Fenofibrate Alleviates Insulin Resistance and Hepatic Steatosis via Modulation of let-7/ SERCA2b&nbsp;Axis

doi:10.21203/rs.3.rs-83279/v1

Download PDF

Research

Fenofibrate Alleviates Insulin Resistance and Hepatic Steatosis via Modulation of let-7/ SERCA2b Axis

https://doi.org/10.21203/rs.3.rs-83279/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Fenofibrate is a peroxisome proliferator-activated receptor alpha agonist, which is widely used in clinical practice to effectively ameliorates the development of NAFLD. However, the molecular mechanism remains largely unknown, the present study aimed to investigate the role and specific mechanism of fenofibrate on lipid metabolism disorders associated diseases.

Methods: The male C57BL6/J mice were divided into 3 groups, the mice in control group (n=10) were fed with normal chow diet, and the mice in HFD-fed group (n =10) were fed with a high fat diet (HFD) for 14 weeks. For the fenofibrate +HFD-fed group (n =10), the mice fed HFD were orally gavaged with fenofibrate (40 mg/kg) daily for the last 4 weeks. Body weight and hip width were measured. Macrosteatosis and fat deposition in the liver were measured by H&E staining and Oil red O staining individually. The levels of serum and hepatic triglyceride were measured, and HOMA-IR, HOMA-ISI were analyzed. The levels of SCD-1, Bip, CHOP and SERCA2b were measured by western blotting. The expression of let-7 were analyzed by qPCR, and the complementarity between the 3′-UTR of SERCA2b gene and let-7 was measured by luciferase reporter assay.

Results: Fenofibrate reduces hepatic steatosis and insulin resistance in HFD-fed mice. Fnofibrate alleviates endoplasmic reticulum stress (ER stress) of mice fed a high fat diet (HFD). Fenofibrate increases the levels of Sarco-endoplasmic reticulum Ca²⁺-ATPase 2b (SERCA2b) which serves as a regulator of ER stress. Further, the levels of let-7 microRNA is also regulated by fenofibrate, and let-7 directly targets 3’-UTR of SERCA2b.

Conclusion: The present data suggests that fenofibrate alleviates ER stress through the let-7/SERCA2b axis to protect against excessive lipid accumulation in the liver of Non-alcoholic fatty liver disease (NAFLD) mice.

Endocrinology & Metabolism

Gastroenterology & Hepatology

Fenofibrate

SERCA2b

Let-7 microRNA

Non-alcoholic fatty liver disease

Endoplasmic reticulum stress

Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide now [1]. NAFLD is typically characterized by excess accumulation of abnormal amounts of fat in the hepatocytes [2]. The excessive fat accumulation in the liver is strongly associated with an increased risk of obesity, type 2 diabetes, metabolic syndrome, cardiovascular disease and cancer [3,4]. NAFLD has become an important public health issue because of its high prevalence and potential progression to severe liver diseases. Therefore, understanding of the mechanism of NAFLD development is driving progress in therapeutic strategies.

Accumulating evidence reveals that hepatic endoplasmic reticulum (ER) stress (ER stress) critically contributes to pathogenesis of NAFLD [5]. ER present in the cytoplasm of eukaryotic cells carries out multiple essential functions, which is particularly important in calcium storage, protein and lipid synthesis [6]. ER stress occurs when ER function is disturbed by misfolded proteins accumulation or ER calcium is depleted. Various pathological conditions, including hypoxia, ischaemia, inflammation, energy disturbance, and oxidative stress, interrupt the homeostatic function of ER and then trigger the ER stress [6,7]. It is well known that ER stress activates a signal transduction system termed the unfolded protein response (UPR) [8]. Activation of the UPR depends on three ER stress sensor proteins: inositol-requiring enzyme 1α (IRE1α), protein kinase RNA-like ER kinase (PERK), and ATF6, a transmembrane basic leucine zipper transcription factor [9,10]. For instance, activated IRE1α specifically cleaves the mRNA of the transcription factor X-box binding protein (XBP)1, which is required for translation of transcriptionally active XBP1[10]. During ER stress, the release of ATF6 from the ER chaperon Grp78/BiP permits activation of ATF6, mediating the expression of UPR target genes, including XBP-1. Although the role of ER stress in NAFLD was confirmed [11], the specific mechanism remains largely unknown. Sarco-endoplasmic reticulum calcium ion ATPase (SERCA) is a P-type ATPase family member that pumps Ca²⁺ from the cytosol to the ER [12]. Among family numbers of SERCAs, SERCA2b serves as a housekeeping isoform involved in the cellular calcium homeostasis [13]. The SERCA2b protein levels and activity are significantly reduced in mice with obesity [14,15]. Overexpression of SERCA2b ameliorates ER stress, increases glucose tolerance and improves the NAFLD phenotypes in obese mice [14-16]. These results indicate that SERCA2b plays an important role in regulating ER stress during NAFLD.

MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression at the post-transcriptional level by targeting sequence motifs located within the 3′ untranslated region (UTR) of mRNA transcripts [17]. A number of studies have shown that disturbance of miRNA expressions contributes to metabolic disorders associated with NAFLD by altering key signaling elements [18-22]. For instance, while overexpression of the let-7 in mice resulted in impaired glucose tolerance, knockdown of the let-7 in mice resulted in hepatic lipid accumulation and improved insulin resistance in mice fed HFD [23]. The action of let-7 is mainly due to inhibition of the Insulin-PI3K pathway by targeting insulin receptor (INSR) and insulin receptor substrate 2 (IRS2) and insulin-like growth factor 1 receptor (IGF1R) [23,24]. Our recent study demonstrates that miR-30b induces ER stress by targeting SERCA2b, thereby impairing insulin sensitivity in rats fed HFD [20]. Thus, miRNAs represent potential novel therapeutic targets for NAFLD. Fenofibrate, the peroxisome proliferator-activated receptors α (PPAR-α) agonist, is a prescription medication used to lower cholesterol and triglycerides [25]. It has been shown that fenofibrate improves fibrosis, inflammation and lipid homeostasis of hepatic by activing PPAR-α [26], but the precise mechanism is not well understood. In this study, we showed that fenofibrate treatment suppressed hepatic lipid accumulation and improved insulin resistance by suppressing let-7 expression in the liver of mice fed HFD. Our results identified that let-7 family miRNAs were regulators of SERCA2b by targeting 3’-UTR of SERCA2b mRNA. Thus, fenofibrate alleviates ER stress through the let-7/SERCA2b axis to protect against hepatic lipogenesis of NAFLD mice.

Animals

Adult (age, 6 weeks) male C57BL6/J mice were obtained from the Nanjing Biomedical Research Institute of Nanjing University (Nanjing, China). The mice were fed with free access to water and food in plastic cages at a controlled temperature of 20± 2℃, humidity of 50%–60% and a 12-hour light–dark cycle. After 1 week of acclimatization, the mice were randomly divided into 3 groups: control group (n=10), HFD-fed group (n=10), and fenofibrate + HFD-fed group (n=10), fenofibrate was dissolved with 0.5% sodium carboxymethyl cellulose (CMC-Na). The mice in control group were fed with normal chow diet, and the mice in HFD-fed group were fed with a high fat diet (HFD), which consists of 20% carbohydrate, 20% protein and 60% fat (total 25.07 kJ/g), for 14 weeks. For the fenofibrate +HFD-fed group, the mice fed HFD were orally gavaged with fenofibrate (40 mg/kg) daily for the last 4 weeks. Body weight was measured once a week throughout the investigation.

Western blotting

Mouse liver was homogenized in liquid nitrogen, the homogenate was lysed on ice for 1 h in lysis buffer (BioTeKe, Beijing, China). Protein lysates were loaded into each well and separated on 7.5%, 10% or 12.5% SDS polyacrylamide gel. Separated proteins were then transferred to immobilon-PSQ transfer PVDF membrane (Millipore, Bedford, MA), and blocked with 5% skim milk in Tris-buffered saline supplemented with 0.1% Tween-20 (TBST) for 2 hours at room temperature. The primary antibodies were anti-ATP2A2/SERCA2b (#4388, Cell Signaling Technology, Beverly, MA), anti-Bip (#3183, Cell Signaling Technology), anti-CHOP (#2895, Cell Signaling Technology), and anti-GAPDH antibodies (#8884, Cell Signaling Technology). The immunoreactive signals were detected using the ECL western blotting substrate reagents (#32109, Thermo Scientific Science, Waltham, MA). An imaging system (Amersham Imager 600) was used for documentation of the western blotting results. Quantitation was analyzed with the ImageJ (NIH).

Quantitative RT-PCR

Total miRNAs in tissue were extracted with the miRcute miRNA Isolation kit (DP501, Transgen, Being, China). cDNA was reversely synthesized using the miRcute Plus miRNA First-Strand cDNA kit (KR211-01, Trangen, Being, China). Quantitative real-time PCR (qRT-PCR) analysis of let-7a, let-7b, let-c, let-7d, let-7e, let-7f, let-7g, let-7i, and mir-98 were performed using miRcute Plus miRNA qPCR kit (SYBR Green) (FP411-01-01,Trangen, Being, China) on a Roche LightCycler 480 System (Roche Applied Science, Mannheim, Germany). The primers used for PCR were as follows:

let-7a: 5’- UGAGGUAGUAGGUUGUAUAGUU- 3’;

let-7b: 5’- UGAGGUAGUAGGUUGUGUGGUU- 3’;

let-7c: 5’- UGAGGUAGUAGGUUGUAUGGUU - 3’;

let-7d: 5’- AGAGGUAGUAGGUUGCAUAGUU- 3’;

let-7e: 5’- UGAGGUAGGAGGUUGUAUAGUU- 3’;

let-7f: 5’- UGAGGUAGUAGAUUGUAUAGUU- 3’;

let-7g: 5’- UGAGGUAGUAGUUUGUACAGUU- 3’;

let-7i: 5’- UGAGGUAGUAGUUUGUGCUGUU- 3’;

mir-98: 5’- UGAGGUAGUAAGUUGUAUUGUU- 3’.

All qRT-PCRs were performed in triplicates. U6 was used for normalization.

Luciferase reporter assay

The 3′-UTR of SERCA2b mRNA was amplified by PCR and cloned into the psiCHECK2 luciferase reporter vector. The human hepatocarcinoma cell line HepG2 cells were grown in 24-well plate containing Dulbecco’s Modified Eagle Medium (Hyclone, Logan, UT) supplemented with 10% Fetal Bovine Serum (FBS, Hyclone), and maintained at 37°C with 5% CO2. When 60% to 80% confluent, the cells were transfected using Lipofectamine 2000® Reagent (Thermo Fisher Scientific, Waltham, MA) with 3′-UTR of SERCA2b reporter plasmids with negative control (NC) mimics or miR-let-7 mimic. At 48 h transfection, the luciferase activity was determined by the Dual Luciferase Assay System (Promega, Beijing, China). The renilla luciferase activity was used as a normalization in each well. All experiments were repeated three times.

Hematoxylin and eosin (H&E) staining

Fresh liver samples were fixed in 10% formalin and embedded in paraffin. After sectioned at a 5-μm thickness, and the sections were mounted onto glass microscope slides, and air-dried at room temperature for 24 h. The sections were then stained with hematoxylin and eosin (H&E). Images were acquired in a Leica aperio CS2 system.

Oil-red O staining

Oil-red O staining was used to determine lipid deposition. In briefly, OCT-embedded tissues were sectioned at a 10-μm thickness, and fixed in 10% formalin for 10-15 min, then rinsed in distilled water and air-dried. The sections were stained with freshly prepared Oil Red O staining solution (Sigma-Aldrich) for 8–10 min at 60℃. Finally, the sections were counterstained with hematoxylin. Images were acquired in a Leica aperio CS2 system.

Statistics

The data presented in each figure are mean ± SD of three independent experiments performed in triplicate. The data presented in each figure are mean ± SD. Statistical differences between two groups were analyzed using Student’s t-test. Statistical difference between multiple groups were performed by one-way ANOVA, followed by a Student-Newman–Keuls test. Data were analyzed using GraphPad Prism 7 (GraphPad Software Inc., La Jolla, CA), A value of P < 0.05 was considered to represent a statistical significance.

Fenofibrate reduces hepatic steatosis and insulin resistance in HFD-fed mice

Mice became obviously obese, which were accompanied with significant increases in body weight and hip width after the 14 weeks of HFD feeding (Fig. 1a-b). To confirm the beneficial effects of fenofibrate, these HFD-induced obese (DIO) mice were administered vehicle (CMC-Na) and fenofibrate by oral gavage daily for 4 weeks. We found that the body mass and the average hip width of DIO mice were significantly decreased after fenofibrate administration. Compared with the vehicle, DIO mice treated with fenofibrate exhibited significant decreases in hepatocyte ballooning (Fig. 1c), macrosteatosis (H&E staining) and fat deposition (Oil red O staining) in the liver (Fig. 1d) as well as the levels of serum and hepatic triglyceride (TG) (Fig. 1f-g). Next, we measured the protein levels of steroyl-CoA desaturase (SCD-1), which is a key enzyme for the synthesis of monounsaturated fatty acids [27]. The protein levels of SCD-1 were significantly up-regulated in the liver of DIO mice, which were reduced by fenofibrate treatment (Fig. 1e). As insulin resistance (IR) is one of the most frequent complications of obesity, we determined the effects of fenofibrate on IR. We found that fenofibrate treatment reduced HOMA-IR (Homeostatic model assessment for insulin resistance) (Fig. 1h), and alleviated HOMA-ISI (Homeostatic model assessment for insulin sensitivity) (Fig. 1i). These data indicate that fenofibrate treatment dramatically improves abnormal lipid accumulation and insulin resistance in the liver of DIO mice.

Fenofibrate treatment ameliorates ER stress accompanied by up-regulation of SERCA2b in the liver of HFD-fed mice

ER stress plays a vital role in the pathological development of hepatic steatosis [5]. We thus tested whether ER stress activated by HFD feeding were attenuated by fenofibrate treatment. We determined the protein levels of Bip and CHOP, two indicators of ER stress by western blotting, and found that both protein expressions were up-regulated in the in the liver of DIO mice (Fig. 2a-b), compared with those in mice fed normal diet. Fenofibrate treatment dramatically ameliorates ER stress, which was activated by HFD feeding (Fig. 2a-b). It has been shown that the protein expression or activity of SERCA2b are significantly reduced in mice with obesity [14,15,20]. whereas increased SERCA2b expression or activity contributes to the amelioration of ER stress in obese mice [28,29]. To identify whether fenofibrate ameliorates ER stress by regulating SERCA2b, we measured the protein levels of SERCA2b by western blotting. Indeed, fenofibrate treatment significantly restored the protein expression of SERCA2b in the liver of DIO mice (Fig. 2c). Similar results were confirmed by immunohistochemistry analysis (Fig. 2d). These data indicate that fenofibrate treatment ameliorates ER stress, at least in part, by up-regulating SERCA2b in the liver of HFD-fed mice.

Fenofibrate treatment attenuates let-7 expression in the liver of HFD-fed mice

Overexpression of let-7 in mice results in impaired glucose tolerance, while global knockdown of let-7 improves the impaired glucose tolerance in mice with obesity [30]. Using miRNA microarray, our recent study reveals that the levels of let-7 family miRNAs are elevated in the liver of rats fed HFD [20]. We measured the levels of let-7 family in the liver of mice by RT- qPCR, and found that the levels of let-7a, let-7b, let-c, let-7d, let-7e, let-7f, let-7g, and let-7i were increased in DIO mice (Fig. 3a). Fenofibrate treatment significantly inhibited the levels of let-7 family in the liver of DIO mice.

SERCA2b is a target gene of let-7

let-7 is highly conserved in different species including human and rodents (Fig. 3b). To identify whether SERCA2b is regulated by let-7, we first analyzed the sequence alignment of SERCA2b 3′-UTR and let-7 family by Targetscan algorithm. We identified let-7 family that could bind to the 3’UTR of SERCA2b (Fig. 3c). To confirm the involvement of let-7 in the regulation of SERCA2b expression, we construct a luciferase reporter vector containing the 3′-UTR of SERCA2b. We found that transfection of let-7 mimics markedly decreased the luciferase activity of SERCA2b 3′-UTR in HepG2 cells (Fig. 3d). The data clearly demonstrates that let-7 miRNA directly targets SERCA2b.

In this study, we characterized the molecular mechanism underlying fenofibrate alleviated hepatic steatosis and insulin resistance in a rodent model of NAFLD (Fig. 4). Fenofibrate reduces the expressions of let-7 family, which are up-regulated in the liver of DIO mice. Our results identify that SERCA2b is a target of let-7. Downregulation of SERCA2b results in the activation of ER stress, thereby inducing steatosis and insulin resistance. Thus, fenofibrate improves the pathogenesis of NAFLD by modulation of the let-7/ SERCA2b axis.

Activation of ER stress initiates inflammation, insulin resistance, and hepatic steatosis, all of which are important factors involved in NAFLD pathogenesis. Fenofibrate can alleviate endoplasmic reticulum stress in the liver of mice with obesity [31], but the mechanism remained largely unclear. In this study, our results demonstrate that fenofibrate can alleviate ER stress via up-regulation of SERCA2b. It has been shown that overexpression of SERCA2b significantly suppresses steatosis, at least in part, by inhibiting the up-regulation of lipogenesis genes, such as SCD1, DGAT2, and ACC2 in the liver of ob/ob mice [14]. However, overexpression of SERCA2b does not influence expression of SREBP1c, a master regulator of these lipogenic genes (SCD1, DGAT2, and ACC2). Thus, downregulation of these lipogenic genes by SERCA2b is independent of SREBP1c. Actually, XBP1 directly regulates the expression of lipogenic genes, such as SCD1, DGAT2, and ACC2 in the liver [32]. Thus, SERCA2b regulates lipid accumulation probably by inhibiting lipogenic genes mediated by XBP1.

Dysregulation of miRNA expressions has been associated with NAFLD by altering a variety of pathways [18-20,22]. For example, using miRNA microarray, our recent study identifies that upregulation of miR-30b promotes insulin resistance and hepatic steatosis by targeting SERCA2b in rats fed HFD [20]. Interestingly, elevated expressions of let-7 family are observed in the liver of the rats fed HFD [20]. In the current study, the levels of let-7 family, such as let-7a, let-7b, let-c, let-7d, let-7e, let-7f, let-7g, let-7i, and mir-98, were also observed in the liver of DIO mice. Meanwhile, we found that fenofibrate treatment downregulated the expressions of let-7 family in the DIO mice. Two previous studies have demonstrated that let-7 induces hepatic lipid accumulation and insulin resistance by targeting the key components of the insulin signaling pathway, such as INSR, IRS2, and IGF1R in mice with obesity [23]. Our data demonstrated that SERCA2b is a novel target of let-7. Thus, our results revealed that fenofibrate improves the pathogenesis of NAFLD by alleviating ER stress through let-7/ SERCA2b axis.

The strengths of this study were listed as following: First, we clarify that fenofibrate alleviates ER stress via up-regulation of SERCA2b, thereby improving steatosis and insulin resistance in a rodent model of NAFLD. Second, the data also suggests that fenofibrate reduces the expressions of let-7 family, which are up-regulated in the liver of NAFLD mice, and further research identify that SERCA2b is a target of let-7. Thus, Fenofibrate alleviates insulin resistance and hepatic steatosis via modulation of let-7/ SERCA2b axis. This study also has some limitations. Clearly, the mechanism underlying fenofibrate downregulates let-7 need to be investigated further in light of our current results.

In conclusion, our data demonstrates that fenofibrate alleviates ER stress by regulating SERCA2b in the liver of NAFLD mice. Moreover, the levels of let-7 is also regulated by fenofibrate, and let-7 regulates SERCA2b by directly targeting the 3’-UTR of SERCA2b. Thus, fenofibrate improves the pathogenesis of NAFLD by modulation of the let-7/ SERCA2b axis.

ER stress: endoplasmic reticulum stress; HFD: high fat diet; SERCA2b: Sarco-endoplasmic reticulum Ca²⁺-ATPase 2b; NAFLD: Non-alcoholic fatty liver disease; UPR: unfolded protein response; IRE1α: inositol-requiring enzyme 1α; PERK: protein kinase RNA-like ER kinase; XBP: X-box binding protein; INSR: insulin receptor; IRS2: insulin receptor substrate 2; IGF1R: insulin-like growth factor 1 receptor; PPAR-α: peroxisome proliferator-activated receptors α; CMC-Na: sodium carboxymethyl cellulose; DIO: HFD-induced obese; TG: triglycerides; IR: insulin resistance; HOMA-IR: Homeostatic model assessment for insulin resistance; HOMA-ISI: Homeostatic model assessment for insulin sensitivity

Acknowledgements

We thank Professor Fan Li (the Department of Pathology and Pathophysiology of Kunming Medical University) for technical assistance.

Authors’ contributions

All authors had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. ZD, NSZ, MLQ, CYL and ZCG involved in study concept and design. ZD and ZB performed the animal experiment and acquired the data. NSZ and MYC performed the cell experiment and acquired the data. DY and GZT helped with the animal experiments. WY and LSF interpreted the results and drew the figures. CYL, SCJ and PGY were involved in drafting of manuscript, study supervision, revision of manuscript for intellectual content. All authors read and approved the final manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (No. 81560099 and No.81760108), the Key Project of Science and Technology Department of Yunnan Province (2018FA039), and the Postgraduate Innovation Fund of Kunming Medical University (2020S025).

Availability of data and materials

The dataset used and analyzed during the current study is available from the corresponding author on reasonable request.

Ethics approval and consent to participate

Ethical approval for this animals’ research was given by the Ethics Committee of the Kunming Medical University (No: kmmu2020248).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Author details

¹The First Affiliated Hospital, Yunnan Institute of Digestive Disease, Kunming Medical University, Kunming 650032, China. ²State Key Laboratory for Conservation and Utilization of Bio-Resources in Yunnan, School of Life Sciences, Yunnan University, Kunming 650091, China. ³Department of Faculty of Basic Medicine, Kunming Medical University, Kunming 650500, China. ⁴Department of Surgery, Lijiang Women's and Children's Hospital, Lijiang 530721, China.

Quesada-Vázquez S, Aragonès G, Bas D, et al. Diet, Gut Microbiota and Non-Alcoholic Fatty Liver Disease: Three Parts of the Same Axis. Cells. 2020;9(1):176.
Antonucci L, Porcu C, Iannucci G, Balsano C, Barbaro B. Non-Alcoholic Fatty Liver Disease and Nutritional Implications: Special Focus on Copper. Nutrients. 2017;9(10):1137.
Chen L, Chen XW, Huang X, Song BL, Wang Y. Regulation of glucose and lipid metabolism in health and disease. Sci China Life Sci. 2019;62:1420–58.
Adams LA, Anstee QM, Tilg H, Targher G. Non-alcoholic fatty liver disease and its relationship with cardiovascular disease and other extrahepatic diseases. Gut. 2017;66:1138–53.
Puri P, Mirshahi F, Cheung O, Natarajan R, Maher JW, Kellum JM, Sanyal AJ. Activation and dysregulation of the unfolded protein response in nonalcoholic fatty liver disease. Gastroenterology. 2008;134:568–76.
Amen OM, Sarker SD, Ghildyal R, Arya A. Endoplasmic Reticulum Stress Activates Unfolded Protein Response Signaling and Mediates Inflammation, Obesity, and Cardiac Dysfunction: Therapeutic and Molecular Approach. Front Pharmacol. 2019;10:977.
Choy KW, Murugan D, Mustafa MR. Natural products targeting ER stress pathway for the treatment of cardiovascular diseases. Pharmacol Res. 2018;132:119–29.
Yadav RK, Chae SW, Kim HR, Chae HJ. Endoplasmic Reticulum Stress and Cancer. J Cancer Prev. 2014;19:75–88.
Gardner BM, Pincus D, Gotthardt K, Gallagher CM, Walter P. Endoplasmic reticulum stress sensing in the unfolded protein response. Cold Spring Harb Perspect Biol. 2013;5:a013169.
Minamino T, Komuro I, Kitakaze M. Endoplasmic reticulum stress as a therapeutic target in cardiovascular disease. Circ Res. 2010;107:1071–82.
Kim JY, Garcia-Carbonell R, Yamachika S, Zhao P, Dhar D, Loomba R, Kaufman RJ, Saltiel AR, Karin M. ER Stress Drives Lipogenesis and Steatohepatitis via Caspase-2 Activation of S1P. Cell. 2018;175:133–45 e115.
Zhang Y, Inoue M, Tsutsumi A, et al. Cryo-EM structures of SERCA2b reveal the mechanism of regulation by the luminal extension tail. ence Advances. 2020;6(33):eabb0147.
Ushioda R, Miyamoto A, Inoue M, Watanabe S, Okumura M, Maegawa KI, et al. Redox-assisted regulation of Ca2⁺ homeostasis in the endoplasmic reticulum by disulfide reductase ERdj5. Proc Natl Acad Sci U S A. 2016;113:e6055–63.
Park SW, Zhou Y, Lee J, Ozcan U. Sarco(endo)plasmic reticulum Ca2⁺-ATPase 2b is a major regulator of endoplasmic reticulum stress and glucose homeostasis in obesity. Proc Natl Acad Sci U S A. 2010;107:19320–5.
Fu S, Yang L, Li P, Hofmann O, Dicker L, Hide W, et al. Aberrant lipid metabolism disrupts calcium homeostasis causing liver endoplasmic reticulum stress in obesity. Nature. 2011;473:528–31.
Chemaly ER, Troncone L, Lebeche D. SERCA control of cell death and survival. Cell Calcium. 2018;69:46–61.
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215–33.
Trajkovski M, Hausser J, Soutschek J, Bhat B, Akin A, Zavolan M, et al. MicroRNAs 103 and 107 regulate insulin sensitivity. Nature. 2011;474:649–53.
Ng R, Wu H, Xiao H, Chen X, Willenbring H, Steer CJ, Song G. Inhibition of microRNA-24 expression in liver prevents hepatic lipid accumulation and hyperlipidemia. Hepatology. 2014;60:554–64.
Dai LL, Li SD, Ma YC, Tang JR, Lv JY, Zhang YQ, et al. MicroRNA-30b regulates insulin sensitivity by targeting SERCA2b in non‐alcoholic fatty liver disease. Liver Int. 2019;39:1504–13.
Gjorgjieva M, Sobolewski C, Dolicka D, Correia de Sousa M, Foti M. miRNAs and NAFLD: from pathophysiology to therapy. Gut. 2019;68:2065–79.
Wu H, Zhang T, Pan F, Steer CJ, Li Z, Chen X, Song G. MicroRNA-206 prevents hepatosteatosis and hyperglycemia by facilitating insulin signaling and impairing lipogenesis. J Hepatol. 2017;66:816–24.
Frost RJ, Olson EN. Control of glucose homeostasis and insulin sensitivity by the Let-7 family of microRNAs. Proc Natl Acad Sci U S A. 2011;108:21075–80.
Zhu H, Shyh-Chang N, Segre AV, Shinoda G, Shah SP, Einhorn WS, et al. The Lin28/let-7 axis regulates glucose metabolism. Cell. 2011;147:81–94.
Vardanyan R, Hruby V: Chap. 20 - Hypolipidemic and Antihyperlipidemic Drugs. In Synthesis of Best-Seller Drugs. Edited by Vardanyan R, Hruby V. Boston: Academic Press. 2016; 285–315.
Chanda D, Lee CH, Kim YH, Noh JR, Kim DK, Park JH, et al. Fenofibrate differentially regulates plasminogen activator inhibitor-1 gene expression via adenosine monophosphate-activated protein kinase-dependent induction of orphan nuclear receptor small heterodimer partner. Hepatology. 2009;50:880–92.
Poloni S, Blom HJ, Schwartz IV. Stearoyl-CoA Desaturase-1: Is It the Link between.
Sulfur Amino Acids and Lipid Metabolism?. Biology (Basel). 2015;4:383–96.
Ouyang Z, Li W, Meng Q, Zhang Q, Wang X, Elgehama A, et al. A natural compound jaceosidin ameliorates endoplasmic reticulum stress and insulin resistance via upregulation of SERCA2b. Biomed Pharmacother. 2017;89:1286–96.
Kang S, Dahl R, Hsieh W, Shin A, Zsebo KM, Buettner C, et al. Small Molecular Allosteric Activator of the Sarco/Endoplasmic Reticulum Ca2⁺-ATPase (SERCA) Attenuates Diabetes and Metabolic Disorders. J Biol Chem. 2016;291:5185–98.
Frost RJA, Olson EN. Control of glucose homeostasis and insulin sensitivity by the Let-7 family of microRNAs. Proc Natl Acad Sci U S A. 2011;108:21075–80.
Zhang N, Lu Y, Shen X, Bao Y, Cheng J, Chen L, et al. Fenofibrate treatment attenuated chronic endoplasmic reticulum stress in the liver of nonalcoholic fatty liver disease mice. Pharmacology. 2015;95:173–80.
Lee AH, Scapa EF, Cohen DE, Glimcher LH. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science. 2008;320:1492–6.

Download PDF

Version 1

posted

You are reading this latest preprint version

Fenofibrate Alleviates Insulin Resistance and Hepatic Steatosis via Modulation of let-7/ SERCA2b Axis

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Strength And Limitations

Conclusions

Abbreviations

Declarations

References

Status:

Version 1