1. Patients and specimens
96 cases of primary OSCC tissue samples were recruited from 2010–2015 from patients treated with surgery at the Department of Oral and Maxillofacial Surgery, the Affiliated Stomatological Hospital of Nanjing Medical University: 59 were male (61.46%) and 37 were female (38.54%), with an average age of 60.4 years (range, 35–91 years). The primary tumors were located in the tongue (n = 32), gingiva (n = 21), buccal mucosa (n = 26), and other sites (n = 17), such as the palate, lower lip, jaw, soft palate, oropharynx, or floor of the mouth. All patients underwent extensive resection of the primary tumor and underwent classic radical neck dissection or selective regional lymph node dissection. None of the patients had received chemotherapy or radiotherapy before the surgery. All patients had complete clinical data and clear pathological diagnosis, including sex, age, tumor location, tumor size, lymph node metastasis, distant metastasis, pathological grade, clinical stage, postoperative recurrence, survival and follow-up information. Clinical stage and TNM classification were defined by the International Union Against Cancer (UICC) and the American Joint Commission on Cancer (AJCC). The pathological classification was based on the World Health Organization (WHO) criteria. This study was approved by the ethics committee of Nanjing Medical University and was conducted in accordance with the World Medical Association Declaration of Helsinki. Written informed consent was obtained from all the patients.
2. Immunohistochemical staining
Formalin-fixed, paraffin-embedded primary OSCC tissue specimens were cut into 4µm-thick sections, cleared with xylene, and rehydrated through a graded alcohol series. After antigen retrieval and blocking, the sections were incubated overnight with antibodies against LOX (1:100; Abcam, Cambridge, MA, USA) and α-SMA (1:200; Abcam). All sections were then incubated with HRP-polymer anti-rabbit Kit and a DAB Detection Kit (Maixin Biotech, Fuzhou, China) followed by counterstaining with hematoxylin. The sections were dehydrated in gradient alcohol, clarified in xylene, mounted with neutral gum.
3. Evaluation of immunoreactivity
The staining intensity of tissue sections was individually evaluated by two pathologists who were blinded to the patients' clinical data. Immunoreactivity of LOX and α-SMA in tumor stroma was estimated according to the classification system described by Fuji et al. (Fujii et al., 2012): 0, negative (no staining); 1, sparse (a small population of discrete stained fibroblasts); 2, focal (irregular and intermittent areas of stained fibroblasts); and 3, abundant (widespread and consecutive areas of stained fibroblasts). The specimens were categorized into two subgroups according to immunoreactivity score: low expression (0–1) and high expression (2–3).
4. Fibroblast isolation and preparation of conditioned media
Fresh oral cancer tissues and matched normal tissues were collected under sterile conditions. All samples were obtained with informed consent from the patients, and the fibroblast isolation protocol was approved by the Nanjing Medical University Ethics Committee. All tissue samples were snap-frozen in liquid nitrogen and stored at -80°C until fibroblast isolation. Fresh tissues were washed with PBS (penicillin 100 U/mL, streptomycin 100 µg/mL) three times and cut into approximately 1 mm3 size. The tissues were spread evenly on the culture dish and placed upside down in a primary incubator for 4 h to adhere. The tissues were maintained in DMEM (Gibco, Grand Island, NY, USA) with 15% FBS (Gibco) for 1–2 weeks. Purified fibroblasts were obtained by differential enzyme digestion and maintained in DMEM with 10% FBS. Cells were seeded into T-25 culture flasks and grown in 5 ml serum-free media for 48 h until the cells were approximately 80% confluent. Conditioned media were collected and centrifuged at 2000 rmp for 30 min to remove cellular debris.
5. Cell culture
HNSCC cell lines Cal27 and HN6 were used. Cal27 and HN6 cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). All cancerous cell lines were maintained in Dulbecco's modified Eagle’s medium (DMEM)/F12 (Invitrogen) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin at 37°C in a 5% CO2-humidified incubator. All cells were routinely tested for mycoplasma at regular intervals throughout the whole course of the study. To inhibit of FAK phosphorylation, cells were treated with FAK inhibitor 14 (FAKi, Santa Cruz Biotechnology, Santa Cruz, CA, USA) at different concentrations.
6. Lentiviral construct and transfection
Human LOX-encoding lentiviral vectors were constructed by GeneChem Co., Ltd (Shanghai, China). CAFs cells were transfected with a specific shRNA lentivirus targeting LOX knockdown, and the scrambled sequence was co-transfected as a negative control. All transfection procedures were performed according to the manufacturer’s instructions. Cells in the control group (CAFs-shNC) and the experimental group (CAFs-shLOX) were cultured at 37°C in a 5% CO2 incubator and changed to complete medium 12–16 h after transfection. Stable cells were selected using 2 mg/ml puromycin. Fluorescence microscopy was used to observe transfection efficiency, and real-time polymerase chain reaction (PCR) and western blot were used to estimate the efficiency of LOX knockdown.
7. RNA isolation and quantitative reverse transcription-quantitative PCR (qRT-PCR)
Total RNA was extracted from cells with TRIzol reagent (Invitrogen) and equal quantities of cDNA were reverse transcribed using Superscript (Vazyme, Nanjing, China) according to the manufacturer’s instructions. qPCR was performed using the PCR System 7900 (Applied Biosystems, Foster City, CA, USA) with SYBR Green Master Mix (TaKaRa, Shiga, Japan). The primers for GAPDH were: forward 5’-GAAGGTGAAGGTCGGAGTC-3’ and reverse 5’- GAGATGGTGATGGGATTTC-3’; LOX: forward 5’- TTCTTACCCAGCCGACCAAGATA-3’ and reverse 5’- GTGTTGGCATCAAGCAGGTCA-3’; α-SMA: forward 5’- CTGGCCGAGATCTCACTGACTA-3’ and reverse 5’- GCCCATCAGGCAACTCGTAA-3’; FAP: forward 5’- GACCCACGCTCTGAAGACAGAATTA-3’ and reverse 5’- AGCAGAGGTGGCAACTCCAAATAC-3’; FSP-1: forward 5’- CAGATAAGCAGCCCAGGAAGA-3’ and reverse 5’- AAGGAGCCAGGGTGGAAAA-3’; E-cadherin: forward 5’- TACACTGCCCAGGAGCCAGA-3’ and reverse 5’- TGGCACCAGTGTCCGGATTA-3’; N-cadherin: forward 5’- TGGACCATCACTCGGCTTA − 3’ and reverse 5’- ACACTGGCAAACCTTCAC − 3’ ; vimentin: forward 5’- TGAGTACCGGAGACAGGTGCAG − 3’ and reverse 5’- TAGCAGCTTCAACGGCAAAGTTC − 3’. The following program was performed using a two-step cycling protocol: an initial denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 31 s. Each sample in each experiment was performed in triplicate and the results were expressed as the mean of three independent experiments. Relative expression levels of related genes were quantified and compared to the internal control GAPDH and analyzed using the 2-ΔΔCT method.
8. Protein extraction and nuclear, cytoplasmic protein fractionation
Protein extraction was performed using common methods. Briefly, cells were lysed with an appropriate radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Shanghai, China) containing protease inhibitor cocktail and phosphatase inhibitor cocktail (Beyotime, Shanghai, China), incubated for 15 min at 4°C, and scraped using a cell scraper. For cells cultured on collagen, cells were agitated on a rocking platform at 4°C for 30 min and then removed the lysis buffer. Nuclear and cytoplasmic proteins were isolated using the Invent Nuclear and Cytoplasmic Extraction Reagents Kit (Invent Biotechnologies, Plymouth, MN, USA) according to the manufacturer’s instructions.
9. Western blot assay
Western blot assays were performed according to the common methods. Briefly, equal amounts of protein samples were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 5% skimmed milk at room temperature for 2 h and incubated at 4°C overnight with primary antibodies against β-actin as a control (1:500; Proteintech), α-SMA (1:200; Abcam), FSP-1 (1:1000; Abcam), FAP (1:800; Abcam), LOX (1:1000; Abcam), E-cadherin (1:1000; CST), N-cadherin (1:1000; CST), vimentin (1:500; Santa Cruz Biotechnology), and Snail (1:500; Abcam), β-catenin (1:1000; CST), FAK (1:1000, CST), p-FAK(Tyr397) (1:1000, CST), c-myc (1:500, CST), cyclin D1 (1:500, CST), Lamin B1 (1:1000, CST) followed by incubation with ant-goat immunoglobulin G (IgG) horseradish peroxidase (HRP)-conjugated secondary antibodies (Zhongshan Golden Bridge Bio, Beijing, China) for 45 min at room temperature. The protein bands were detected using ECL chemiluminescence reagents (Millipore) and visualized using the ImageQuant LAS4000 Mini Imaging System (General Electrics, Louisville, Kentucky). Analyses of the bands were performed using ImageJ software.
10. Cell proliferation assay
Cell proliferation was assessed by CCK-8 cell assay (Cell Counting Kit-8, Dojindo, Japan). Cells (3×103 cells/well) were seeded into 96-well plates, and 10 µl CCK-8 reagent was added to each well 2–4h before testing at the same time. Cell viability was determined at 0, 1, 2, 3 and 4 days after cell attachment. Three parallel repeats were performed for each sample in each experiment and the results were expressed as the mean of three independent experiments.
11. Cell migration and invasion assays
Cell migration and invasion assays in vitro were performed using wound healing and transwell assays. For the wound healing assay, cells were plated in six-well plates and grown to 90% confluence. Artificial wounds were created with a 200 µl sterile pipette tip across the cell surface and then the cells were incubated with CM to migrate into the open area. Images of the same area of the wound were taken at 0,12 and 24 h to determine the wound closure. Cell invasion assays were performed using 8 µm pore size transwell chambers (Miliipore) whose upper chamber was precoated with Matrigel (Corning, Bedford, MA, USA). For the migration assays, there was no matrigel in the upper chamber. Approximately 1 × 105 cells per well were seeded in the upper chambers and incubated with CM in the lower chamber. After 24 h, the transwell chambers were fixed with 4% PFA and stained with crystal violet (Sigma-Aldrich, St. Louis, MO, USA). Cells attached to the lower layer were imaged (Olympus, Tokyo, Japan) and counted in randomly selected fields.
12. Preparation of collagen matrix
For the fibroblast-modified collagen, fibroblasts were resuspended in FBS, and type I collagen, 5 × DMEM and reconstitution buffer (50 mmol/L NaOH, 260 mmol/L NaHCO3, and 200 mmol/L HEPES) were sequentially added and evenly mixed. The mixture was spread in a 12-well plate, and the plate was placed in a 5% CO2 incubator at 37°C for 30–60min to solidify. Complete medium was added and the medium was changed every day. For the collagen treated with drugs, 12-well plates were coated with 1.5 mg/ml collagen and placed at room temperature for 30 min followed by incubation at 37°C for 2 h. Human recombinant LOX (huLOX; OriGene, Rockville, MD, USA) was used to induce crosslinking of collagen. Ribose (Sigma-Aldrich, Dorset, UK), which induced crosslinking non-enzymatically, was used as a positive control and BAPN (Sigma-Aldrich, Dorset, UK) was used as an inhibitor of LOX. Then, PBS only (PBS), or PBS containing 150 ng/ml huLOX (huLOX), or 60 mM ribose (ribose), or huLOX combined with 10mM BAPN (huLOX + BAPN) were added to each group and incubated at 37°C for 5 days.
13. Cellular immunofluorescence assay
The cells were grown on collagen gels for 24 h. For F-actin staining, the collagen gels were fixed in 4% PFA for 20 min at room temperature and permeabilized with 0.1% Triton X-100 for 15 min. The gels were then incubated with primary antibody against F-actin (1:100, Beyotime) for 30 min at 37°C. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) (Beyotime, Shanghai, China). Fluorescence images were visualized using a fluorescence microscope (Leica Microsystems, Mannheim, Germany)
14. Determination of matrix stiffness
The relative stiffness of collagen gels, which were modified with fibroblasts, LOX, ribose and BAPN, was measured using a MARS60 microinfrared rheometer (Thermo Fisher, MA, USA) under the following conditions. Briefly, the collagen gels were measured over a range from 0.5–5% strain at a fixed angular frequency of 0.5 rad/s and temperature of 21°C on MARS60 microinfrared rheometer. The output of G’ was recorded for 20 min with a data point obtained every 60 s. The samples were found to be only minimally frequency dependent within the range of testing and showed a linear viscoelastic response within the strain range evaluated.
15. Three-dimensional coculture system
Fibroblast-modified collagen was prepared as previously described. Cal27 cells were resuspended in the mixed medium and then seeded onto the surface of the solidified gel to create a 3D co-culture system with CAFs. The culture medium was changed daily. After 3 days, the collagen gels were transferred to the scaffold in six-well plates for culture at the air-liquid interface. At the specific time point, the gels were fixed with 4% PFA, embedded in paraffin, and cut into 4 µm sections for H&E staining.
16. Statistical analysis
The correlation of α-SMA and LOX expression with clinicopathological parameters was analyzed using ANOVA, the chi-square test, Fisher’s exact test, and Mann-Whitney test. Spearman's correlation analysis was used to estimate the correlation between α-SMA and LOX in the tumor stroma. The results are represented as the means ± SEM or as specified in the figure legends. The data were analyzed using SPSS 18.0 and Prism 7 software (GraphPad Software, La Jolla, CA, USA). Comparisons between the two groups were analyzed using the 2-tailed, unpaired Student’s t test. Comparisons among the three groups were performed using one-way ANOVA followed by Tukey’s multiple comparisons test. Adjusted values of P < 0.05 were considered significant.