2.1. Luciferase reporter assay
The reporter construct (GAL4)5-TK-LUC and the GAL4-DBD-BCL6BTB expression plasmid were kindly provided by Dr. Ari Melnick (Weill Cornell Medical College, Department of Haematology/Oncology, New York, NY, USA.) A TK-Renilla luciferase plasmid was included as an internal control (Promega, WA, USA). 293T cells were cotransfected with (GAL4)5-TK-LUC and GAL4-DBD-BCL6BTB or GAL4-DBD plus a TK-Renilla reporter construct using Lipofectamine 2000 (Thermo Fisher Scientific). After transfection for 6 h, the cells were treated with the compounds for 24 h. A dual luciferase assay was performed according to the manufacturer’s guidelines (Promega, WA, USA).
2.2. BCL6 Protein and SMRT Peptide
The DNA segment coding for the BCL6 BTB domain (5-129) with mutations in C8Q, C67R and C84N was cloned into a vector containing a C-terminal GST tag. The construct was expressed in E. coli BL21 (DE3), and the culture was incubated at 18 ℃ with 0.5 mM IPTG for 18 h. BCL6BTB protein was purified by glutathione agarose resin and dialyzed with PBS. The peptide SMRT (1414–1430) with a 6His tag was synthesized by Abace Biology Company.
2.3. Homogenous Time Resolved Fluorescence (HTRF) Assay
The HTRF assay in 384-well plates (Greiner Bio-one, 784045) was performed according to the manufacturer’s instructions (Cisbio). Briefly, a total volume of 8 µL of BCL6-GST protein and 6His-SMRT peptide were added to each well, and then 2 µL of diluent buffer with the compounds to be tested was added. After 1 h, a total volume of 10 µL of anti-6His-XL665 (Cisbio) and anti-GST-Tb (Cisbio) was added to reach a 20 µL final volume. After overnight incubation, the plate was read on a microplate reader (BioTek Cytation5) at 665 nm and 620 nm.
2.4. Surface plasmon resonance (SPR) Assay
A Biacore T200 instrument (GE Healthcare) equipped with a CM5 sensor chip (GE Healthcare) was used to monitor binding interactions via SPR. The BCL6BTB protein was immobilized on CM5 using amine-coupling at a flow rate of 10 µL/min in 10 mM sodium acetate buffer (pH 4.0). Then, 0.1 mg/mL BCL6 BTB protein was injected for 420 s, and the surface was blocked by 1 M ethanolamine. The kinetics and affinity studies were performed in 25 mM HEPES, pH 7.5, 150 mM NaCl, 0.05% (v/v) Tween-20 and 5% DMSO at 25°C. Various concentrations of compounds were injected into the flow system. Data analysis was performed using Biacore T200 Plus Evaluation Software (GE healthcare).
2.5. Cell culture and animals
Various cell lines were used including: 293T, SUDHL4, SUDHL6, OCI-Ly7, Farage, DOHH2, NCM460, PNT1A, LO2 and HAF. The cell lines SUDHL4, SUDHL6, Farage, NCM460, LO2, HAF and 293T were purchased from ATCC. OCI-Ly7 and DOHH2 were obtained from the DSMZ German collection of microorganisms and cell cultures and PNT1A was obtained from the ECACC. SUDHL4, SUDHL6, Farage, DOHH2, NCM460, PNT1A and LO2 were grown in RPMI-1640 medium (Gibco), and OCI-Ly7 was maintained in IMDM (Gibco). 293T cells were cultured in DMEM, and HAF cells were grown in DMEM with 2 mM glutamine. The medium was supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco). All cells were incubated at 37 ℃ in a humidified atmosphere with 5% CO2.
All animals were obtained from the Animal Centre of East China Normal University. All procedures involving animals were approved by the Animal Investigation Committee of the Institute of Biomedical Sciences, East China Normal University.
2.6. Immunofluorescence assay
SUDHL4 cells were exposed to WK500B for 24 h, fixed with 4% paraformaldehyde, permeabilized with 0.3% Triton X-100 and blocked with 1% BSA. The cells were incubated with the antibodies against BCL6 (CST, 14895) and SMRT (Invitrogen, MA1-842) overnight. Cells were then stained with secondary antibodies and DAPI was used to visualize the nuclei. Images were acquired on a confocal microscope (Leica).
2.7. Real-Time Quantitative PCR
SUDHL4 and Farage cells were treated with compounds for 24 h and lysed with TRIzol reagent (Invitrogen). RNA was extracted and reverse transcribed into cDNA with the Prime Script RT Reagent Kit (Takara). The cDNA was then used as the template for the RT-qPCR reaction and the RT-qPCR reaction was performed using SYBR-Green (Takara) on QuantStudio®3 Real-Time PCR System (Applied Biosystems). The sequences of primers used in the study were as follows:
p53: CCCTTCCCAGAAAACCTACC and AATCAACCCACAGCTGCAC,
CDKN1A: CTGAAGGGTCCCCAGGTG and TAGGGCTTCCTCTTGGAGAA,
CXCR4: AGGCCCTAGCTTTCTTCCAC and CTGCTCACAGAGGTGAGTGC,
CD69: CTGGTCACCCATGGAAGTG and CATGCTGCTGACCTCTGTGT,
β-actin: TGAAGTGTGACGTGGACATC and CATACTCCTGCTTGCTGATC.
2.8. Cell Proliferation Assay
Cell viability was tested by an MTS assay (Promega, WA, USA). Cells were seeded in 96-well plates and then treated with the indicated concentrations of compounds for 72 h. Then, 20 µL of MTS was added and incubated at 37°C for 1–2 h. The absorbance at 490 nm was measured by a SpectraMax 190 plate reader, and the IC50 value was calculated using GraphPad Prism. In the drug combination assay, the CI value was calculated by Calcusyn software.
2.9. Cell Cycle Analysis
SUDHL4 cells were treated with WK500B for 24 h. Then, the cells were harvested, washed with PBS and fixed with cold 70% ethanol at 4°C for 12 h. Subsequently, the cells were washed twice with PBS and incubated with 50 µg/mL propidium iodide and 10 µg/mL RNase for 30 min in the dark at room temperature. Cells were stored at 4°C until analysis by flow cytometry (FACS Calibur, BD Biosciences).
2.10. Cell apoptosis assay
SUDHL4 cells were treated with WK500B for 24 h. Cells were collected, washed with PBS resuspended in binding buffer andincubated with Annexin V-FITC and propidium iodide in the dark for 20 min. Samples were analysed immediately by using flow cytometry (FACS Calibur, BD Biosciences).
2.11. Immunization of mice
To induce the GC reaction, 8-week-old male C57BL/6 mice were immunized with 100 µg of 4-hydroxy-3-nitrophenylacetyl (NP)-(Santa Cruz) coupled chicken gamma globulin (CGG) (Cedarlane). Two days later mice were randomly assigned to the indicated groups and treated daily with drugs or vehicle (0.5% methyl cellulose) by intragastric gavage for 12 days. Mice were sacrificed at the peak of the GC response. Spleens were collected for flow cytometry and histology analysis, and serum was processed for ELISA assays.
2.12. GC analysis
Cell suspensions from spleens were prepared by grinding tissue through sterile wire mesh and stained with a panel of fluorescent-conjugated antibodies including PerCP/Cy5.5 conjugated anti-B220 (Biolegend, 103236), FITC-conjugated anti-FAS (BD Pharmingen, 554257), eFluor 660-conjugated anti-GL7 (Invitrogen, 50-5902-82), PerCP/Cy5.5 conjugated anti-CD4 (Biolegend, 100434 ), PE-conjugated anti-CXCR5 (Biolegend, 145504), and APC-conjugated anti-PD1 (Biolegend, 109112). Samples were run on a FACS Calibur (BD), and the data were analyzed with FlowJo software (TreeStar, Portland, OR).
2.13. Immunofluorescence histology
Mouse spleens were frozen in OCT compound (Sakura), and 6 µm-thick cryostat sections were stained with biotin-conjugated peanut agglutinin (Sigma) and IgD (BD Pharmingen) at 4°C overnight followed by incubation with donkey anti-rat IgG(H + L)-Alexa Fluor 488 (Invitrogen) and streptavidin-Cy3 (Biolegend) for 2 h at room temperature. After washing in PBST, the slides were mounted in Prolong Gold anti-fade reagent (Molecular Probes). Images were acquired by a microscope, and ImageJ software (NIH) was used to quantify the GC areas.
2.14. ELISA
Immunoglobulin levels in serum were measured by ELISA. The titres of isotype-specific antibodies were determined for the binding of NP-specific antibodies to NP5-BSA and NP23-BSA on coated plates according to the manufacturer's protocol (Southern Biotech). OD values at 450 nm were measured by a plate reader (BioTek).
2.15. Xenograft tumor growth
The SUDHL4 xenograft tumour models were developed by injecting 1 × 107 cells into male SCID mice (6–8 weeks of age). The mice were grouped randomly when the volume of the tumour nodules reached 100 mm3 and were treated by gavage injection with the indicated compounds or vehicle for 18 days, and the bodyweight and tumour dimensions were measured. The tumour volume was calculated using the following equation: tumour volume = length × width × width × 0.52. At the completion of the study, the mice were euthanized, and tumours and major organs were collected.
2.16. H&E staining and IHC
Tumours and tissue specimens were fixed and embedded in paraffin. Sections were cut from the paraffin blocks. For IHC staining, samples were carried out using the VECTASTAIN ABC kit (Vector). Anti–Ki67 (1:250; Catalogue #ab15580, Abcam) was used as the primary antibody. For H&E staining, samples were stained with haematoxylin and eosin according to standard protocols.
2.17. Statistical analysis
The results are expressed as the mean ± SD. The significance of the difference between two groups was analysed by Student’s t test. For animal experiments, data were analysed by two-way ANOVA. All experiments were performed at least three times, except for the animal experiments. All statistical analyses were carried out using GraphPad Prism 5.0 software. The significant differences in the means were determined at the level of *P < 0.05, ** P < 0.01 and ***P < 0.001.