Expression of Glycogenic Genes in the Oviduct of Chinese Brown Frog (Rana Dybowskii) During Pre-Hibernation

doi:10.21203/rs.3.rs-829182/v1

Download PDF

Research

Expression of Glycogenic Genes in the Oviduct of Chinese Brown Frog (Rana Dybowskii) During Pre-Hibernation

https://doi.org/10.21203/rs.3.rs-829182/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: The oviduct of Chinese brown frog (Rana dybowskii) expands specifically during pre-hibernation. However, the underlying molecular mechanism remains unclear.

Results: This study investigated the mRNA and protein expression levels of glycogenic genes in the oviduct of Rana dybowskii during the breeding season and pre-hibernation. Morphological studies revealed increased weight and enlarged diameter of the oviduct in pre-hibernation. Furthermore, significantly increased glycogen level was detected in the oviduct during pre-hibernation when compared to the breeding season. Transcriptome analysis further identified that the differentially expressed genes in the synthesis and metabolism pathways of carbohydrates in the oviduct during pre-hibernation. The relative mRNA levels of glycolysis and glycogenesis-related genes were up-regulated, while gluconeogenesis-related genes were down-regulated during pre-hibernation. Also, Western blot showed that glucose transporter and glycogen synthesis-related proteins, such as total-GYS, and p-GSK-3β were highly expressed in the oviduct during pre-hibernation. In addition, immunohistochemical data showed that glucose transporter and total-GYS, p-GYS, total-GSK-3β and p-GSK-3β related to glycogen synthesis were both expressed regionally in the oviduct of Rana dybowskii during the breeding season and pre-hibernation.

Conclusions: The data suggests that carbohydrate metabolism plays an important role in the hibernation process of Rana dybowskii, and provides a new insight into the mechanism underlying the expansion of the oviduct of Rana dybowskii during pre-hibernation.

Animal Science

Biotechnology and Bioengineering

Glycogen synthesis

Oviduct

Pre-hibernation

Rana dybowskii

Hibernation is an animal's survival strategy which allows it to face low temperatures and food limitations in cold winters [1]. During hibernation, the animal’s metabolic energy is mainly derived from glycogen and fat, which are stored as fuel sources in the body. Previous studies have revealed the alteration of the proteins and enzymes related to the regulation of carbohydrate metabolism during hibernation, and that changes in carbohydrate metabolism during this process [2]. In particular, the glucose uptake rate is increased during hibernation, so as to maintain the basic glycaemia [3]. In general, glucose homeostasis is strictly controlled, so as to meet the energy needs of the vital organs and maintain personal health, by regulating various glucose metabolism pathways such as glycogenesis, glycogenolysis, glycolysis and gluconeogenesis [4].

Glucose, as an important energy resource for most mammals, acts by a process of facilitative diffusion mediated by members of the glucose transporter (GLUT) family of membrane transport proteins. At present, there are 14 subtypes of GLUTs in various human tissues, and GLUT proteins are encoded by the SLC2 genes [5, 6]. Among them, glucose transporter 1 (GLUT1) was the first glucose transporter to be cloned, and is one of the most common membrane transport proteins. In some cell types, such as the plasma membranes of proliferating cells, an increase in glucose uptake depends on the de novo synthesis of GLUT1 protein [7]. Glycolysis is the most time-effective and energy-efficient process for cells to obtain additional energy [6]. Rate-limiting enzymes in glycolysis include phosphofructokinase-1 (PFK-1), which is encoded by the PFKP gene, and liver-type pyruvate kinase (L-PK), encoded by the PK gene and phospho-glucose isomerase (GPI) [4]. Members of the aldolase family are also the key enzymes in the glycolysis process, including ALDOA, ALDOB and ALDOC. Among them, ALDOC has the ability to detect glucose deficiency [8]. Previous studies have shown that ALDOC knockdown inhibits the increase in glucose uptake, glycolysis and cell proliferation in some cell types [9].

During hibernation, the organism typically maintains its own normal blood sugar level through gluconeogenesis, glycogenolysis and glycolysis. Gluconeogenesis is an indispensable regulatory mechanism in such organisms. When the body’s blood sugar level is reduced, it may cause the blood sugar level to reach a normal value, thereby preventing the organism from entering shock or dying as a result of hypoglycemia [10]. In hibernating animals, triacylglycerol is decomposed into glycerol, which can in turn generate glucose through gluconeogenesis [11]. Phosphoenolpyruvate carboxykinase (PEPCK) is known to play a role in the first step of gluconeogenesis. It is highly expressed in gluconeogenic tissues such as the liver and kidney [12]. Recent studies have shown that PEPCK may be the main regulator of tricarboxylic acid cycle (TCA cycle) flux. In addition, PCK is the coding gene of PEPCK-C, which is associated with metabolic diseases such as diabetes, and PCK1 gene mutation can cause excessive gluconeogenesis and output greater amounts of glucose [13, 14]. Glycogen is the main storage form of glucose, a fast and accessible form of energy that can be provided to tissues on demand [15]. In addition, glycogen synthase (GYS) is an essential enzyme in glycogenesis and is encoded by the GYS gene. It catalyzes the extension of glycogen chains, and is regulated by glycogen synthase kinase 3 (GSK-3) [16]. The function of GSK-3 is to inactivate GYS by phosphorylation, thereby inhibiting glycogen synthesis. GSK-3 comprises two types found in animals: GSK3α and GSK3β. GSK3β exists in various tissues of organisms, and is regulated by protein kinase B (Akt) [17–19]. Previous studies have shown that an increased insulin signal activates Akt in cells, thereby suppressing GSK3 and increasing GYS activity during glycogenesis [20, 21]. Phosphoglucomutase (PGM1) is encoded by the PGM gene, and is also a key enzyme in glycogenesis, which can reversibly prepare glucose subunits for glycolysis or glycogenesis, thus exhibiting winter state-specific phosphorylation [22]. The detection of the glucose metabolism gene expression can reflect the level of glucose metabolism in cells.

The Chinese brown frog (Rana dybowskii) is a special hibernating animal, mainly distributed in the forest areas of South Korea, Japan, eastern Siberia and northeastern China [23]. Affected by latitude and altitude, the hibernation of Rana dybowskii ranges from November to March of the following year, and the breeding season is from February to June [24]. Interestingly, some studies have observed that the oviduct of Rana dybowskii expands specifically during pre-hibernation. Due to the low oxygen intake during hibernation, hibernating animals obtain energy through anaerobic glycolysis during this period, thus resulting in the blood glucose level markedly increasing [25, 26]. However, there have been few reports regarding the in-depth study of the glucose metabolic mechanism in Rana dybowskii during hibernation. The present study investigated expression patterns of glycogenic genes in the oviduct of Rana dybowskii during the breeding season and pre-hibernation, thus providing theoretical support to further explain the expansion of Rana dybowskii oviduct during pre-hibernation.

Animals

Adult female Rana dybowskii were obtained in mid-April 2019 (the breeding season, n = 27) and mid-September 2018 (pre-hibernation period, n = 27) from Chinese Brown Frog Breeding Farm in Jilin Province, China. The animals used in the experiments were treated in accordance with the requirements of the National Animal Welfare Legislation. And the experiments were conducted in accordance with Beijing Forestry University standards. Both the left and right oviducts were obtained from Rana dybowskii after administering ether anesthesia. One side of the oviduct was put in the 4% paraformaldehyde solution for 24 hours and then used for histological and immunohistochemical analysis; the other one was stored at -80°C for transcriptome sequencing, total protein, and RNA extraction.

Glycogen content determination

Dehydration of glycogen forms 5-hydroxymethyl furfural under strong acid conditions. 5-hydroxymethyl furfural can react with anthrone and produce blue-green furfural derivatives which have a characteristic absorption peak at 620nm. The glycogen content in oviduct tissues of Rana dybowskii was determined using a Solarbio glycogen content detection kit according to the manufacturer’s instructions, and the absorbance of each treatment was measured using a microplate reader (Bio-Rad, USA).

Histology

The oviduct tissues of Rana dybowskii were dehydrated in ethanol series and xylene, and then embedded in paraffin. Serial sections of 5 µm were mounted on glass slides coated with poly-L-lysine (Sigma, St. Louis, MO, USA) and baked in a drying oven at 37°C for 9 hours. Sections were further stained with hematoxylin-eosin (HE) or Periodic Acid-Schiff (PAS) for histological observation.

Immunohistochemistry

Serial sections of the oviduct tissues were incubated with 10% normal goat serum to reduce background staining. And then the sections were incubated with primary polyclonal antibodies against GLUT1 (bs-20173R, Beijing Bioss Biotechnology Co., China), p-GYS (ab81230, Abcam, Cambridge, UK), total-GYS (bs-2359R, Beijing Bioss Biotechnology Co.), p-GSK-3β (ab145937, Abcam, Cambridge, UK) and total-GSK-3β (bs-0023M, Beijing Bioss Biotechnology Co.) using a 1:200 dilution for 12 h at 4°C. The negative control sections were treated with phosphate-buffered saline. Next, the sections were incubated with secondary antibodies for 30 min at room temperature, goat anti-rabbit IgG (Bioss, China) conjugated with biotin and peroxidase with avidin, followed by visualization with 3,3'-diaminobenzidine solution (Wako, Tokyo, Japan), in 150 mL of 0.05 M Tris-HCl buffer, pH 7.6, plus 30 µL H₂O₂. Finally, the reacted sections for GLUT1, p-GYS, total-GYS, p-GSK-3β, and total-GSK-3β were counterstained with hematoxylin solution (Merck, Tokyo, Japan).

RNA isolation

Total RNA was isolated from the oviduct tissue sample using the Trizol® Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Approximately 0.1g of oviduct tissue was immediately homogenized in 1 mL of Trizol Reagent by ultrasonic crusher. Then the mixture was vigorously shaken for 20–30 s after the addition of 0.2 mL of chloroform and incubated for 3 min at room temperature. Next, the supernatant was transferred to a new tube and 0.8 times the volume of isopropanol (Beijing Hondar collet Technology Co., Beijing, China) was added to it. Finally, samples were placed at room temperature for 8 min and then centrifuged (12000×g) at 4°C for 18 min to precipitate RNA. The RNA pellet was washed twice with 70% ethanol, dried under air naturally, and then dissolved in 50 µl of diethyl procarbonate-treated water. (Beijing Hondar collet Technology Co., Beijing, China).

Quantitative real-time PCR

First-strand complementary DNA (cDNA) was synthesized by reverse transcription using StarScript II First-strand cDNA Synthesis Mix (GenStar, Beijing, China). The cDNA was stored at − 20°C until use. The sequences of the primers for real-time quantitative polymerase chain reaction (Q-PCR) analysis were designed using the Primer 3 program (Table 1). The Q-PCR reactions were carried out in a 20 µL volume and performed with ABI PRISM 7500 Fast Q-PCR (System Applied Biosystems, Foster City, CA, USA). The thermal cycle was as follows: denaturation for 10 min at 95°C, followed by 40 cycles at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 70°C for 30 s. Transcript levels of the target genes were normalized to an endogenous housekeeping gene β-actin and were calculated using the 2^−ΔΔCt method.

Table 1

Oligonucleotide primers used for quantitative Real-Time PCR
Gene	Sequence of primer (5′→ 3′)	Production length (bp)
slc2a	F:ACAAAATGGCCACAACCTGC R:GAGAAGATGGCCAGGACGAG	162
gys	F:CACTCCGGGGACAACCAAG R:CCACTTTGTTGGCCACTTCC	326
gsk3b	F:TCCTTCTTCGATGAGCTGCG R:CGTGCGCAGAACATGCTATT	242
pgm	F:CGGACGATCATGGCACAGAA R:TTCTGCTGGAAGACGGTGAC	107
pfkp	F:ATGTGCCCGGCTCAGATTTC R:AGTAGCCACCCATCGTTTCG	135
aldoc	F:GCTCAGCAGATTGTAGCCGA R:CTCCTCGGTGTTCTCCACAC	105
gpi	F:GGAGCCCGTGTCAACTACAA R:GCCAGGAAGTTGGCCAAAAG	191
pk	F:AATGCTGTACTGGATGGGGC R:CAACTGCCGGTGGAAAATGG	135
pck1	F:CCTGAAAGAGCCCTGCTTCT R:AAGCGCGTGGTTCCTACTC	299
β-actin	F:AACCCTCTTAGAAACCGGCA R:AAGCGTAAAGTGCCAGGTTG	103

Western blotting

Weighed 0.1 g of Rana dybowskii oviduct tissues for two periods respectively, and then homogenized with 1 mL of RIPA solution and 10 µL phenyl-methanesulfonyl fluoride (PMSF) in a homogenizer on ice. The total homogenate was centrifuged at 12,000×g for 5 min at 4°C to obtain the supernatant. Protein extracts were subjected to SDS-PAGE using a 12% separation gel and transferred to a PVDF membrane. The membranes were blocked in 3% bovine serum albumin (BSA) for 1 h at room temperature and incubated overnight at 4°C in one of the following primary antibodies: rabbit anti-GLUT1 (1:500 dilution), rabbit anti-total-GYS (1:400 dilution), rabbit anti-p-GYS (1:400 dilution), rabbit anti-p-GSK-3β (1:400 dilution) and rat anti-total-GSK-3β (1:600 dilution). Secondary incubation of the membrane used a 1:1000 dilution of goat anti-rabbit IgG or goat anti-mouse IgG antibodies conjugated with horseradish peroxidase (HRP) for 1 h at room temperature. Subsequently, the membrane was stained with 10 mg 3,3-diaminobenzidine solution (Wako) in 50 mL phosphate buffer (0.03 M) plus 3µL H₂O₂. β-actin (AM1829B, Abgent Co., San Diego, CA, USA) was used as an endogenous control. Finally, the band intensity was quantified using Quantity One software (ver. 4.5, BioRad Laboratories).

RNA library construction and sequencing

Total RNA from Rana dybowskii oviduct tissues were extracted using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s procedure. The quantity and purity of total RNA were analyzed using a Bioanalyzer 2100 and RNA 6000 Nano LabChip kit (Agilent, Santa Clara, CA, USA) with an RNA integrity number (RIN) scores of > 7.0. To obtain mRNA, some sample of total RNA was used to isolate poly(A) mRNA with a poly(T) oligo-attached magnetic bead (Invitrogen). Then the mRNA was fragmented into small pieces after purification, and the cleaved RNA fragments were reverse-transcribed to create the final cDNA library in accordance with the protocol for the mRNA-Seq sample preparation kit (Illumina, San Diego, CA, USA).

Differentially Expressed Genes (DEGs) identification and annotation

The raw RNA-seq data were filtered to remove adaptor-contaminated and low-quality bases and to obtain clean reads [27]. The filtered reads were aligned and mapped to the reference genome using Hisat 2.0. Genes with an adjusted |log2(fold change)|>1 and p < 0.05 were identified as DEGs. The DEGs underwent enrichment analysis using Kyoto encyclopedia of Genes and Genomes (KEGG) to detect the biological functions and potential pathways, and p < 0.05 was deemed statistically significant.

Statistical analysis

The statistical analysis of the data was carried out by GraphPad Prism 5 software and analyzed using the Student’s t-test. Significance was assigned at p ≤ 0.05.

Morphological and histological changes in Rana dybowskii oviduct

Morphological and histological changes of the oviduct in Rana dybowskii were observed during the breeding season and pre-hibernation (Fig. 1). Compared with the breeding season, the oviduct of Rana dybowskii was significantly enlarged in pre-hibernation (Fig. 1A). The weight and diameter of the oviduct were significantly greater during pre-hibernation than those of the breeding season (Fig. 1B, C and D). The histological results revealed that oviducts were composed of glandular cells (GC), epithelial cells (EC), and tubule lumen (TL). In the breeding season, the nuclei of round shaped-glandular cells were clearly visualized. In contrast, the glandular cells during pre-hibernation became much larger with a lack of obvious boundaries (Fig. 1E and F).

Increased glycogen content in the oviduct during pre-hibernation

Glycogen is a branched polymer of glucose that serves as a repository of energy. The glycogen in the oviduct of Rana dybowskii was localized by the PAS staining (Fig. 2). Glycogen in purple-magenta color was mainly concentrated in epithelial cells during the breeding season, while glycogen was mainly distributed in glandular cells in pre-hibernation (Fig. 2A and B). In addition, the glycogen content in the oviduct of Rana dybowskii during pre-hibernation was significantly higher than that in the breeding season (Fig. 2C).

Transcriptome analysis revealed altered glucose metabolic pathways in the oviduct during pre-hibernation

Transcriptome analysis showed that 41,512 genes were expressed in the oviduct during pre-hibernation (M9), and 91,482 genes were expressed during the breeding season (M4). Among them, a total of 59,814 genes were identified as co-expressed in two periods (Fig. 3A). Visual analysis of a volcano map (Fig. 3B) by imageGP (http://www.ehbio.com/ImageGP/index.php/Home/Index/index.html) showed that there were 4,078 DEGs in the annotated genes of which 1,082 were up-regulated and 2,276 were down-regulated. The KEGG enrichment analysis of DEGs related to glucose metabolism annotated 9 pathways: starch and sucrose metabolism, pyruvate metabolism, pentose phosphate pathway, other glycan degradation, insulin signaling pathway, glycolysis and gluconeogenesis, galactose metabolism, fructose and mannose metabolism and carbon metabolism (Fig. 3C), Among them, there were more DEGs in glycolysis and gluconeogenesis. Furthermore, a heat map (Fig. 3D) showed that the up-regulated DEGs in the oviduct of Rana dybowskii during pre-hibernation were related to the glycolysis pathway, pentose phosphate pathway, pyruvate metabolism pathway, galactose metabolism pathway, fructose and mannose metabolism pathway, and starch and sucrose metabolism pathway, On the other hand, the down-regulated DEGs in the oviduct tissues during pre-hibernation were related to the insulin signaling pathway.

The DEGs involved in glycogen synthesis, glycolysis, and gluconeogenesis were verified by Q-PCR (Fig. 4). The mRNA expression levels of slc2a, gys, and pgm, which were positively related to glycogenesis, were up-regulated. The gene gsk3b, which was negatively related to glycogenesis, was significantly down-regulated in pre-hibernation (Fig. 4A-D). On the other hand, glycolysis-related genes, including pfkp, aldoc, pk, were expressed in both periods, with no significant differences between the breeding season and pre-hibernation. The gpi was significantly increased during pre-hibernation (Fig. 4E-H). In addition, the mRNA expression level of gluconeogenesis-related gene pck1 was significantly decreased in pre-hibernation (Fig. 4I). Taken together, these transcriptome results suggested that up-regulated glycogenesis and glycolysis pathway pathway, and down-regulated gluconeogenesis during pre-hibernation.

Immunolocalization and protein expression of glycogen synthesis related genes

Glycogen synthesis plays an important role in the survival of Rana dybowskii during pre-hibernation. The western blot analysis of glucose transporters GLUT1 and glycogenesis-related proteins, such as total-GYS, p-GYS, total-GSK-3β, and p-GSK-3β protein levels in the oviduct during the breeding season and pre-hibernation were shown in Fig. 7. Bands of approximately 54 kDa, 81 kDa, 85 kDa, 47 kDa, and 47 kDa represented GLUT1, total-GYS, p-GYS, total-GSK-3β, and p-GSK-3β, respectively (Fig. 5A, B and C). The protein expression levels of GLUT1, total-GYS and p-GSK-3β were significantly higher, while the p-GYS was significantly lower in pre-hibernation compared with the breeding season. There was no significant difference in the protein expression level of total-GSK-3β between the two periods.

Immunolocalizations for glucose transporters GLUT1 and total-GYS, p-GYS, total-GSK-3β and p-GSK-3β related to glycogen synthesis were detected in the oviduct of Rana dybowskii during the breeding season and pre-hibernation (Fig. 6). The positive signal of GLUT1 was localized at the cytoplasm of the glandular cells in the oviduct during the breeding season (Fig. 6A), Interestingly, GLUT1 was located in both epithelial and glandular cells during pre-hibernation (Fig. 6B). The expressions of total-GYS was localized in both the epidermal cells and glandular cells of the breeding season and pre-hibernation (Fig. 6C and D). During the breeding season, p-GYS, total-GSK-3β, and p-GSK-3β were highly expressed in the glandular cells, while those immunostaining were only detected in the epithelial cells in pre-hibernation (Fig. 6E-J). There was no immunohistochemical signal found in the negative control (Fig. 6K and L).

The oviduct of Rana dybowskii expands specifically in pre-hibernation, yet the mechanism and cause of the expansion remain unclear. Our study shows for the first time that glycogen is one of the main substances of expansion, which is abundantly present in the glandular cells of the oviduct during pre-hibernation. In addition, we explored the changes in the oviduct during the breeding season and pre-hibernation at the transcriptome level, focusing on carbohydrate metabolism pathways, and also explored the expression and changes of glycogenesis, glycolysis and gluconeogenesis during pre-hibernation. The currently available results of transcriptome analysis in the oviduct of Rana dybowskii have indicated that DEGs mapped into numerous pathways including glucose metabolism pathway by means of enrichment analysis. We focused on the research on the glucose metabolism pathways of Rana dybowskii, which clearly demonstrated the immunolocalization and expression patterns of glucose metabolism-related genes, e.g. slc2a, gys, pgm, gpi in the oviduct of Rana dybowskii during the breeding season and pre-hibernation. The results showed that glucose transporters GLUT1 and glycogenesis-related proteins, such as total-GYS, p-GYS, total-GSK-3β and p-GSK-3β were expressed in different cell types of Rana dybowskii oviduct during the breeding season and pre-hibernation. Western blotting data suggested that the protein levels of GLUT1, total-GYS and p-GSK-3β increased significantly during pre-hibernation. Moreover, the mRNA expression levels of slc2a and glycogenesis-related genes gys and pgm were significantly higher during pre-hibernation than in the breeding season. In addition, the glycolysis-related gene gpi increased, and the gluconeogenesis-related gene pck1 decreased in pre-hibernation. These findings suggested that glucose metabolism may play a key role in the mechanism of Rana dybowski’s oviduct specific expansion during pre-hibernation.

The speed of glucose metabolism depends on the efficiency of glucose uptake by cells in the body, yet glucose does not have the ability to penetrate directly into cells, thus relying on GLUT to enter cells [28]. In the present study, GLUT1 was expressed in epithelial cells and glandular cells during the breeding season and pre-hibernation, and the protein and mRNA levels of GLUT1 were significantly increased in pre-hibernation, which implied that the glucose could enter the oviduct more quickly during pre-hibernation. These findings were similar to those observed in other animals. For example, in Nile tilapia, the expression of GLUT1 is remarkably up-regulated after being fed or injected with glucose [29].

Previous studies have shown that PCNA and c-kit receptor proteins are expressed in the oviduct of Rana dybowskii in pre-hibernation, thus suggesting that the oviduct of Rana dybowskii exhibit proliferation and differentiation effects during pre-hibernation [30]. In the present study, glycogen was mainly distributed in glandular cells during pre-hibernation by PAS staining, and the oviductal weight and pipe diameter of Rana dybowskii increased sharply in pre-hibernation, which suggests that Rana dybowskii may accumulate energy by storing nutrients such as carbohydrates in the oviduct in preparation for winter, and that the specific expansion of the oviduct of Rana dybowskii is related to the storage of glycogen. Excessive glucoses in the organisms generate glycogen through the catalysis of GYS [31]. In the present study, the protein and mRNA levels of GYS were also significantly up-regulated in pre-hibernation, while the protein level of active p-GYS was markedly down-regulated in pre-hibernation, which suggested that the dephosphorylated GYS increased in pre-hibernation, then glucose was catalyzed to produce glycogen. Moreover, the mRNA expression level of gsk3b, which is negatively correlated with glycogen synthesis, was significantly down-regulated in pre-hibernation, while the inactivated p-GSK-3β protein level was remarkably up-regulated in pre-hibernation, thus further indicating that GYS can catalyze glucose to form more glycogen during pre-hibernation. Moreover, the results of this study showed that the glycogen content in the oviduct of Rana dybowskii increased significantly in pre-hibernation, which was approximately three times that of the breeding period. In Bufo gargarizans, the liver glycogen content was the lowest throughout the year during the breeding period, and reached its annual peak in pre-hibernation [32]. Similarly, research on Pseudacris triseriata also revealed that the glycogen levels reached the highest during pre-hibernation in November [33]. In addition, immunohistochemical results showed that total GSK-3β was positively expressed in epithelial cells, yet no positive expression was observed in glandular cells in pre-hibernation, while inactivated p-GSK-3β also had no positive staining in glandular cells in pre-hibernation. This indicated that GSK-3β was almost not expressed in the glandular cells, thus leading to the GYS catalyzing the synthesis of glycogen, while glycogen was accumulated in the glandular cells of the oviduct in pre-hibernation. These findings suggested that GSK-3β was either activated or inactivated in specific cells during different periods, which led to the inactivation or activation of GYS in specific types of cells, thereby ultimately causing glycogen to accumulate in different cells in the oviduct of Rana dybowskii. Combining these data, it is indicated that glycogen accumulates in glandular cells during pre-hibernation, and the rapid increase in glycogen content may be one of the reasons for the specific expansion in the oviduct of Rana dybowskii.

In pre-hibernation, hibernating animals will consume greater amounts of food than non-hibernating animals so as to have sufficient energy sources, and the organism is dominated by glycolysis [34]. Previous studies have reported that, when the temperature gradually decreases during hibernation, the blood sugar level of Rana dybowskii increases, and the levels of liver glycogen and muscle glycogen decrease, thus suggesting that glycogen degradation may be the source of glucose [35]. Studies have also shown that Arctic ground squirrels have a short awakening stage during hibernation, at which time glycogen in the body produces a large amount of glucose, and enter the blood through the cell membrane, so as to provide energy [36]. When the body’s intake of glucose from food is sufficient, then the amount of fructose 1, 6-diphosphate in the body will remain at a high level, activating 6-phosphofructokinase 1 (PFK1) and blocking fructose 1,6-bisphosphatase (FBp), which can accelerate the process of glycolysis and inhibit gluconeogenesis [37]. In the present study, the mRNA levels of glycolysis-related gene gpi were significantly up-regulated during pre-hibernation. At the same time, we observed that the mRNA expression level of the rate-limiting enzyme PEPCK in gluconeogenesis decreased significantly during pre-hibernation. Therefore, our data suggested that the glycolysis of mammals during pre-hibernation was enhanced, and that the process of gluconeogenesis in the oviduct may have been markedly inhibited due to sufficient food intake in the pre-hibernation period of Rana dybowskii.

Our study demonstrates that the volume of glandular cells has increased in the oviduct of Rana dybowskii. In addition, the glycogen was mainly concentrated in the glandular cells, and the level of glycogen was higher during pre-hibernation. The glucose metabolism-related genes (gys, pgm, gpi, pck1) exhibit significant differences in pre-hibernation and the breeding season. These findings suggested that the metabolic substrates used in the oviduct of Rana dybowskii during pre-hibernation may have mainly consisted of carbohydrates. This study provided new insights regarding the specific expansion of the oviduct of Rana dybowskii during pre-hibernation.

GLUT: Glucose transporter; PFK-1: Phosphofructokinase-1;

L-PK: Liver-type pyruvate kinase; GPI: Phospho-glucose isomerase;

PEPCK: Phosphoenolpyruvate carboxykinase; TCA cycle: Tricarboxylic acid cycle;

GYS: Glycogen synthase; GSK-3: Glycogen synthase kinase 3;

PGM1: Phosphoglucomutase; HE: Hematoxylin-eosin;

PAS: Periodic Acid-Schiff; cDNA: Complementary DNA;

Q-PCR: Quantitative polymerase chain reaction; PMSF: Phenyl-methanesulfonyl fluoride;

BSA: Bovine serum albumin; HRP: Horseradish peroxidase;

RIN: RNA integrity number; DEGs: Differentially Expressed Genes;

KEGG: Kyoto encyclopedia of Genes and Genomes; GC: Glandular cells; EC: Epithelial cells; TL: Tubule lumen; PFK1: 6-phosphofructokinase 1; FBp: Fructose 1,6-bisphosphatase

Acknowledgments

Not applicable.

Authors’ contributions

M.X., Q.W., and H.Z. conceived the study; C.F., Y.L., A.Z., and W.X. worked on experiments and performed data analysis; C.F., Q.W., and M.X. wrote the paper. All the authors read and approved the final manuscript.

Funding

This research work was supported by National Natural Science Foundation of China (31872320) and Young Scientist Start-up Funding of Beijing Forestry University (BLX201714).

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

All procedures were reviewed and approved by the Policy on the Care and Use of Animals established by the Ethics Committee of Beijing Forestry University. The author(s) confirmed with the Helsinki Declaration of 1975 (as revised in 2008) concerning Human and Animal Rights, and that they followed out the policy concerning Informed Consent as shown on Springer.com.

Consent for publication

Not applicable.

Competing interests

The author(s) declare that they have no conflict of interest.

Author details

¹College of Biological Science and Technology, Beijing Forestry University, Beijing 100083, China. ²HD Biosciences, a WuXi AppTec company, San Diego CA 92121, USA.

Andrews MT. Advances in molecular biology of hibernation in mammals. BioEssays. 2007;29(5):431-40. https://doi.org/10.1002/bies.20560.
Vella CA, Nelson OL, Jansen HT, Robbins CT, Jensen AE, Constantinescu S, et al. Regulation of metabolism during hibernation in brown bears (Ursus arctos): Involvement of cortisol, PGC-1α and AMPK in adipose tissue and skeletal muscle. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology. 2020;240:110591. https://doi.org/10.1016/j.cbpa.2019.1 10591.
Weitten M, Oudart H, Habold C. Maintenance of a fully functional digestive system during hibernation in the European hamster, a food-storing hibernator. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology. 2016;193:45-51. https://doi.org/10.1016/j.cbpa.2016.01.006.
Han H, Kang G, Kim JS, Choi BH, Koo S. Regulation of glucose metabolism from a liver-centric perspective. Experimental & Molecular Medicine. 2016;48(3):e218. https://doi.org/10.1038/emm.2015.122.
Thorens B, Mueckler M. Glucose transporters in the 21st Century. American Journal of Physiology-Endocrinology and Metabolism. 2010;298(2):E141-5. https://doi.org/10.1152/ajpendo.00712.2009.
Labak CM, Wang PY, Arora R, Guda MR, Asuthkar S, Tsung AJ, et al. Glucose transport: Meeting the metabolic demands of cancer, and applications in glioblastoma treatment. Am J Cancer Res. 2016;6(8):1599-608.
Parra-Abarca J, Rivera-Ramírez N, Villa-Maldonado L, García-Hernández U, Aguilera P, Arias-Montaño J. Histamine H1 and H3 receptor activation increases the expression of Glucose Transporter 1 (GLUT-1) in rat cerebro-cortical astrocytes in primary culture. Neurochemistry International. 2019;131:104565. https://doi.org/10.1016/j.neuint.2019.104565.
Fan K, Wang J, Sun W, Shen S, Ni X, Gong Z, et al. MUC16 C-terminal binding with ALDOC disrupts the ability of ALDOC to sense glucose and promotes gallbladder carcinoma growth. Experimental Cell Research. 2020;394(1):112118. https://doi.org/10.1016/j.yexcr.2020.112118.
Kathagen-Buhmann A, Schulte A, Weller J, Holz M, Herold-Mende C, Glass R, et al. Glycolysis and the pentose phosphate pathway are differentially associated with the dichotomous regulation of glioblastoma cell migration versus proliferation. Neuro-Oncology. 2016;18(9):1219-29. https://doi.org/10.1093/neu onc/now024.
Abdel KM, Abdel K, Ezzat ElD, Safwat O, Abdel HM. Carbohydrate metabolism in Malpolon monspessulanus and Uromastix aegyptius during the entry, deep and arousal phases of hibernation. J Therm Biol . 1995;20(5):367-72. https://doi.org/ 10.1016 /0306-4565(94)00070-Y.
Andrews MT. Genes controlling the metabolic switch in hibernating mammals. Biochemical Society transactions. 2004;32 (6):1021-24.
Liu M, Jin L, Sun S, Liu P, Feng X, Cheng Z et al. Metabolic reprogramming by PCK1 promotes TCA cataplerosis, oxidative stress and apoptosis in liver cancer cells and suppresses hepatocellular carcinoma. Oncogene. 2018;37(12):1637-53. https://doi.org/10.1038/s41388-017-0070-6.
Gómez-Valadés AG, Vidal-Alabró A, Molas M, Boada J, Bermúdez J, Bartrons R et al. Overcoming Diabetes-Induced hyperglycemia through inhibition of hepatic phosphoenolpyruvate carboxykinase (GTP) with RNAi. Molecular Therapy. 2006;13(2):401-10. https://doi.org/10.1016/j.ymthe.2005.08.026.
Mcleod MJ, Krismanich AP, Assoud A, Dmitrienko GI, Holyoak T. Characterization of 3-[(Carboxymethyl)thio]picolinic Acid: A Novel Inhibitor of Phosphoenolpyruvate Carboxykinase. Biochemistry. 2019;58(37):3918-26. https: //doi.org/10.1021/acs.biochem.9b00583.
Prats C, Graham TE, Shearer J. The dynamic life of the glycogen granule. Journal of Biological Chemistry. 2018;293(19):7089-98. https://doi.org/10.1074/ jbc.R117.802843.
Zeng Z, Ni J, Ke C. Expression of glycogen synthase (GYS) and glycogen synthase kinase 3beta (GSK3beta) of the Fujian oyster, Crassostrea angulata, in relation to glycogen content in gonad development. Comp Biochem Physiol B Biochem Mol Biol. 2013;166(3-4):203-14. https://doi.org/10.1016/j.cbpb.2013.0 9.003.
Grimes CA, Jope RS. The multifaceted roles of glycogen synthase kinase 3beta in cellular signaling. Prog Neurobiol. 2001;65(4):391-426. https://doi.org/10.10 16/s0301-0082(01)00011-9.
Frame S, Cohen P. GSK3 takes centre stage more than 20 years after its discovery. Biochem J. 2001;359(1):1-16. https://doi.org/10.1042/0264-6021: 359 0001.
Hemmings BA, Restuccia DF. PI3K-PKB/Akt pathway. Cold Spring Harb Perspect Biol. 2012;4(9):a11189. https://doi.org/10.1101/cshperspect.a011189.
Petersen MC, Vatner DF, Shulman GI. Regulation of hepatic glucose metabolism in health and disease. Nature Reviews Endocrinology. 2017;13(10):572-87. https://doi.org/10.1038/nrendo.2017.80.
Roach PJ, Depaoli-Roach AA, Hurley TD, Tagliabracci VS. Glycogen and its metabolism: Some new developments and old themes. Biochemical Journal. 2012;441(3):763-87. https://doi.org/10.1042/BJ20111416.
Hindle AG, Karimpour-Fard A, Epperson LE, Hunter LE, Martin SL. Skeletal muscle proteomics: Carbohydrate metabolism oscillates with seasonal and torpor-arousal physiology of hibernation. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2011;301(5): R1440-52. https://doi.org/10.1152/ajpregu.00298.2011.
Yang S, Xiao X, Xu Y, Li D, Chai L, Zhang J. Induction of antimicrobial peptides from Rana dybowskii under Rana grylio virus stress, and bioactivity analysis. Canadian Journal of Microbiology. 2012;58(7):848-55. https://doi.org/ 10.1139/w2012-055.
Su H, Zhang H, Wei X, Pan D, Jing L, Zhao D, et al. Comparative Proteomic Analysis of Rana chensinensis Oviduct. Molecules. 2018;23(6):1384. https://doi. org/10.3390/molecules23061384.
Huang D, Yang L, Wang C, Ma S, Cui L, Huang S, et al. Immunostimulatory Activity of Protein Hydrolysate from Oviductus Ranae on MacrophageIn Vitro. Evidence-Based Complementary and Alternative Medicine. 2014;2014:1-11. https://doi.org/10.1155/2014/180234.
Xiao X, Zheng D, Yang C, Chai L. Survival and Metabolic Responses to Freezing Temperature in the Northeast Forest Frog Rana dybowskii. Asiatic Herpetological Research. 2008;11:147-152.
Liu J, Yang L, Hou Y, Soteyome T, Zeng B, Su J, et al. Transcriptomics Study on Staphylococcus aureus Biofilm Under Low Concentration of Ampicillin. Frontiers in Microbiology. 2018;9:2413. https://doi.org/10.3389/fmicb.2018.024 13.
Tanasova M, Fedie JR. Molecular tools for facilitative carbohydrate transporters (Gluts). Chembiochem. 2017;18(18):1774-88. https://doi.org/10.1002/cbic.20170 0221.
Hrytsenko O, Pohajdak B, Xu B, Morrison C, VanTol B, Wright JR. Cloning and molecular characterization of the glucose transporter 1 in tilapia (Oreochromis niloticus). General and Comparative Endocrinology. 2010;165(2):293-303. https://doi.org/10.1016/j.ygcen.2009.07.017.
Shen Y, Liu Y, Ma J, Ma X, Tian Y, Zhang H, et al. Immunoreactivity of c-kit receptor protein during the prehibernation period in the oviduct of the Chinese brown frog, Rana chensinensis. J Vet Med Sci. 2012;74(2):209-13. https://doi.or g/10.1292/jvms.11-0033.
Brunner Y, Schvartz D, Priego-Capote F, Couté Y, Sanchez J. Glucotoxicity and pancreatic proteomics. Journal of Proteomics. 2009;71(6):576-91. https://doi.org/ 10.1016/ j.jprot.2008.10.002.
Feng Z, Ji L, Shi W, Xia X. Seasonal changes of glycogen content in Bufo gargarizans. Dongwu Xuebao. 2007;53:1048-53.
Edwards JR, Jenkins JL, Swanson DL. Seasonal effects of dehydration on glucose mobilization in freeze-tolerant chorus frogs (Pseudacris triseriata) and freeze-intolerant toads (Bufo woodhousii andB. Cognatus). Journal of Experimental Zoology. 2004;301A(6):521-31. https://doi.org/10.1002/jez.a.81.
Chazarin B, Storey KB, Ziemianin A, Chanon S, Plumel M, Chery I, et al. Metabolic reprogramming involving glycolysis in the hibernating brown bear skeletal muscle. Front Zool. 2019;16:12. https://doi.org/10.1186/s12983-019-03 12-2.
Li X. Analysis of glucose in blood and enzyme specific activity of low temperature-stressd Rana dybowskii. Northeast Forestry University; 2012.
Epperson LE, Dahl TA, Martin SL. Quantitative analysis of liver protein expression during hibernation in the golden-mantled ground squirrel. Molecular & Cellular Proteomics. 2004;3(9):920-33. https://doi.org/10.1074/mcp.M40004 2-MCP200.
Han J, Wang Y. Regulation of Hepatic Gluconeogenesis. Zhongguo Xibao Shengwuxue Xuebao. 2019;41:1216–24.

Download PDF

Version 1

posted

You are reading this latest preprint version

Expression of Glycogenic Genes in the Oviduct of Chinese Brown Frog (Rana Dybowskii) During Pre-Hibernation

Status:

Version 1

Abstract

Figures

Background

Methods

Animals

Glycogen content determination

Histology

Immunohistochemistry

RNA isolation

Quantitative real-time PCR

Western blotting

RNA library construction and sequencing

Differentially Expressed Genes (DEGs) identification and annotation

Statistical analysis

Results

Morphological and histological changes in Rana dybowskii oviduct

Increased glycogen content in the oviduct during pre-hibernation

Transcriptome analysis revealed altered glucose metabolic pathways in the oviduct during pre-hibernation

Immunolocalization and protein expression of glycogen synthesis related genes

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1