A Novel p.K116Q SNP in the OLR1 Gene and Its Relation to Fecundity in Awassi Ewes

doi:10.21203/rs.3.rs-832411/v1

Download PDF

Research

A Novel p.K116Q SNP in the OLR1 Gene and Its Relation to Fecundity in Awassi Ewes

https://doi.org/10.21203/rs.3.rs-832411/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 28 Feb, 2022

Read the published version in Theriogenology →

Version 1

posted

You are reading this latest preprint version

Background

Sheep's fecundity is determined by both twinning rate and litter size, both influenced by several genes, one of which is OLR1 (oxidized low-density lipoprotein receptor gene). This study aimed to determine the genetic variation of the OLR1 gene affecting the fecundity traits of Awassi ewes.

Results

Two genotypes of 334-bp amplicons, CC and CA were detected. In a sequence reaction, the novel mutation p.K116Q was discovered in CA genotypes. There was a highly significant (P ≤ 0.01) association between the single nucleotide polymorphism (SNP) and reproductive traits, in that sheep with the p.K116Q SNP had lower litter size, twinning rate, fecundity, and lambing percentages than individuals with CC genotypes. The ewes with CC genotypes had 1.98 lambs more than those with CA genotypes. These observations imply that the missense p.K116Q variant has an adverse effect on the traits under study.

Conclusions

As such, SNP p.K116Q appears to negatively influence fecundity traits in Awassi sheep. The data evidence that the OLR1 gene variant is one of the most important candidates for marker-assisted selection in the sheep industry.

Animal Science

Biotechnology and Bioengineering

Litter size

OLR1

polymorphism

sheep

The fecundity in sheep flocks is an important determinant of profitability [1]. A sheep's fecundity is determined by twinning rate and litter size, which are affected by many different genes [2]. One of these is the oxidized low-density lipoprotein receptor gene (OLR1) [3] that resides in chromosome 3 in sheep and contains 6 exons (Adopted from ncbi.nlm.nih.gov); in chromosome 5 in cattle with 5 exons [4]. This gene encodes OLR1 protein and belongs to the C-type lectin family that functions to absorb and degrade low-density lipoproteins [5], which impacts energy balance, in turn influencing reproductive characteristics [3]. It is also possible that this encoded protein functions to regulate fecundity genes so that the OLR1 gene is involved in sheep fecundity [2].

Several studies have been reported the polymorphism of the OLR1 gene in livestock and its relationship to phenotypic traits. An SNP within the exon and intron regions of the OLR1 gene is associated with phenotypic traits in cattle, according to Komisarek and Dorynek [6] and Fonseca et al. [7]. Furthermore, OLR1 is regarded as a potentially important gene in dairy cattle growth traits [8, 9]. The 3′ untranslated regions of OLR1 (NW_215807: g. 8238C>A) contain a polymorphism associated with the fat content of milk [10]. Besides, the SNP in the bovine OLR1 gene (c. 495 T> C) affects carcass traits, fat accumulation, and growth in Angus, Charolais, and hybrid cattle [11]. The OLR gene is investigated in another study conducted on Dutch Holsteins/Friesians; the results indicated that OLR g.8232C>A significantly affected (P < 0.05) the fat content of milk [12]. A genetic variant in buffalo OLR1 at position 8,232 in the 3′-UTR has been affected by fat content and yield in the Mehsana breed [13]. Additionally, Javed et al. [14] provided evidence of the association between the polymorphisms of the OLR1 gene and growth traits, as well as dairy quality parameters in buffalo. The A/C SNP in the 3′-UTR fragment of the OLR1 gene has been linked to lactational traits in Iranian Holstein cattle [15]. According to a recent study, the bovine OLR1 T10588C and T10647T mutations have significant associations with fat distribution, back fat thickness, and intramuscular fat accumulation [16]. Additionally, there is a relationship between OLR1 gene genetic polymorphism and litter size in Xidu black pigs. The TT genotype exhibited significantly larger litter sizes in comparison to TC and CC genotypes (P< 0.01), indicating that the 7-bp mutation T/C at intron 4 had a significant effect on litter size traits [17]. Considering the aforementioned studies, there has been little research conducted on the impact of genetic polymorphisms in the OLR1 gene on fecundity traits in livestock, and no research on their association with fecundity traits in Awassi sheep.

Animal

Two hundred mature ewes (114 with single progeny and 86 with twins) were used in this study, not pregnant or lactating, and aged between 2.5 and 5 years. Two herding stations (Babylon and Karbala, Iraq) were randomly selected to receive the animals. For the entire year, both grass and concentrated food (2.5 percent of their body weight every day, composed of barley, bran, salt (59%), (40%) and (1%) concentrates, respectively), as well as freshwater, were provided to the animals. Several fecundity traits were recorded at the stations, such as twinning rate, lambing percentage, and litter size. Litter size was determined by dividing the number of lambs born by the number of ewes lambing.

DNA and PCR

In the morning, before feeding the sheep, blood samples were drawn from the jugular vein. A vacutainer tube containing EDTA was used to collect blood for genetic analysis. To extract genomic DNA, a rapid salting-out technique was employed [18]. The amplification of three different regions of the genetic code of OLR1 was achieved using NCBI Primer-BLAST [19], provided by Bioneer (South Korea). A PCR experiment was conducted using Bioneer's PCR premix (50 μM, 10mM, 30mM, 1.5mM for dNTPs, Tris-HCl, KCl, MgCl2, and 1 U Top DNA polymerase). Using the thermal gradient device (Eppendorf, Germany), the best PCR amplification conditions were determined (Table 1). The denaturation was carried out for 4 minutes at 94 °C, followed by 30 cycles of denaturation for 30 seconds, annealing for 45 seconds, and elongation for 30 seconds. Accordingly, the results were verified by electrophoresis of PCR products on agarose gels (1.5%) and determining the gel image with a Chemidoc Gel Imager (Bio-Rad, USA).

SSCP (single-strand conformation polymorphism)

All PCR products were genotyped according to the protocol of Imran et al. [20]. The denaturing-loading buffer (95%, formamide, 0.05% xylene cyanol, and 20 mM EDTA, pH 8) was added to equal volumes for each PCR amplicon. Following 7 minutes of denaturation, the PCR amplicons were transferred onto wet ice and stored for 10 minutes. Using a 0.5 TBE buffer, samples denatured in neutral polyacrylamide gels were loaded on. Subsequently, the gels were electrophoresed for 4 hours at 200mA and 100V at room temperature. To stain the gels, the rapid staining protocol developed by Byun et al. [21] was used.

DNA sequencing and in silico analyses

Following the detection of SSCP bands in polyacrylamide gels, downstream reactions were performed using the methods of sequencing laboratories (Macrogen, Geumchen, Korea). A referring sequence of the OLR1 gene was retrieved from NCBI's website (https://www.ncbi.nlm.nih.gov). A BioEdit ver, 7.1. was used to edit DNA polymorphisms within each detected genotype (DNASTAR, Madison) and visualized using SnapGene Viewer ver. 4.0.4 (http://www.snapgene.com). Amino acid reading frames were detected using the Expasy software [22]. Moreover, a comparison of amino acid sequences was conducted, using UniProtKB, with their corresponding sequences in the OLR1 database (http://www.uniprot.org/align/). Many computational tools were used to predict the structure and function of mutant proteins, including SIFT [23], PolyPhen-2 [24], Provean [25], Panther [26], and PhD SNP [27].

Statistical analyses

Genotype and allele frequency were analyzed by PopGen32, version 1.31 [28]. Using Hardy-Weinberg disequilibrium law, disequilibrium was calculated. According to Botstein et al. [29], polymorphism information content (PIC) was computed. Association analysis of the OLR1 genotypes was performed using IBM SPSS 23.0 (NY, USA), with a general linear model as follows:

Y_ijkl = μ + G_i + P_j + A_k +e_ijkl

Where: Y_ijkl = phenotype characteristics, μ = the mean of all traits, G_i = fixed effect of i^th genotypes (i = CC, AC, AA) P_j = fixed effect of j^th parity (j = 1, 2, 3, 4), A_k = fixed effect of k^th age group (2.5,>2.5-3.5,>3.5-4.5,>4.5-5), and e_ijkl = random residual error. Tukey-Krammer tests were performed to examine differences between means with a level of significance of (P ≤0.05). Reproductive traits of fecundity (the number of lambs weaned per ewe), lambing percentage (the number of lambs born per ewe lambed), and ewe birth type were analyzed using Chi-square test. Based on preliminary analysis, effects of interaction and lambing season were unaffected by the model findings and were excluded.

Genotyping of OLR1 gene

The PCR amplification of three genetic fragments of 334 bp, 291 bp, and 274 bp was performed on the 3 OLR1 coding regions, along with their flanking regions (Fig. 1, A). Although the 291 bp amplification of exon 4 by PCR was designed, PCR experiments turned out to be problematic since agarose gels showed no specific bands. Following this, PCR-SSCP patterns were designed to cover exon 6 exhibited monomorphic electrophoretic migration and no heterogeneity was observed. Furthermore, two distinctive PCR-SSCP patterns were observed in the 334 bp amplicons designed for exon 3 (Fig. 1, B). The sequencing results showed that only one of the SSCP variants carried the C246A SNP, indicating exon 3 heterogeneity. Based on the C246A substitution, the detected SSCP variants were given genotypic values CC for homozygous C/C SSCP variants and CA for heterozygous C/A SSCP variants present at position 246 of PCR amplicons (Fig. 1, C). The Expasy software indicated that a missense (p.K116Q) occurred at the 116^th position of the mature OLR1, where lysine (Lys) was exchanged with glutamine (Glu) (Fig. 1, D). Regarding the genetic diversity of p.K116Q, the genotype CA was predominant with a total frequency of 0.75 (n = 149) and a lower prevalence for the genotype CC with a total frequency of 0.25 (n = 51) (Table 2). However, the Chi-square test showed that polymorphism in the OLR1 gene at the K116Q SNP locus deviated significantly from the HWE (P ≤ 0.05).

In silico prediction of p.K116Q

All used in silico prediction tools were given neutral/non-deleterious signals for p.K116Q. The I-Mutant 2 tool further confirmed that the p.K112Q SNP does not function deleteriously, as it predicted increased stability of OLR1 upon modification of this SNP (Table 3). This non-deleterious effect on the structure, function, and stability of the analyzed protein may be attributed to the noncritical positions that it occupies on the OLR1 protein.

OLR1 gene analysis: statistical results

As such, based on the association analysis of p.K116Q SNP locus with fecundity traits, individuals with CA genotype had significantly (P ≤ 0.01) lower litter size, twinning rate, fecundity, and lambing percentage than individuals with CC genotype (Table 4). In comparison to that of CA genotype ewes, CC ewes had 1.98 lambs. Hence, the missense p.K116Q SNP had a negative impact on these traits.

Polymorphism of OLR1 gene and genetic diversity

The genetic diversity analysis of the OLR1 gene in Awassi ewes revealed that genotype CA was predominant with a total frequency of 0.75 (n = 149) and a lower prevalence for the genotype CC with a total frequency of 0.25 (n = 51). However, the Chi-square test showed that polymorphism in the OLR1 gene at the K116Q SNP locus deviated significantly from the HWE (P ≤ 0.05). Numerous studies have reported polymorphisms in the OLR1 gene in livestock in various regions. In direct genomic sequencing of OLR1, Khatib et al. [8] identified 3 genotypes CC, AC, and AA in Holstein Dairy Cattle with 3′-UTR polymorphism. Using PstI/PCR-RFLP, Komisarek and Dorynek [6] identified 3 genotypes of OLR1 in Polish Holstein-Friesian bulls CC, CT, and TT. Further, Javed et al. [14] revealed the polymorphism in exonic regions of the OLR1 in Nili Ravi buffalo and determined 3 genotypes AA, AB and BB. Furthermore, a single nucleotide polymorphism (SNP) in the promoter region of the OLR1 gene (c.-495 T>C) in hybrid, Angus, and Charolais beef cattle is identified and assigned CC, CT, and TT genotypes [11]. Fonseca et al. [7] genotyped rs109019599 in OLR1 by PCR-RFLP assays and observed in the agarose gel AA (254 bp), CC (269 bp), and AC (269 and 254 bp). Moreover, the identification of OLR1 genotypes in the 3’UTR region of dairy cattle is performed using PCR-RFLP, i.e., AA, AC and CC genotypes [3]. Recently, Anggraeni [4] identified the base mutations of the OLR1 gene at 3'UTR location by PCR-RFLP techniques in Holstein Friesian dairy cattle and found 3 genotypes CC, AC, and AA. The aforementioned studies indicated that no studies have been undertaken on OLR1 genotyping in Awassi sheep. Therefore, this study provides genotypic information and new associations that may prove more useful in selecting sheep and be recommended for measuring functional traits in future marker-assisted selection programs.

Sequencing and in silico analyses of OLR1 gene

By detecting the C246A SNP in only one of the SSCP mutations, a sequencing reaction confirmed the presence of heterogeneity in exon 3 (Fig. 1, C). A p.K116Q SNP was positioned in the 116^th lysine residue of the mature OLR1, where an amino acid substitution occurred from lysine (Lys) to glutamine (Glu) (Fig. 1, D). Some SNPs occur in non-coding regions, whereas others in coding regions [30]. These non-synonymous SNPs modify amino acid sequences when present in a coding sequence (called mutant SNPs), altering protein activity and causing drastic phenotypic changes [31, 32]. The missense mutation can negatively impact function not only by changing the protein's stability but also by interfering with the structure and function of other biological molecules [33]. Additionally, missense mutations can affect a molecule's flexibility and alter its equilibrium or alter the dynamics of its conformation [34]. All the in silico prediction tools used in the current study provided neutral or non-deleted signals for p.K116Q (Table 3). This non-deleterious effect in terms of the structural, functional, and structural stability of the analyzed protein occurs due to its non-critical positions where occupied in this protein. Studer et al. [35] note that mutations can change an organism's phenotype in any way, perhaps with a beneficial, detrimental or neutral effect on its fitness.

Association analyses of OLR1 gene with fecundity traits

This study examined the association between p. K116Q SNP locus and fecundity traits and revealed that individuals with AC genotype had significantly (P≤0.01) lower litter size, twinning rate, fecundity, and lambing percentage compared to CC genotypes (Table 4). As a result, these traits were negatively affected by C246A SNP mutation. In this regard, only one article has addressed the potential association between polymorphisms in the porcine OLR1 gene and litter size. This study showed a T/C mutation at 7bp of intron4 with 3 genotypes TT, TC, and CC. The litter size of TT genotyped piglets is significantly higher than that of TC and CC genotyped piglets [36].

Importantly, the OLR1 degrades the oxidized forms of low-density lipoproteins (ox-LDL) and promotes cholesterol accumulation and adipocyte fatty acid uptake, thereby affecting liver fat metabolism [3, 6]. Although these roles are significant, changes in the lipid profile or fat content could lead to clinical and physiological problems [37]. Thus, by upregulating OLR1, adipocytes increase their total cholesterol content and capacity to absorb free fatty acids (FFA). If the adipocyte's lipid storage capacity is exceeded, it becomes unable to control the release of FFAs into the blood circulation, ultimately resulting in abnormal accumulation of lipid outside the adipocyte [38]. Moreover, excess fatty acids in the ovary generate damage to the cumulus and granulosa cells responsible for normal steroidogenesis in the gonads [39]. Furthermore, the accumulation of intracellular lipids causes high levels of free fatty acids to form, leading to oxidative damage and the production of highly active oxidative metabolites that cause irreversible cellular damage [40]. It has been shown that these metabolic changes can damage oocytes directly or by affecting their follicular environment [41]. Based on these data, OLR1 gene variation causes several damaging aspects on oocytes, which could adversely affect fecundity traits. Consequently, the Awassi breed is characterized by a high level of adaptability to harsh environments [42] with a lower reproductive capacity [43, 44]. The low reproductive rate of this breed is a major concern for many breeders in the Middle East. Further, the low prevalence of the CC genotype with a total frequency of 0.25 (n = 51) in this study is likely to be one of several factors contributing to the low fertility of the Awassi breed.

A novel single nucleotide polymorphism (SNP), p. K116Q, was found in the OLR1 gene (exon 3), in the heterozygous CA genotype. The results of the association analysis between p. K116Q SNP locus and fecundity traits revealed that individuals with the CA genotype had significantly lower litter sizes, ewe birth types, fecundity, and lambing percentages than those with the CC genotype. Twin-producing ewes with CC genotypes showed more measured fecundity traits than single-producing ewes with CC genotypes. In light of these results, OLR1 is a promising candidate gene for sheep marker selection.

Acknowledgements

In acknowledging the sheep stations (Babylon and Karbala) that provided the Awassi ewes, the authors express their gratitude.

Author contribution

Tahreer M. Al-Thuwaini: Conceptualization, writing-original draft, supervision, methodology (lead). Mohammed Baqur S. Al-Shuhaib: Editing, data curation, and investigation (lead). Mohammed M. Mohammed: Methodology (equal).

Data and model availability statement

None of the data were deposited in an official repository but data are available upon request.

Ethics approval

With approval no. 020,7,18 provided by Al-Qasim Green University, this study was conducted from July 2020 to March 2021 and followed the international guidelines for the veterinary care and use of livestock.

Consent for publication

Not applicable.

Conflict of interest statement

None.

Richards JS, Ren YA, Candelaria N, Adams JE, Rajkovic A. Ovarian follicular theca cell recruitment, differentiation, and impact on fertility: 2017 update. Endocrine reviews. 2018; 39(1): 1-20. https://doi.org/10.1210/er.2017-00164‏
Miao X, Luo Q, Zhao H, Qin X. Ovarian transcriptomic study reveals the differential regulation of miRNAs and lncRNAs related to fecundity in different sheep. Scientific reports. 2016; 6(1): 1-11. https://doi.org/10.1038/srep35299
Kowalewska-Łuczak I, Czerniawska-Piątkowska E. Polymorphism in the OLR1 gene and functional traits of dairy cattle. Veterinarski arhiv. 2018; 88(2): 171-177.‏ https://doi.org/10.24099/vet.arhiv.170228
Anggraeni A. Genetic polymorphisms of the OLR1 and DGAT1 genes associated with milk components in Holstein Friesian dairy cattle under an intensive management in Central Java. In IOP Conference Series: Earth and Environmental Science (Vol. 287, No. 1, p. 012001). IOP Publishing. 2019. https://doi.org/ 10.1088/1755-1315/287/1/012001
Mentrup T, Cabrera-Cabrera F, Schröder B. Proteolytic Regulation of the Lectin-Like Oxidized Lipoprotein Receptor LOX-1. Frontiers in Cardiovascular Medicine. 2021; 7: 409.‏ https://doi.org/10.3389/fcvm.2020.594441
Komisarek J, Dorynek Z. Effect of ABCG2, PPARGC1A, OLR1 and SCD1 gene polymorphism on estimated breeding values for functional and production traits in Polish Holstein-Friesian bulls. Journal of applied genetics. 2009; 50(2): 125-132.‏ https://doi.org/10.1007/BF03195663
Fonseca PDDS, de Souza FR, de Camargo GM, Gil FM, Cardoso DF, Zetouni L, et al. Association of ADIPOQ, OLR1 and PPARGC1A gene polymorphisms with growth and carcass traits in Nelore cattle. Meta gene. 2015; 4: 1-7.‏ https://doi.org/10.1016/j.mgene.2015.02.001
Khatib H, Leonard SD, Schutzkus V, Luo W, Chang YM. Association of the OLR1 gene with milk composition in Holstein dairy cattle. Journal of dairy science. 2006; 89(5): 1753-1760.‏ https://doi.org/10.3168/jds.S0022-0302(06)72243-3
Rezaei M, Rahbar R, Naderi Y. ABCG2 and OLR1 gene polymorphism on production traits in Holsteins and Simmental cows of Mazandaran Province. Acta Biol. Indica. 2016; 5: 30-37.‏
Wang X, Peñagaricano F, Tal-Stein R, Lipkin E, Khatib H. Association of an OLR1 polymorphism with milk production traits in the Israeli Holstein population. Journal of dairy science. 2012; 95(3): 1565-1567.‏ https://doi.org/10.3168/jds.2011-5012
Vinsky M, Islam K, Chen L, Li C. Association analyses of a single nucleotide polymorphism in the promoter of OLR1 with growth, feed efficiency, fat deposition, and carcass merit traits in hybrid, Angus and Charolais beef cattle. Canadian Journal of Animal Science. 2013; 93(2): 193-197.‏ https://doi.org/10.4141/cjas2012-115
Soltani-Ghombavani M, Ansari-Mahyari S, Edriss MA. Association of a polymorphism in the 3'untranslated region of the OLR1 gene with milk fat and protein in dairy cows. Archives Animal Breeding. 2013; 56(1): 328-334.‏ https://doi.org/10.7482/0003-9438-56-032
Manisha D, Rank DN, Vataliya PH, Joshi CG. Oxidized low density lipoprotein receptor 1 (OLR1) gene polymorphism in Mehsana buffaloes (Bubalus bubalis). Buffalo Bulletin. 2013; 32(4): 260-264.‏
Javed M, Babar ME, Nadeem A, Yaqub T, Hussain T. Identification of Single Nucleotide Polymorphisms in OLR1 Gene in Nili Ravi Buffalo. Editorial Board. 2013; 701.‏
Hosseinpour Mashhadi M. A research on association between SCD1 and OLR1 genes and milk production traits in Iranian Holstein dairy cattle. Iranian Journal of Applied Animal Science. 2017; 7(2): 243-248.‏
Gui LS, Raza SHA, Jia J. Analysis of the oxidized low density lipoprotein receptor 1 gene as a potential marker for carcass quality traits in Qinchuan cattle. Asian-Australasian journal of animal sciences. 2019; 32(1): 58.‏ https://doi.org/10.5713/ajas.18.0079
Mu QIAO, Kang-chi LI, Jun-jing WU, Hua-yu WU, Jia-wei ZHOU, Shu-qi MEI, et al. Polymorphism of porcine OLR1 gene and its association with liter size trait of Xidu black pigs. Hubei Agricultural Sciences. 2020; 59(24): 141.‏
Al-Shuhaib MBS. A Universal, rapid, and inexpensive method for genomic DNA isolation from the whole blood of mammals and birds. J. Genet. 2017; 96(1): 171–176. https://doi.org/10.1007/s12041-017-0750-6
Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden T. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012; 13: 134. https://doi.org/10.1186/1471-2105-13-134
Imran FS, Al-Thuwaini TM, Al-Shuhaib MBS, Lepretre F. A Novel Missense Single Nucleotide Polymorphism in the GREM1 Gene is Highly Associated with Higher Reproductive Traits in Awassi Sheep. Biochemical Genetics. 2020; 1-15.‏ https://doi.org/10.1007/s10528-020-10006-x
Byun SO, Fang Q, Zhou H, Hickford JGH. An effective method for silver-staining DNA in large numbers of polyacrylamide gels. Anal. Biochem. 2009; 385: 174–175. https://doi.org/ 10.1016/j.ab.2008.10.024
Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003; 31: 3784–3788. https://doi.org/10.1093/nar/gkg563
Pauline CN, Steven H. SIFT predicting amino acid changes that affect protein function. Nucl. Acids Res. 2003; 31:3812–3814. https://doi.org/10.1093/nar/gkg509
Adzhubei I, Jordan DM, Sunyaev SR. Predicting functional effect of human missense mutations using PolyPhen‐2. Current protocols in human genetics. 2013); 76(1): 7-20. https://doi.org/10.1002/0471142905.hg0720s76‏
Choi Y, Sims GE, Murphy S, Miller JR, Chan AP. Predicting the functional effect of amino acid substitutions and indels. PLOS ONE. 2012; 7: e46688. https://doi.org/10.1371/journal.pone.0046688
Tang H, Thomas PD. PANTHER-PSEP: predicting disease-causing genetic variants using position-specific evolutionary preservation. Bioinformatics. 2016; 32: 2230–2. https://doi.org/10.1093/bioinformatics/btw222
Capriotti E, Calabrese R, Casadio R. Predicting the insurgence of human genetic diseases associated to single point protein mutations with support vector machines and evolutionary information. Bioinformatics. 2006; 22(22): 2729-2734. https://doi.org/10.1093/bioinformatics/btl423
Yeh FC, Yang RC. POPGENE version 1.31, Microsoft window-based freeware for population genetic analysis. University of Alberta and Tim Boyle, Centre for International Forestry Research, 1999.
Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American journal of human genetics. 1980; 32(3): 314.‏
Hrdlickova B, de Almeida RC, Borek Z, Withoff S. Genetic variation in the non-coding genome: Involvement of micro-RNAs and long non-coding RNAs in disease. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 2014; 1842(10): 1910-1922.‏ https://doi.org/10.1016/j.bbadis.2014.03.011
Ng PC, Henikoff S. Predicting the effects of amino acid substitutions on protein function. Annu. Rev. Genomics Hum. Genet. 2006; 7: 61-80.‏ https://doi.org/10.1146/annurev.genom. 7.080505.115630
Chu D, Wei L. Nonsynonymous, synonymous and nonsense mutations in human cancer-related genes undergo stronger purifying selections than expectation. BMC cancer. 2019; 19(1): 1-12. https://doi.org/10.1186/s12885-019-5572-x‏
Pandurangan AP, Blundell TL. Prediction of impacts of mutations on protein structure and interactions: SDM, a statistical approach, and mCSM, using machine learning. Protein Science. 2020; 29(1): 247-257.‏ https://doi.org/10.1002/pro.3774
Stefl S, Nishi H, Petukh M, Panchenko AR, Alexov E. Molecular mechanisms of disease-causing missense mutations. Journal of molecular biology. 2013; 425(21): 3919-3936.‏ https://doi.org/10.1016/j.jmb.2013.07.014
Studer RA, Dessailly BH, Orengo CA. Residue mutations and their impact on protein structure and function: detecting beneficial and pathogenic changes. Biochemical journal. 2013; 449(3): 581-594.‏ https://doi.org/10.1042/BJ20121221
Qiao M, Li KC, Wu JJ, Wu HY, Zhou JW, Mei SQ, et al. Polymorphism of porcine OLR1 gene and its association with liter size trait of Xidu black pigs. Hubei Agricultural Sciences. 2020; 59(24): 141.‏
Khaki Z, Khazraiinia P, Chegini S, Nia SK. Comparative study of serum lipid profile in chicken, ostrich, cattle, and sheep. Comparative Clinical Pathology. 2012; 21(3): 259-263.‏ https://doi.org/10.1007/s00580-010-1088-0
Chui PC, Guan HP, Lehrke M, Lazar MA. PPARγ regulates adipocyte cholesterol metabolism via oxidized LDL receptor 1. The Journal of clinical investigation. 2005; 115(8): 2244-2256. https://doi.org/10.1172/JCI24130
Raviv S, Hantisteanu S, Sharon SM, Atzmon Y, Michaeli M, Shalom-Paz E. Lipid droplets in granulosa cells are correlated with reduced pregnancy rates. Journal of ovarian research. 2020; 13(1): 1-10.‏ https://doi.org/10.1186/s13048-019-0606-1
Mu YM, Yanase T, Nishi Y, Tanaka A, Saito M, Jin CH, et al. Saturated FFAs, palmitic acid and stearic acid, induce apoptosis in human granulosa cells. Endocrinology. 2001; 142(8): 3590-3597.‏ https://doi.org/10.1210/endo.142.8.8293
Wathes DC, Fenwick M, Cheng Z, Bourne N, Llewellyn S, Morris DG, et al. Influence of negative energy balance on cyclicity and fertility in the high producing dairy cow. Theriogenology. 2007; 68: S232-S241.‏ https://doi.org/10.1016/j.theriogenology. 2007.04.006
Al-Thuwaini TM. The relationship of hematological parameters with adaptation and reproduction in sheep; A review study. Iraqi Journal of Veterinary Sciences. 2021; 35(3): 575-580.‏ https://doi.org/10.33899/ijvs.2020.127253.1490
Galal S, Gürsoy O, Shaat I. Awassi sheep as a genetic resource and efforts for their genetic improvement—A review. Small Ruminant Research. 2008; 79(2-3): 99-108.‏ https://doi.org/10.1016/j.smallrumres.2008.07.018
Gootwine E. Mini review: breeding Awassi and Assaf sheep for diverse management conditions. Tropical animal health and production. 2011; 43(7): 1289-1296.‏ https://doi.org/10.1007/s11250-011-9852-y

Table 1. The oligonucleotide primer sets designed for the ampliﬁcation of the ovine OLR1 gene. The symbols “F” and “R” refer to forward and reverse primers, respectively. The design was based on the ovine NCBI Reference Sequence NC_040254.1.

Primer code	Locus	Sequence (5ʹ - 3ʹ)	Binding coordinate in the genome		Amplicon length	Annealing temperature
			Start	Stop
OLR1,exo3-F	Exon 3	TTCACCGAAATCCAGTGGAGG	220107792	220107812	334 bp	60.4 °C
OLR1,exo3-R		CCTCTCGCCCTCATACCTGA	220108106	220108125		60.4 °C
OLR1,exo4-F	Exon 4	AGAGATGGCATGCATGTGGG	220113177	220113196	291 bp	NA*
OLR1,exo4-R		AATCCAGCCTGACACATCCC	220113448	220113467		NA*
OLR1-exo6-F	Exon 6	CCCTGCCTGCAGGTTTAGAA	220114431	220114450	274 bp	59.1 °C
OLR1-exo6-R	Exon 6	CTAGTAGCAGGCAGTTCCCG	220114685	220114704		59.1 °C

* No specific results were obtained from utilizing this primers’ pair to amplify this locus since no specific bands (~ 291 bp) were observed in agarose gel electrophoresis.

Table 2. Genetic diversity of the OLR1 gene in Awassi ewes.

Observed genotypes		Genotype frequencies		Allele frequencies		Ho	He	Ne	PIC	χ²
CC	CA	CC	CA	A	C
n= 51	n= 149	0.25	0.75	0.63	0.37	0.74	0.47	1.87	0.35	69.93

Abbreviations: χ ² – Chi-square, Ho – observed heterozygosity, He – Expected heterozygosity, Ne – effective allele frequency, n – number of individuals. All Chi-square tests have one degree of freedom and within the significance level P≤ 0.05.

Table 3. The in silico prediction of p.K116Q on ovine OLR1 protein, in terms of structure and function.

SIFT		Meta-SNP		PROVEAN		SNAP		PhD-SNP		I-Mutant2
Score	Prediction	Score	Prediction	Score	Prediction	Score	Prediction	Score	Prediction	Score	Prediction
0.130	Neutral	0.147	Neutral	-0.97	Neutral	0.260	Neutral	0.153	Neutral	1.44	Increase

SIFT: Value > 0.05 mutation is predicted neutral; Meta-SNP: Value < 0.5 mutation is predicted neutral; PROVEAN: value > -2.5 is predicted neutral; SNAP: Value < 0.5 mutation is predicted neutral; PhD-SNP: Value < 0.5 mutation is predicted neutral; I-Mutant2: DDG > 0 increase stability.

Table 4. The association between OLR1 genetic polymorphism at locus p.116K>Q and fecundity traits in Awassi ewes.

Genotypes	Litter size (LSM ± SE)	Ewe birth type (% )		Fecundity	Lambing percentage
Genotypes	Litter size (LSM ± SE)	Singleton	Twin	Fecundity	Lambing percentage
CC (51)	1.98± 0.04^a	12(23.52%)^b	39(76.47%)^a	1.76^a	176.47^a
CA (149)	1.42± 0.05^b	102(68.45%)^a	47(31.54%)^b	1.31^b	131.54^b
P-value	0.01*	0.01*	0.04*	0.02*	0.03*

LSM ± SE, Least square means ± Standard error, * (P≤0.05). ^a,b Significant differences in means represent by differences in the same column within each classification.

Download PDF

Journal Publication

published 28 Feb, 2022

Read the published version in Theriogenology →

Version 1

posted

You are reading this latest preprint version

A Novel p.K116Q SNP in the OLR1 Gene and Its Relation to Fecundity in Awassi Ewes

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Status:

Journal Publication

Version 1