High frequency of the Duffy-negative genotype and absence of Plasmodium vivax infections in Ghana

doi:10.21203/rs.3.rs-80611/v1

Download PDF

Research

High frequency of the Duffy-negative genotype and absence of Plasmodium vivax infections in Ghana

https://doi.org/10.21203/rs.3.rs-80611/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 17 Feb, 2021

Read the published version in Malaria Journal →

You are reading this latest preprint version

Background

The Duffy-negative phenotype is a condition which is thought to confer complete resistance against blood infection with Plasmodium vivax. However, recent studies from different malaria-endemic regions including western Africa have now shown that P. vivax can infect red blood cells (RBCs) and cause clinical disease in Duffy-negative people. The actual prevalence of P. vivax in local populations in Ghana is unknown. In addition, little information is available about the distribution of Duffy genotypes in Ghana. We determined the prevalence of P. vivax and the distribution of Duffy genotypes in Ghana.

Methods

DNA was extracted from dried blood spots (DBS) collected from 952 subjects (845 malaria patients and 107 asymptomatic persons) from nine locations in Ghana. Plasmodium species identification was carried out by nested polymerase chain reaction (PCR) amplification of the small-subunit rRNA genes; P. vivax was further characterized by PCR analysis of the central region of the Pvcsp gene. Duffy blood group genotyping was performed by PCR with sequence-specific primers (PCR-SSP) to detect the presence of the FY^ES allele.

Results

No cases of P. vivax were detected in any of the samples by both PCR methods used. Majority of infections (542, 94.8%) in the malaria patient samples were due to P. falciparum with only 1 infection (0.0017%) and 2 infections (0.0034%) due to P. malariae and P. ovale, respectively. No case of mixed infection was identified. Of the samples tested for the FY^ES allele from all the sites, 90.5% (862/952) had the FY^ES allele. All positive samples were genotyped as FY*B-33/FY*B-33 (Duffy-negative homozygous) and therefore classified as Fy(a-b-).

Conclusions

No cases of P. vivax were detected by both PCRs and 90.5% of the subjects tested carried the FY^ES allele. The lack of P. vivax infections observed can be attributed to the high frequency of the FY^ES allele that silences erythroid expression of the Duffy. These results provide insights on the host susceptibility for P. vivax infections that has before not been investigated in Ghana.

Infectious Diseases

Plasmodium vivax

Malaria

Duffy blood group

Duffy-negative

Ghana

Malaria remains the most important parasitic infection in the world with 228 million cases in 2018 (95% confidence interval [CI]: 206–258 million) (1) caused by infection with one or more of the six species of Plasmodium parasites. Two species, Plasmodium falciparum and P. vivax, are responsible for most of the morbidity and mortality due to malaria (2, 3). However, P. vivax malaria does not attract as much attention in almost every aspect as does the deadlier P. falciparum malaria because, traditionally, the infection was thought to be benign and self-limiting (4, 5). Recent evidence is however challenging this long-held notion of the benign nature of P. vivax malaria, demonstrating that infection with P. vivax can also result in severe illness and death (6). Globally, 53% of the P. vivax burden is in the WHO South-East Asia Region and P. vivax is the predominant parasite (75% of malaria cases) in the WHO Region of the Americas (1).

An important biological difference between P. vivax and P. falciparum is that only P. vivax merozoites use the Duffy (Fy) antigen receptor for chemokines (DARC) to invade erythrocytes (7, 8). The DARC-coding gene is polymorphic with multiple alleles as the codominant FY*A and FY*B, which encode for the two antigens – Fya and Fyb. Four genotypes are possible as a result of the combination of the major alleles, Fy(a + b+), Fy(a + b-), Fy(a-b+) and Fy(a-b-) (9). The first three correspond to a Duffy-positive phenotype, mostly prevalent in Asian and in Caucasian populations and the last one corresponds to the Duffy-negative phenotype, mainly prevalent in African people, who are consequently resistant to P. vivax infection. The Fy(a-b-) genotype results from a point mutation, -33T > C, in the promoter region of allele FY*B, in the GATA box region (10), preventing transcription and resulting in the null ‘erythrocyte silent’ (ES) phenotype.

Until now, the Duffy-negative phenotype was viewed as giving almost total protection against infection with P. vivax because it prevents P. vivax from invading host erythrocytes and completing its complex life cycle (11). Field observations indicate that the conclusion of the absolute dependence on the presence of Duffy on the red cell for P. vivax infection and development in the red cell no longer holds true because a number reports concern findings of P. vivax in the blood of Duffy-negative persons in Brazil (12), Ethiopia (13, 14), Madagascar (15), Kenya (16), Equatorial Guinea and Angola (2) including West African countries, such as Mauritania (17), Cameroon (18, 19), Mali (20), and Benin (21). Thus, contrary to expectation, there is evidence of P. vivax transmission even in areas mapped with highest Duffy-negativity frequencies (20, 22, 23).

The exact frequency of Duffy blood group is poorly documented across Africa, as indeed few populations have been surveyed and there are large gaps in our documentation on Duffy genotypes and phenotypes across Africa, with Ghana being no exception. (24) have concluded that there are sufficient numbers of Duffy-positive individuals in some areas in Africa to maintain P. vivax transmission in areas where the majority of the population is Duffy-negative. The first objective of the present study was to evaluate the P. vivax circulation among both symptomatic and asymptomatic outpatients seeking medical care in various parts of Ghana. The second objective was to explore the Duffy antigen genotype frequency among the study population.

Study areas

The study was conducted in nine sites across Ghana (Fig. 1): Bekwai, Cape Coast, Hohoe, Navrongo, Tarkwa, Sunyani, Wa, Yendi and Accra. These sites are located in three ecological zones of Ghana. The description of these sites has already been published (25–27).

Sampling

Sampling was both prospective and retrospective. Prospective blood samples were collected by finger prick on filter paper (Whatman 3 MM filter paper) from subjects in the study areas. Informed consent was sought from all subjects. Retrospective blood samples were obtained from the blood banks at the Korle Bu Teaching Hospital and 37 Military Hospital to investigate the frequency of the Duffy allele.

DNA extraction

Dried blood spots (DBS) on filter paper were cut into small pieces with scissors and transferred into 1.5-ml microtubes. For lysis, 200 µl TNES digestion buffer (10 mM Tris-HCl (pH 7.5), 400 mM NaCl, 100 mM EDTA, 0.60% SDS) was added to the filter papers, followed by the addition of 6 µl of proteinase K (10 mg/ml) to each tube and incubation at 55^oC overnight in a heat block (Thermo Block TDB-120, Warren, United States of America). Samples were retrieved, 200 µl 5 M NaCl was added to each tube and vortexed briefly. The contents were then spun at 15000 rpm for 10 minutes. The supernatants were transferred into 1.5 ml Eppendorf tubes, and 800 µl of cold absolute ethanol added to each tube and rocked gently back and forth. Samples were stored in a --18^oC freezer for 3 hours. They were retrieved, allowed to thaw, and spun at 14000 rpm for 30 minutes. Then absolute ethanol was carefully poured off the pellet, 500 µl 70% ethanol added and the tubes spun again at 14000 rpm for 5 minutes. After the spun, the supernatant was poured off and the tubes were blotted on filter paper and air-dried. The formed pellets were finally re-suspended in 200 µl TE (10 mM Tris-HCl, pH 8.0; 1 mM EDTA, pH 8.0.) and stored at -21^oC.

Detection and identification of Plasmodium species

Detection of malaria infection and identification of Plasmodium species for all DBS samples were carried out using the nested-PCR amplification of the small-subunit ribosomal RNA genes as described by (28). For each PCR run, two negative controls (water and human DNA) and a positive control (DNA from each species) were used. PCR was performed using OneTaq® Quick-Load® 2X Master Mix with standard buffer from NEB (New England Biolabs Inc., Ipswich, MA, USA).

Genotyping of Pvcsp genes

Further P. vivax parasite characterization was carried out by analysis of the central region of the Pvcsp gene, following a slightly modified version of the protocol described by (29) using the primers VivF 5‘ - TCCATCCTGTTGGTGGACTT – 3’ and VivR 5‘ – TCACAACGTTAAATATGCCAG – 3’.

PCR was performed using OneTaq® Quick-Load® 2X Master Mix with standard buffer (NEB) and 0.4 µM of each primer. Conditions for amplification were an initial denaturation at 94^oC for 5 minutes, followed by 35 cycles of 94^oC for 1 minute, 60^oC for 90 seconds and 68^oC for 1 minute, with a final extension at 68^oC for 10 minutes. PCR reactions were carried out in a SEEAMP™ SCE1000 thermal cycler (Seegene Inc., Seoul, Korea). All PCR runs included a P. vivax positive control (courtesy of Michael Alifrangis).

After the reaction 10 µl of the PCR product was run by electrophoresis at 120 volts in 2% agarose gel (Biopioneer Co, USA) stained with 0.5 µg/ml ethidium bromide (Life Technologies Co, USA) in 1X Tris acetate EDTA (TAE) running buffer (Biopioneer Co, USA) using 2 µl of blue/orange DNA loading dye (6X) (Promega Co, USA). A 100-base pair DNA ladder (NEB) was run alongside the PCR products on the gel. The gel was photographed using UV-illumination (UVIsave gel documentation system, model GAS9200/1/2/3, version 12) and analysed.

Duffy blood group genotyping by PCR-SSP

Duffy genotypes were determined for all blood samples by PCR-SSP using the protocol described by (30) with some modifications. Four PCRs were performed on each sample to genotype the FY*A, FY*B, FY*A^ES and FY*B^ES using forward primers GATAFY2 (5'-CTCATTAGTCCTTGGCTCTTAC-3') and FYAB2 (5’-CTCATTAGTCCTTGGCTCTTAT-3’) and reverse primers FYAREV (5'-AGCTGCTTCCAGGTTGGCAC-3') and FYBREV (5'-AGCTGCTTCCAGGTTGGCAT-3'). The combination of GATAFY2 and FYAREV identified the FY*A^ES allele, GATAFY2 and FYBREV identified the FY*B^ES allele, FYAB2 and FYAREV primers the FY*A allele, and FYAB2 and FYBREV primers the FY*B allele. PCR was performed using OneTaq® Quick-Load® 2X Master Mix with standard buffer (NEB) and 0.4 µM of each primer. Conditions for amplification were an initial denaturation at 94^oC for 5 minutes, followed by 40 cycles of 94^oC for 30 seconds, 56^oC for 30 seconds and 68^oC for 1 minute, with a final extension at 68^oC for 10 minutes. In addition, co-amplification of the human growth hormone gene (HGH) using 0.04 µM each of the HGH-F (5’-TGCCTTCCCAACCATTCCCTTA-3’) and HGH-R (5’-CCACTCACGGATTTCTGTTGTGTTTC-3’) primers was run as an internal control. PCR reactions were carried out in a SEEAMP™ SCE1000 thermal cycler (Seegene Inc., Seoul, Korea). The PCR product sizes of the FY*A^ES FY*B^ES, FY*A, and FY*B alleles were each 711 bp, whereas that of the internal control (i.e., the HGH gene) was 434 bp.

DNA was extracted from DBS collected from a total 952 subjects (845 malaria patients and 107 asymptomatic persons) from 9 locations in Ghana. Out of these 845 malaria patient samples, only 545 (64.5%) were found to be infected with malaria parasites following PCR diagnostic assays of the 18S rRNA gene (Table 1). As expected, majority of these infections (542, 94.8%) were due to P. falciparum with only 1 infection (0.0017%) and 2 infections (0.0034%) due to P. malariae and P. ovale, respectively. No mixed parasitic infections were detected.

Table 1

– Prevalence of infection in malaria patients
Sampling sites (sample size)	Number of infected patients
Sampling sites (sample size)	P. falciparum	P. malariae	P. ovale	P. vivax
Bekwai (128)	103	0	0	0
Cape Coast (159)	100	0	0	0
Hohoe (73)	28	0	0	0
Navrongo (102)	90	2	0	0
Tarkwa (49)	38	0	0	0
Sunyani (18)	5	0	0	0
Wa (64)	39	0	0	0
Yendi (113)	43	0	0	0
Accra (139)	96	0	1	0
Total	542	2	1	0

No cases of P. vivax were detected by PCR in the 845 patient samples tested from all the study sites. In order to confirm the results from the PCR analyses, a different gene of P. vivax (pvcsp) was also PCR amplified but gave the same results (Fig. 2) in that the expected 1064 bp fragment was amplified in only the positive control DNA.

All the 952 subjects were Duffy genotyped by PCR-SSP. A negative reaction was defined as the presence of only the 434 bp amplification HGH control DNA fragment. A positive reaction was defined as the presence of a clearly visible 711-bp DNA fragment with or without the amplification control band (Fig. 3). Of the samples tested for the FY^ES allele from all the sites, 90.5% (862/952) had the FY^ES allele Results showed that all samples that were positive were genotyped as FY*B-33/FY*B-33 (Duffy-negative homozygous) being therefore classified as Fy(a-b-).

Until relatively recently, P. vivax was rarely studied across most of sub-Saharan Africa and malaria diagnostics frequently remained limited to P. falciparum. Since 2010, however, evidence of the presence P. vivax in West Africa has emerged (21, 23, 31, 32) despite the high prevalence of Duffy-negative red blood cell phenotype. Nevertheless, no P. vivax infections were found in this molecular based study conducted in nine sites across Ghana.

In a 2019 case report from China (33), a 49-year-old Chinese man was diagnosed by both microscopy and PCR as having uncomplicated P. vivax malaria on December 19, 2016. This was 39 days after he returned from Ghana after a stay of one and a half years. However, the Duffy genotype of the Chinese man was not given. The presence of the Fy(a-b-) phenotype outside the African continent and the Arabian Peninsula has been estimated to be at frequencies not exceeding 10% (22). It is therefore highly likely that the Chinese man is Duffy-positive since the frequency of Fya among the Chinese has been estimated to exceed 97% (34).

Though P. vivax infections cannot be entirely ruled out in Ghana, it is important to note that an earlier study also from China (35) reported a case of a 39-year-old Chinese man who had stayed in Ghana, for 6 months in 2012, for whom a microscopic examination of Giemsa-stained thin and thick blood smears initially indicated P. vivax infection. However, the results of a thrice conducted rapid diagnostic test were not in agreement with P. vivax and standard PCR analysis of the small-subunit rRNA gene, followed by gene sequencing, pointed to a variant P. ovale wallikeri. Microscopic identification of P. ovale and P. vivax due to their morphological similarities (36) may be unreliable since P. vivax can be misdiagnosed for P. ovale infections and conversely (37). There is also potential for cross-reactivity between P. ovale- and P. vivax -specific antigens in serological screening (38).

Evidence relating to P. vivax transmission across Africa appears inconsistent (38). In the West African countries were P. vivax infections have been recorded, Nigeria (39, 40), Mauritania (41), Mali (42), Cameroon (19), and Benin (21), the prevalence has been very low: These studies have varied in terms of sample size and diagnostic methods (43) and in some reports the Duffy antigen status of the patients was not determined (31, 39, 41). As in this present study, extensive surveys using high-sensitivity molecular methods have repeatedly failed to diagnose P. vivax (24, 44).

The low prevalence of P. vivax infection in West Africa has been attributed to the high frequency of the Duffy-negative phenotype in this region (7, 22, 45). In this study, 90.5% (862/952) of the malaria patients had the FY^ES allele and were classified as Fy(a-b-) in agreement with the report by Howes, Reiner (38). It is clearly obvious that Duffy-negativity provides significant protection against P. vivax blood-stage infection, particularly in symptomatic patients presenting for treatment, though this protection is not absolute. This is in agreement with long-prevailing thinking that for P. vivax invasions to occur an interaction between the parasites and antigens of the Duffy blood group system is necessary (46, 47). However, several other host cell receptors have recently been identified as being involved in the parasite invasion pathway of RBCs. Gruszczyk, Kanjee (48) identified host transferrin receptor 1 (TfR1 or CD71) as an alternative receptor, critical for P. vivax. entry into reticulocytes. CD98 has also been shown to be involved in entrance of the parasite into the host cell (49). Lack of the Duffy antigen thus seems to places a certain restriction on the invasion mechanism, but not completely. A better understanding of the mechanisms that allow interaction between P. vivax and the Fya and Fyb host antigens may allow more specific assessments of the risks of P. vivax infection and clinical disease across the Duffy-negative populations previously considered fully protected, as well as identifying potential vaccine targets.

No P. vivax infections were confirmed by PCR and the FYES allele that results in silenced expression of the Duffy antigen on erythrocytes was found in 90.5% of the patients. The high frequency of FY^ES allele could explain the sparse evidence of P. vivax infections in the samples studied across the country. Though P. vivax malaria is not prevalent and does not represent a significant public health risk, the risk of infection for travellers and foreign aid workers who are Duffy-positive remains uncertain.

DBS

Dried blood spots

DNA

Deoxyribonucleic acid

erythrocyte silent

PCR

Polymerase chain reaction

PCR-SSP

PCR with sequence-specific primers

rRNA

ribosomal RNA

Ethics approval and consent to participate

Ethical approval for this study was granted by the Noguchi Memorial Institute for Medical Research Institutional Review Board (NMIMR IRB), University of Ghana.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

Authors declare no competing interest.

Funding

Financial support for this study was provided by the University of Ghana Office of Research Innovation and Development (ORID).

Authors' contributions

The study was conceived and designed by CAB, KK, and EA. CAB, PAP, ND, AG, and HA contributed to data collection and analysis. All authors contributed to data interpretation. The article was drafted by CAB with critique and revision from PAP, ND, KK and AG. All authors contributed to and approved the final manuscript.

Acknowledgements

The authors thank Michael Alifrangis for the P. vivax positive control samples.

WHO. World Malaria Report 2019. World Health Organisation; 2019.
Mendes C, Dias F, Figueiredo J, Mora VG, Cano J, de Sousa B, et al. Duffy negative antigen is no longer a barrier to Plasmodium vivax--molecular evidences from the African West Coast (Angola and Equatorial Guinea). PLoS neglected tropical diseases. 2011;5(6):e1192.
WHO. World malaria report, 2016. World Health Organisation; 2016.
Mueller I, Galinski MR, Baird JK, Carlton JM, Kochar DK, Alonso PL, et al. Key gaps in the knowledge of Plasmodium vivax, a neglected human malaria parasite. The Lancet Infectious diseases. 2009;9(9):555-66.
Price RN, Tjitra E, Guerra CA, Yeung S, White NJ, Anstey NM. Vivax malaria: neglected and not benign. The American journal of tropical medicine and hygiene. 2007;77(6 Suppl):79-87.
Alexandre MA, Ferreira CO, Siqueira AM, Magalhaes BL, Mourao MP, Lacerda MV, et al. Severe Plasmodium vivax malaria, Brazilian Amazon. Emerging infectious diseases. 2010;16(10):1611-4.
Miller LH, Mason SJ, Clyde DF, McGinniss MH. The resistance factor to Plasmodium vivax in blacks. The Duffy-blood-group genotype, FyFy. The New England journal of medicine. 1976;295(6):302-4.
Miller LH, Mason SJ, Dvorak JA, McGinniss MH, Rothman IK. Erythrocyte receptors for (Plasmodium knowlesi) malaria: Duffy blood group determinants. Science (New York, NY). 1975;189(4202):561-3.
Parasol N, Reid M, Rios M, Castilho L, Harari I, Kosower NS. A novel mutation in the coding sequence of the FY*B allele of the Duffy chemokine receptor gene is associated with an altered erythrocyte phenotype. Blood. 1998;92(7):2237-43.
Tournamille C, Colin Y, Cartron JP, Le Van Kim C. Disruption of a GATA motif in the Duffy gene promoter abolishes erythroid gene expression in Duffy-negative individuals. Nature genetics. 1995;10(2):224-8.
Miller LH, Aikawa M, Johnson JG, Shiroishi T. Interaction between cytochalasin B-treated malarial parasites and erythrocytes. Attachment and junction formation. The Journal of experimental medicine. 1979;149(1):172-84.
Carvalho TA, Queiroz MG, Cardoso GL, Diniz IG, Silva AN, Pinto AY, et al. Plasmodium vivax infection in Anajas, State of Para: no differential resistance profile among Duffy-negative and Duffy-positive individuals. Malaria journal. 2012;11:430.
Lo E, Yewhalaw D, Zhong D, Zemene E, Degefa T, Tushune K, et al. Molecular epidemiology of Plasmodium vivax and Plasmodium falciparum malaria among Duffy-positive and Duffy-negative populations in Ethiopia. Malaria journal. 2015;14:84.
Woldearegai TG, Kremsner PG, Kun JF, Mordmuller B. Plasmodium vivax malaria in Duffy-negative individuals from Ethiopia. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2013;107(5):328-31.
Menard D, Barnadas C, Bouchier C, Henry-Halldin C, Gray LR, Ratsimbasoa A, et al. Plasmodium vivax clinical malaria is commonly observed in Duffy-negative Malagasy people. Proceedings of the National Academy of Sciences of the United States of America. 2010;107(13):5967-71.
Ryan JR, Stoute JA, Amon J, Dunton RF, Mtalib R, Koros J, et al. Evidence for transmission of Plasmodium vivax among a duffy antigen negative population in Western Kenya. The American journal of tropical medicine and hygiene. 2006;75(4):575-81.
Wurtz N, Mint Lekweiry K, Bogreau H, Pradines B, Rogier C, Ould Mohamed Salem Boukhary A, et al. Vivax malaria in Mauritania includes infection of a Duffy-negative individual. Malaria journal. 2011;10:336.
Fru-Cho J, Bumah VV, Safeukui I, Nkuo-Akenji T, Titanji VP, Haldar K. Molecular typing reveals substantial Plasmodium vivax infection in asymptomatic adults in a rural area of Cameroon. Malaria journal. 2014;13:170.
Ngassa Mbenda HG, Das A. Molecular evidence of Plasmodium vivax mono and mixed malaria parasite infections in Duffy-negative native Cameroonians. PloS one. 2014;9(8):e103262.
Bernabeu M, Gomez-Perez GP, Sissoko S, Niambele MB, Haibala AA, Sanz A, et al. Plasmodium vivax malaria in Mali: a study from three different regions. Malaria journal. 2012;11:405.
Poirier P, Doderer-Lang C, Atchade PS, Lemoine JP, de l'Isle MC, Abou-Bacar A, et al. The hide and seek of Plasmodium vivax in West Africa: report from a large-scale study in Beninese asymptomatic subjects. Malaria journal. 2016;15(1):570.
Howes RE, Patil AP, Piel FB, Nyangiri OA, Kabaria CW, Gething PW, et al. The global distribution of the Duffy blood group. Nature communications. 2011;2:266.
Russo G, Faggioni G, Paganotti GM, Djeunang Dongho GB, Pomponi A, De Santis R, et al. Molecular evidence of Plasmodium vivax infection in Duffy negative symptomatic individuals from Dschang, West Cameroon. Malaria journal. 2017;16(1):74.
Culleton RL, Mita T, Ndounga M, Unger H, Cravo PV, Paganotti GM, et al. Failure to detect Plasmodium vivax in West and Central Africa by PCR species typing. Malaria journal. 2008;7:174.
Abuaku B, Duah N, Quaye L, Quashie N, Koram K. Therapeutic efficacy of artemether-lumefantrine combination in the treatment of uncomplicated malaria among children under five years of age in three ecological zones in Ghana. Malaria journal. 2012;11(1475-2875 (Electronic)).
Duah NO, Quashie NB, Abuaku BK, Sebeny PJ, Kronmann KC, Koram KA. Surveillance of molecular markers of Plasmodium falciparum resistance to sulphadoxine-pyrimethamine 5 years after the change of malaria treatment policy in Ghana. The American journal of tropical medicine and hygiene. 2012(1476-1645 (Electronic)).
Duah NO, Wilson M, Ghansah A, Abuaku B, Edoh D, Quashie N, et al. Mutations in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance genes, and treatment outcomes in Ghanaian children with uncomplicated malaria. J Trop Pediatr. 2007;53(0142-6338 (Print)):27-31.
Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol. 1993;58(0166-6851 (Print)):283-92.
Alves RT, Póvoa MM, Goldman IF, Cavasini CE, Rossit AR, Machado RL. A new polymerase chain reaction/restriction fragment length polymorphism protocol for Plasmodium vivax circumsporozoite protein genotype (VK210, VK247, and P. vivax-like) determination. Diagn Microbiol Infect Dis 2007;59(0732-8893 (Print)):415-9.
Olsson ML, Hansson C, Avent ND, Akesson IE, Green CA, Daniels GL. A clinically applicable method for determining the three major alleles at the Duffy (FY) blood group locus using polymerase chain reaction with allele-specific primers. Transfusion. 1998;38(0041-1132 (Print)):168-73.
Ba H, Duffy CW, Ahouidi AD, Deh YB, Diallo MY, Tandia A, et al. Widespread distribution of Plasmodium vivax malaria in Mauritania on the interface of the Maghreb and West Africa. Malaria journal. 2016;15:80-.
Rogier E, Moss DM, Chard AN, Trinies V, Doumbia S, Freeman MC, et al. Evaluation of Immunoglobulin G Responses to Plasmodium falciparum and Plasmodium vivax in Malian School Children Using Multiplex Bead Assay. 2017(1476-1645 (Electronic)).
He X, Pan M, Zeng W, Zou C, Pi L, Qin Y, et al. Multiple relapses of Plasmodium vivax malaria acquired from West Africa and association with poor metabolizer CYP2D6 variant: a case report. BMC Infect Dis. 2019;19(1):704-.
Yan L, Fu Q, Jin L, Li L. Duffy blood group phenotypes and genotypes in Chinese. Transfusion. 2001;41(7):970-.
Li Y, Wang G, Sun D, Meng F, Lin S, Hu X, et al. A case of Plasmodium ovale wallikeri infection in a Chinese worker returning from West Africa. Korean J Parasitol. 2013;51(5):557-62.
Collins WE, Jeffery GM. Plasmodium ovale: parasite and disease. Clin Microbiol Rev. 2005;18(3):570-81.
Rosenberg R. Plasmodium vivax in Africa: hidden in plain sight? Trends in parasitology. 2007;23(5):193-6.
Howes RE, Reiner RC, Jr., Battle KE, Longbottom J, Mappin B, Ordanovich D, et al. Plasmodium vivax Transmission in Africa. PLoS neglected tropical diseases. 2015;9(11):e0004222.
Ayorinde AF, Oyeyiga AM, Nosegbe NO, Folarin OA. A survey of malaria and some arboviral infections among suspected febrile patients visiting a health centre in Simawa, Ogun State, Nigeria. J Infect Public Health. 2016;9(1):52-9.
Oboh MA, Badiane AS, Ntadom G, Ndiaye YD, Diongue K, Diallo MA, et al. Molecular identification of Plasmodium species responsible for malaria reveals Plasmodium vivax isolates in Duffy negative individuals from southwestern Nigeria. Malaria journal. 2018;17(1):439-.
Ba H, Ahouidi AD, Duffy CW, Deh YB, Diedhiou C, Tandia A, et al. [Evaluation of malaria rapid diagnostic test Optimal-IT(R) pLDH along the Plasmodium falciparum distribution limit in Mauritania]. Bull Soc Pathol Exot. 2017;110(1):31-7.
Niangaly A, Karthigayan G, Amed O, Coulibaly D, Sa JM, Adams M, et al. Plasmodium vivax Infections over 3 Years in Duffy Blood Group Negative Malians in Bandiagara, Mali. The American journal of tropical medicine and hygiene. 2017;97(3):744-52.
Twohig KA, Pfeffer DA, Baird JK, Price RN, Zimmerman PA, Hay SI, et al. Growing evidence of Plasmodium vivax across malaria-endemic Africa. PLoS neglected tropical diseases. 2019;13(1):e0007140-e.
Sundararaman SA, Liu W, Keele BF, Learn GH, Bittinger K, Mouacha F, et al. Plasmodium falciparum-like parasites infecting wild apes in southern Cameroon do not represent a recurrent source of human malaria. Proceedings of the National Academy of Sciences of the United States of America. 2013;110(17):7020-5.
Livingstone FB. The Duffy blood groups, vivax malaria, and malaria selection in human populations: a review. Hum Biol. 1984;56(3):413-25.
Gunalan K, Lo E, Hostetler JB, Yewhalaw D, Mu J, Neafsey DE, et al. Role of Plasmodium vivax Duffy-binding protein 1 in invasion of Duffy-null Africans. Proceedings of the National Academy of Sciences of the United States of America. 2016;113(22):6271-6.
de Carvalho GB, de Carvalho GB. Duffy Blood Group System and the malaria adaptation process in humans. Revista Brasileira de Hematologia e Hemoterapia. 2011;33(1):55-64.
Gruszczyk J, Kanjee U, Chan LJ, Menant S, Malleret B, Lim NTY, et al. Transferrin receptor 1 is a reticulocyte-specific receptor for Plasmodium vivax. Science (New York, NY). 2018;359(6371):48-55.
Malleret B, El Sahili A, Howland SW, Suwanarusk R, Ong ASM, Kosaisavee V, et al., editors. CD98 is a Plasmodium vivax receptor for human reticulocytes. Proceedings of International Conference on Plasmodium vivax; 2018; Campinas : GALOÁ.

Download PDF

Journal Publication

published 17 Feb, 2021

Read the published version in Malaria Journal →

Review #2 received at journal
14 Oct, 2020
Editorial decision: Major Revision
14 Oct, 2020
Review #1 received at journal
07 Oct, 2020
Reviewer #2 agreed at journal
06 Oct, 2020
Reviewer #1 agreed at journal
04 Oct, 2020
Reviewers invited by journal
25 Sep, 2020
Editor assigned by journal
23 Sep, 2020
Submission checks completed at journal
22 Sep, 2020
Editor invited by journal
22 Sep, 2020
First submitted to journal
18 Sep, 2020

You are reading this latest preprint version

High frequency of the Duffy-negative genotype and absence of Plasmodium vivax infections in Ghana

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Study areas

Sampling

DNA extraction

Detection and identification of Plasmodium species

Genotyping of Pvcsp genes

Duffy blood group genotyping by PCR-SSP

Results

Discussion

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Funding

Authors' contributions

Acknowledgements

References

Status:

Journal Publication

Version 1