucleotides used in this study are listed as follows. Left loxp insertion: 5’-tt*g*c*ccgaattttcgggttgacatacacctctagctctctcctgctcaggctcagcagccacttaaataacttcgtataatgtatgctatacgaagttatgggaatcgtctctgagtggttggagacctgagaggactgtattcacactccacttgtttgctc*a*t*t-3’; Right loxp insertion: 5’-gg*t*t*ctgactcgccttttttctttttgcgtgcaaaccataggaagcttgtgtctgaaactcatagcataacttcgtataatgtatgctatacgaagttataggataagactaatgtggaattgtgtacctgcaggcaggtttgaagtggccatagtagcttat*c*t*g-3’.

Briefly, gRNA and ssDNA Ultramer (IDT) donor oligonucleotides were synthesized and injected into C57BL/6N embryos. Alkbh5^f/f mice generation, and conditionally deleted Alkbh5 in thymic lymphocytes by generating Alkbh5^f/f Lck-Cre mice. We further crossed Alkbh5^f/f Lck-Cre with TCRdelta deficient (TCRδ^−/−) mice to get Alkbh5 and TCRδ double knockout mice. Lck-Cre (B6.Cg strain; Stock No: 003802) and TCRδ^−/− (B6.129P2 strain; Stock No: 002120) mice were obtained from Jackson Laboratory, and have been backcrossed to C57BL/6N mice (Charles River laboratories) for more than ten generations.

We used Alkbh5^f/f without Lck-Cre as wild-type controls for Alkbh5^f/f Lck-Cre mice. All wild-type and knockout mice used in most of the experiments described here were sex- and age- (6 to 10 weeks old) matched littermates and were co-housed after weaning. Unless they came with special instructions, mice were randomly assigned to different experimental groups and each cage contained animals of all different experimental groups. Both male and female mice were used in experiments. All mice were kept under specific pathogen-free (SPF) conditions, on a 12/12 on/off light cycle, maintained at 72 (+/-2) °F with 70% humidity in the animal facility at Yale University. Animal procedures were approved by the Institutional Animal Care and Use Committee of Yale University (IACUC).

In vivo S. Typhimurium infection. Salmonella enterica subsp. enterica serovar Typhimurium (SL1344 strain) was provided by J. Galan and stocked in our lab as previously described⁵⁹. Routinely, 8 to 10 weeks old mice were fasted for 4 hours followed by gavage of streptomycin (20 mg), at day − 1. At day 0 of infection, mice were fasted again for 4 hours and infected with 1 × 10³ CFUs of S. Typhimurium per mouse. Bacteria were propagated overnight in LB containing streptomycin (100 µg/ml) before infection, and subcultured in high salt LB medium (0.3M NaCl) with no antibiotics. Bacterial CFU was calculated by using spectrophotometry with OD600nm wavelength. To calculate fecal CFU, feces were collected at day 4 post infection and resuspended in PBS at the ratio of 50 mg feces per ml PBS. After being vortexed for 30 min, bacteria containing supernatants were clarified by centrifugation at 50 g for 10 min. The supernatants were serially diluted and plated on LB streptomycin plates (100 µg/ml) with 10 µl samples each dot. Similarly, caecum, spleen and liver tissues were harvested and dissociated with gentleMacs C Tubes (Miltenyi Biotech, #130-096-334) as previously described⁵⁹. Organs CFU counts were calculated using similar methodology as above. All CFU counts were preformed blinded by two experimenters separately. All animal experimentats were performed in compliance with Yale Institutional Animal Care and Use Committee protocols.

Colon lymphocytes isolation. Colon tissues was harvested as described and kept in cold RPMI medium until next procedure, when they were turned inside out and incubated in 25 ml dissociation medium (RPMI with 1 mM DTT, 2 mM EDTA and 2% FBS). The tissues were kept stirring at the speed of 500 rpm in 37℃ incubation boxes for 30 minutes. The supernatant which contains the intraepithelial lymphocytes (IEL) was centrifuged and washed with FACS buffer (DPBS with 2% FBS). The remaining colon tissues were cut into small pieces and incubated with 20 ml digestion medium (RPMI with 0.5 mg/ml Dispase, 1 mg/ml Type II Collagenase and 2% FBS). For the digestion procedure, tissues were treated for 45–60 minutes at 37℃, with 600 rpm of stirring speed. When digestion was over, the samples were filtered through 70 µm cell strainer, and rinsed with additional 25 ml of FACS buffer, followed by centrifuging at 500 g for 10 minutes. The cell pellet which contains the lamina propria lymphocytes (LPL) was collected and washed with FACS buffer. Each collected IEL and LPL samples were purified using 40% percoll, and then were strained to remove any undigested material and washed in FACS buffer before processing for flow cytometry analysis.

Flow cytometry. For surface staining, single-cell suspensions were prepared as described and stained for surface markers for 15–30 min at 4 °C. For intracellular cytokine staining, the cells were re-stimulated for 3 h at 37 °C with phorbol 12-myristate 13-acetate (PMA) (Sigma, 50 ng/ml) and ionomycin (Sigma, 1 µg/ml) in the presence of Monensin (Biolegend). After stimulation, cells were washed and stained as the manufacturer described (BD, #554714). For staining of nuclear factors, cells were fixed and stained according to the manufacturer’s instructions (eBioscience, #00-5523-00). For BrdU experiment, mice were retro-orbital injected with BrdU at a dose of 100 µg per gram of body weight 2 hours before euthanasia. Then thymocytes were collected and stained as described above. Cells were all re-suspended in PBS, 0.5% FBS, 5 mM EDTA and acquired with an LSRII cytometer (BD Bioscience). Data were analyzed by using FlowJo software (version 9.0 or higher, BD Bioscience). The list of antibodies and reagents used in flow cytometry is shown in Supplementary Table 5.

RNA isolation and qPCR. TRIzol reagent (Invitrogen) was added to total thymic lymphocytes and then processed following the manufacturer’s instructions. RNA was further purified using the RNase-Free DNase Set (QIAGEN, #79256). The RNA isolation of γδ T cells or progenitors was performed with RNeasy Micro Kit (QIAGEN, #74034) following the manufacturer’s protocol. Maxima H Minus Reverse Transcriptase Kit (ThermoFisher Scientific, #EP0753) was used for cDNA synthesis. Sigma KiCqStart predesigned SYBR green primers, gene-specific 6FAM-MGB probes (ThermoFisher Scientific) and iTaq Universal SYBR Green Supermix or FAM Supermix (Biorad) were used for real time PCR, and β-actin mRNA level was used as internal control to calculated mRNA relative abundance. Primer sequences used for qPCR are as follow: mouse Alkbh5 (forward, 5ʹ-CGCGGTCATCAACGACTACC-3ʹ; reverse, 5ʹ-ATGGGCTTGAACTGGAACTTG-3ʹ), mouse β-actin (forward, 5ʹ-AGTGTGACGTTGACATCCGT-3ʹ; reverse, 5ʹ-GCAGCTCAGTAACAGTCCGC-3ʹ), mouse Myc-peak (forward, 5ʹ-GCTTCGAAACTCTGGTGCAT-3ʹ; reverse, 5ʹ-AATTCCAGCGCATCAGTTCT-3ʹ). Mouse Jagged1, Notch1, Notch2, Hey1, Hes1, Cdkn1a and β-actin specific probes (ThermoFisher Scientific, #4453320).

Western blot. Total protein of thymic lymphocytes was extracted with RIPA lysis buffer supplemented with protease inhibitors (ThermoFisher Scientific). Antibodies against ALKBH5 (Proteintech, #16837-1-AP) and β-actin (Cell Signaling Technology, #4970) were used at a 1:1,000 dilution in 5% no-fat milk buffer at 4 °C overnight. Membranes were washed with 0.1% PBST buffer and then incubated in HRP-conjugated secondary antibody (Cell Signaling Technology, #7074) at room temperature for 1 hour. After extensive wash, membranes were incubated in TLC chemiluminescence reagent (Biorad) and exposed to X-ray film.

m ⁶ A dot blot. m⁶A dot blot was conducted as previously described³¹. Briefly, total RNA extracted from total thymic γδ T cells, were purified with the Dynabeads mRNA Purification Kit (Invitrogen, #61006) according to the manufacturer’s instructions.Then, purified mRNA was further mixed with gly sample loading dye (Invitrogen, #AM8551) and denatured at 65 °C for 20 min, and put on ice immediately. Denatured samples were dropped onto the Hybond-N + membrane, dried naturally and performed UV crosslinking for 2 minutes. 0.1% PBST wash buffer was used to wash the membranes, which were then blocked with 5% non-fat milk for 1 hour. Later, the membranes were probed with anti-m⁶A antibody (Synaptic Systems, #202003) at a dilution of 1:1000 in 4 °C for overnight with gentle shaking. 0.1% PBST buffer washed the membranes three times, 10 min each time. After that, an HRP-conjugated secondary antibody (Cell Signaling Technology, #7074) was added to the membranes and incubated at room temperature for 1 hour. After extensive wash, the signal was detected by enhanced chemiluminescence with pico ECL using Chemidoc MP (Biorad).

RNA-seq library preparation and data processing. Thymic mature γδ T cells (CD45.2⁺CD3⁺TCRγ/δ⁺) and γδ T progenitors (CD45.2⁺CD4⁻CD8⁻TCRγ/δ⁺CD73⁺) were sorted by FACS Aria II (BD Bioscience). Total RNAs were isolated by RNeasy Micro Kit (QIAGEN, #74034) following the manufacturer’s protocol. mRNA for RNA-seq analysis was purified using polyA + selection and RNA-seq libraries were constructed by Yale Center for Genome Analysis (YCGA) using SMARTer® Stranded Total RNA-Seq Kit-Pico Input Mammalian (Clontech). The libraries were sequenced on Illumina HiSeq X 4000 platform (paired-end 150-bp read length) by Geneseeq Technology Inc. Each sample obtained 50 million reads. STAR was used to align the raw sequencing reads to mouse genome mm10 with default parameters after trimming adapter sequences with cutadapt^60,61. Subsequently, we counted reads in features with htseq-count and used DESeq2 for identifying differentially expressed genes between the WT and KO samples with the same number of biological replicates⁶². Visualizations using volcano-plots and heatmaps were produced with R. Gene Ontology (GO) enrichment analysis of biological process was performed by Reactome signaling pathway analysis based on differentially expressed genes.

m ⁶ A-RIP-qPCR. m⁶A-RIP-qPCR analysis was performed as described previously³¹. Briefly, total thymic γδ T cells were isolated using mouse TCRγ/δ + T Cell Isolation Kit (Miltenyi Biotec, #130-092-125) and processed according to the manufacturer’s protocol. The purified poly(A) + mRNA was incubated with anti-m⁶A antibody (Synaptic System, #202003,) or rabbit IgG in RIP wash buffer (150 mM NaCl, 10 mM Tris, 0.1% NP40, PH 7.4, supplemented with RNase inhibitor) for 2 hours at 4 °C. Then, Protein A beads (ThermoFisher Scientific, #21348) were added and incubated in 4 °C for 2 hours. After extensive wash with RIP buffer, immunoprecipitated beads-m⁶A antibody-mRNA complex was competitively eluted by m⁶A nucleotide by using TRIzol reagent (Invitrogen), and then purified by 75% ethanol precipitation. Maxima H Minus Reverse Transcriptase Kit (ThermoFisher Scientific, #EP0753) was used for cDNA synthesis. Sigma KiCqStart predesigned SYBR green primers, gene-specific 6FAM-MGB probes (ThermoFisher Scientific) and iTaq Universal SYBR Green Supermix or FAM Supermix (Biorad) were used for real time PCR. β-actin as m⁶A negative control, Myc peak as m⁶A positive control³⁶.

RNA decay analysis. RNA decay analysis was conducted as previously described⁶³. Briefly, total thymic γδ T cells were isolated using mouse TCRγ/δ + T Cell Isolation Kit (Miltenyi Biotec, #130-092-125) and processed following the manufacturer’s instruction. Then, cells were plated on 96-well plates with 5 × 10⁴ cells per well. After treatment with actinomycin D (5 µg/ml) (Sigma-Aldrich, #A1410) for 0, 2 hours and 4 hours, cells were collected and subjected to RNA extraction. Total RNAs isolation and qPCR conducted for mRNA levels as described above.

Statistical analysis. Statistical analysis was calculated in GraphPad Prism 8 series software. Paired or unpaired Student’s t-test and two-tailed Mann–Whitney U test were used for measurement data of two groups analysis. All general statistical analysis was calculated with a confidence interval of 95%. P values ≤ 0.05 were considered as statistically significant. Survival curves were compared by the log-rank test using GraphPad Prism 8. Data are represented as mean ± s.e.m. or mean ± s.d. as indicated in the figures.

References

Henao-Mejia, J. et al. Generation of Genetically Modified Mice Using the CRISPR-Cas9 Genome-Editing System. Cold Spring Harb. Protoc. 2016, pdb.prot090704 (2016).
Jarret, A. et al. Enteric Nervous System-Derived IL-18 Orchestrates Mucosal Barrier Immunity. Cell 180, 50–63 (2020).
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).
Kim, D., Langmead, B. & Salzberg, S. L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 12, 357–360 (2015).
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Hwang, S. S. et al. mRNA Destabilization by BTG1 and BTG2 maintains T cell quiescence. Science 367, 1255–1260 (2020).

There is NO Competing Interest.

ExtendedDataFigure1.tif
Extended Data Fig. 1 ALKBH5 is expressed in a wide range of immune cells. a, Normalized expression value of ALKBH5 across different immune cells. Data is acquired from Immunological Genome Project (www.immgen.org). b, Schematic representation of the targeting strategy used to flank exon 1 of the Alkbh5 loci with loxP sites (top) and excision with Cre-recombinase (bottom). c, Mouse models employed to specifically knock-out ALKBH5 in lymphocyte populations. d, Quantitative PCR (qPCR) analysis of ALKBH5 gene expression level in thymocytes isolated from 4 pairs of Alkbh5f/f Lck+ and Alkbh5f/f cohoused mice (n = 4). Data represent mean ± s.d.; paired t test was used for statistical analysis. **P < 0.01.
ExtendedDataFigure1.tif
Extended Data Fig. 1 ALKBH5 is expressed in a wide range of immune cells. a, Normalized expression value of ALKBH5 across different immune cells. Data is acquired from Immunological Genome Project (www.immgen.org). b, Schematic representation of the targeting strategy used to flank exon 1 of the Alkbh5 loci with loxP sites (top) and excision with Cre-recombinase (bottom). c, Mouse models employed to specifically knock-out ALKBH5 in lymphocyte populations. d, Quantitative PCR (qPCR) analysis of ALKBH5 gene expression level in thymocytes isolated from 4 pairs of Alkbh5f/f Lck+ and Alkbh5f/f cohoused mice (n = 4). Data represent mean ± s.d.; paired t test was used for statistical analysis. **P < 0.01.
ExtendedDataFigure2.tif
Extended Data Fig. 2 ALKBH5 deficiency leads to expanded γδ T cell population in the periphery. a, Flow cytometric analysis of lymphocytes isolated from indicated lymphoid organs and tissues (pLN, peripheral lymph node; mLN, mesenteric lymph node) of Alkbh5f/f Lck+ and Alkbh5f/f mice. b, Statistical analysis of cell numbers in (a) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). **P < 0.01, ***P < 0.001, n.s., not significant.
ExtendedDataFigure2.tif
Extended Data Fig. 2 ALKBH5 deficiency leads to expanded γδ T cell population in the periphery. a, Flow cytometric analysis of lymphocytes isolated from indicated lymphoid organs and tissues (pLN, peripheral lymph node; mLN, mesenteric lymph node) of Alkbh5f/f Lck+ and Alkbh5f/f mice. b, Statistical analysis of cell numbers in (a) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). **P < 0.01, ***P < 0.001, n.s., not significant.
ExtendedDataFigure3.tif
Extended Data Fig. 3 Loss of ALKBH5 has minimum effects on αβ T cell development. a,c,e, Flow cytometric analysis of CD4+ and CD8+ T cells isolated from the spleen (a), pLN (c) and mLN (e) of Alkbh5f/f Lck+ and Alkbh5f/f mice. The right panel reports the statistical analysis of frequencies for CD4+ and CD8+ T cells on the left. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). b,d,f, Flow cytometric analysis of naïve and memory T cells isolated from the spleen (b), pLN (d) and mLN (f) of Alkbh5f/f Lck+ and Alkbh5f/f mice. The right panel reports the statistical analysis of frequencies for effector memory (CD44), naïve (CD62L), central memory (DP) and double-negative (DN) cells on the left. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). *P < 0.05, **P < 0.01, n.s., not significant.
ExtendedDataFigure3.tif
Extended Data Fig. 3 Loss of ALKBH5 has minimum effects on αβ T cell development. a,c,e, Flow cytometric analysis of CD4+ and CD8+ T cells isolated from the spleen (a), pLN (c) and mLN (e) of Alkbh5f/f Lck+ and Alkbh5f/f mice. The right panel reports the statistical analysis of frequencies for CD4+ and CD8+ T cells on the left. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). b,d,f, Flow cytometric analysis of naïve and memory T cells isolated from the spleen (b), pLN (d) and mLN (f) of Alkbh5f/f Lck+ and Alkbh5f/f mice. The right panel reports the statistical analysis of frequencies for effector memory (CD44), naïve (CD62L), central memory (DP) and double-negative (DN) cells on the left. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). *P < 0.05, **P < 0.01, n.s., not significant.
ExtendedDataFigure4.tif
Extended Data Fig. 4 Loss of ALKBH5 has minimum effects on αβ T cell development (continued). a,c,e, Statistical analysis of cell numbers for CD4+ and CD8+ T cells isolated from the spleen (a), pLN (c) and mLN (e) of Alkbh5f/f Lck+ and Alkbh5f/f mice is reported, correlated with Extended Data Fig. 3 (a,c,e), respectively. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). b,d,f, Statistical analysis of cell numbers for naïve and memory T cells isolated from the spleen (b), pLN (d) and mLN (f) of Alkbh5f/f Lck+ and Alkbh5f/f is reported, correlated with Extended Data Fig. 3 (b,d,f), respectively. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). *P < 0.05, **P < 0.01, n.s., not significant.
ExtendedDataFigure4.tif
Extended Data Fig. 4 Loss of ALKBH5 has minimum effects on αβ T cell development (continued). a,c,e, Statistical analysis of cell numbers for CD4+ and CD8+ T cells isolated from the spleen (a), pLN (c) and mLN (e) of Alkbh5f/f Lck+ and Alkbh5f/f mice is reported, correlated with Extended Data Fig. 3 (a,c,e), respectively. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). b,d,f, Statistical analysis of cell numbers for naïve and memory T cells isolated from the spleen (b), pLN (d) and mLN (f) of Alkbh5f/f Lck+ and Alkbh5f/f is reported, correlated with Extended Data Fig. 3 (b,d,f), respectively. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). *P < 0.05, **P < 0.01, n.s., not significant.
ExtendedDataFigure5.tif
Extended Data Fig. 5 Different subsets of mature γδ T cells are all expanded in Alkbh5f/f Lck+ mice. a, Flow cytometric analysis of three mature γδ T cell subsets (CD8αβ: CD8α+, CD8β+, CD8αα: CD8α+, CD8β–, CD8–: CD8α–, CD8β–) isolated from indicated organs of either Alkbh5f/f Lck+ or Alkbh5f/f mice. b,c, Statistical analysis of frequencies (b) and cell numbers (c) for three mature γδ T cell subsets in (a) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s., not significant.
ExtendedDataFigure5.tif
Extended Data Fig. 5 Different subsets of mature γδ T cells are all expanded in Alkbh5f/f Lck+ mice. a, Flow cytometric analysis of three mature γδ T cell subsets (CD8αβ: CD8α+, CD8β+, CD8αα: CD8α+, CD8β–, CD8–: CD8α–, CD8β–) isolated from indicated organs of either Alkbh5f/f Lck+ or Alkbh5f/f mice. b,c, Statistical analysis of frequencies (b) and cell numbers (c) for three mature γδ T cell subsets in (a) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s., not significant.
ExtendedDataFigure6.tif
Extended Data Fig. 6 Loss of ALKBH5 has no impact on IFN-γ or IL-17 production of mature γδ T cells in colon. a, Statistical analysis of frequencies for IFN-γ-/IL-17A-producing mature γδ T cells isolated from Colon-IEL of Alkbh5f/f Lck+ (n = 7) and Alkbh5f/f (n = 6) mice. Unpaired t test was used for statistical analysis. Each dot represents one mouse. Data represent one out of three independent experiments (mean ± s.d.). b, Statistical analysis of frequencies for IFN-γ-/IL-17A-producing mature γδ T cells isolated from Colon-LPL of Alkbh5f/f Lck+ (n = 7) and Alkbh5f/f (n = 6) mice. Unpaired t test was used for statistical analysis. Each dot represents one mouse. Data represent one out of three independent experiments (mean ± s.d.). n.s., not significant.
ExtendedDataFigure6.tif
Extended Data Fig. 6 Loss of ALKBH5 has no impact on IFN-γ or IL-17 production of mature γδ T cells in colon. a, Statistical analysis of frequencies for IFN-γ-/IL-17A-producing mature γδ T cells isolated from Colon-IEL of Alkbh5f/f Lck+ (n = 7) and Alkbh5f/f (n = 6) mice. Unpaired t test was used for statistical analysis. Each dot represents one mouse. Data represent one out of three independent experiments (mean ± s.d.). b, Statistical analysis of frequencies for IFN-γ-/IL-17A-producing mature γδ T cells isolated from Colon-LPL of Alkbh5f/f Lck+ (n = 7) and Alkbh5f/f (n = 6) mice. Unpaired t test was used for statistical analysis. Each dot represents one mouse. Data represent one out of three independent experiments (mean ± s.d.). n.s., not significant.
ExtendedDataFigure7.tif
Extended Data Fig. 7 Ratio of thymic γδ T cells subsets and their precursor subsets remain intact or increase slightly in Alkbh5f/f Lck+ mice. a,c,e, Flow cytometric analysis of immature TCRvγ1.1+ γδ T cells at double negative (DN) stage (a), TCRvγ1.1+ γδ T precursor cells (defined as CD73+ TCRvγ1.1+ γδ T cells at DN stage) (c) and NKTvγ1.1 precursor cells (defined as CD73+ CD24– NK1.1+ TCRvγ1.1+ γδ T precursor cells) (e). The right panels report the statistical analysis of frequencies for the populations gated in the left panels. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). b,d,f, Flow cytometric analysis of immature TCRvγ2+ γδ T cells at DN stage (b), TCRvγ2+ γδ T precursor cells (defined as CD73+ TCRvγ2+ γδ T cells at DN stage) (d) and NKTvγ2 precursor cells (defined as CD73+ CD24– NK1.1+ TCRvγ2+ γδ T precursor cells) (f). The right panels report the statistical analysis of frequencies for the populations gated in the left panels. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). *P < 0.05, n.s., not significant.
ExtendedDataFigure7.tif
Extended Data Fig. 7 Ratio of thymic γδ T cells subsets and their precursor subsets remain intact or increase slightly in Alkbh5f/f Lck+ mice. a,c,e, Flow cytometric analysis of immature TCRvγ1.1+ γδ T cells at double negative (DN) stage (a), TCRvγ1.1+ γδ T precursor cells (defined as CD73+ TCRvγ1.1+ γδ T cells at DN stage) (c) and NKTvγ1.1 precursor cells (defined as CD73+ CD24– NK1.1+ TCRvγ1.1+ γδ T precursor cells) (e). The right panels report the statistical analysis of frequencies for the populations gated in the left panels. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). b,d,f, Flow cytometric analysis of immature TCRvγ2+ γδ T cells at DN stage (b), TCRvγ2+ γδ T precursor cells (defined as CD73+ TCRvγ2+ γδ T cells at DN stage) (d) and NKTvγ2 precursor cells (defined as CD73+ CD24– NK1.1+ TCRvγ2+ γδ T precursor cells) (f). The right panels report the statistical analysis of frequencies for the populations gated in the left panels. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 7; KO, n = 6). Data represent one out of three independent experiments (mean ± s.d.). *P < 0.05, n.s., not significant.
ExtendedDataFigure8.tif
Extended Data Fig. 8 All subsets of thymic mature γδ T cells are expanded in Alkbh5f/f Lck+ mice based on TCRvγ. a, Flow cytometric analysis of thymic mature TCRvγ1.1+ γδ T cells isolated from Alkbh5f/f Lck+ and Alkbh5f/f mice. b,c, Statistical analysis of frequency (b) and cell number (c) for the gated population in (a) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 6; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). d, Flow cytometric analysis of thymic mature TCRvγ2+ γδ T cells isolated from Alkbh5f/f Lck+ and Alkbh5f/f mice. e,f, Statistical analysis of frequency (e) and cell number (f) for the gated population in (d) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 6; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). g, Flow cytometric analysis of thymic mature γδNKT cells isolated from Alkbh5f/f Lck+ and Alkbh5f/f mice. h,i, Statistical analysis of frequency (h) and cell number (i) for the gated population in (g) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 6; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). ***P < 0.001, ****P < 0.0001, n.s., not significant.
ExtendedDataFigure8.tif
Extended Data Fig. 8 All subsets of thymic mature γδ T cells are expanded in Alkbh5f/f Lck+ mice based on TCRvγ. a, Flow cytometric analysis of thymic mature TCRvγ1.1+ γδ T cells isolated from Alkbh5f/f Lck+ and Alkbh5f/f mice. b,c, Statistical analysis of frequency (b) and cell number (c) for the gated population in (a) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 6; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). d, Flow cytometric analysis of thymic mature TCRvγ2+ γδ T cells isolated from Alkbh5f/f Lck+ and Alkbh5f/f mice. e,f, Statistical analysis of frequency (e) and cell number (f) for the gated population in (d) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 6; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). g, Flow cytometric analysis of thymic mature γδNKT cells isolated from Alkbh5f/f Lck+ and Alkbh5f/f mice. h,i, Statistical analysis of frequency (h) and cell number (i) for the gated population in (g) is reported. Unpaired t test was used for statistical analysis. Each dot represents one mouse (WT, n = 6; KO, n = 5). Data represent one out of three independent experiments (mean ± s.d.). ***P < 0.001, ****P < 0.0001, n.s., not significant.
ExtendedDataFigure9.tif
Extended Data Fig. 9 Transcriptomic changes in ALKBH5 deficient γδ T cell progenitors. a, Numbers of genes that are up-regulated and down-regulated in ALKBH5 deficient γδ T cell progenitors. Differently expressed genes based one P-value (P < 0.05). b, Gene Ontology (GO) enrichment analysis of biological process for up-regulated genes in ALKBH5-deficient γδ T cell precursors.
ExtendedDataFigure9.tif
Extended Data Fig. 9 Transcriptomic changes in ALKBH5 deficient γδ T cell progenitors. a, Numbers of genes that are up-regulated and down-regulated in ALKBH5 deficient γδ T cell progenitors. Differently expressed genes based one P-value (P < 0.05). b, Gene Ontology (GO) enrichment analysis of biological process for up-regulated genes in ALKBH5-deficient γδ T cell precursors.
ExtendedDataFigure10.tif
Extended Data Fig. 10 Transcriptomic changes in ALKBH5 deficient mature γδ T cells. a, Numbers of genes that are up-regulated and down-regulated in ALKBH5 deficient mature γδ T cells. Differently expressed genes based one P-value (P < 0.05). b, Heatmap showing Jagged/Notch signaling-related genes expression across different samples. c,d, Gene Ontology (GO) enrichment analysis of biological process for down-regulated (c) and up-regulated genes (d) in ALKBH5-deficient mature γδ T cells. Data represent three independent experiments combined.
ExtendedDataFigure10.tif
Extended Data Fig. 10 Transcriptomic changes in ALKBH5 deficient mature γδ T cells. a, Numbers of genes that are up-regulated and down-regulated in ALKBH5 deficient mature γδ T cells. Differently expressed genes based one P-value (P < 0.05). b, Heatmap showing Jagged/Notch signaling-related genes expression across different samples. c,d, Gene Ontology (GO) enrichment analysis of biological process for down-regulated (c) and up-regulated genes (d) in ALKBH5-deficient mature γδ T cells. Data represent three independent experiments combined.
SupplementaryTable1.xlsx
Supplementary Table 1
SupplementaryTable1.xlsx
Supplementary Table 1
SupplementaryTable2.xlsx
Supplementary Table 2
SupplementaryTable2.xlsx
Supplementary Table 2
SupplementaryTable3.xlsx
Supplementary Table 3
SupplementaryTable3.xlsx
Supplementary Table 3
SupplementaryTable4.csv
Supplementary Table 4
SupplementaryTable4.csv
Supplementary Table 4
SupplementaryTable5.xlsx
Supplementary Table 5
SupplementaryTable5.xlsx
Supplementary Table 5

Download PDF

Version 1

posted

You are reading this latest preprint version

RNA m6A demethylase ALKBH5 regulates the development of γδ T cells

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

References

Declarations

Competing interests

Author contributions

Acknowledgements

Methods

Additional Declarations

Supplementary Files

Status:

Version 1