Quercetin Protects RIMVECs From Inflammatory Damage, Pyroptosis and Cell Migration by Inhibiting the TLR4/NF-κB/NLRP3 Pathway

doi:10.21203/rs.3.rs-837060/v1

Download PDF

Research

Quercetin Protects RIMVECs From Inflammatory Damage, Pyroptosis and Cell Migration by Inhibiting the TLR4/NF-κB/NLRP3 Pathway

https://doi.org/10.21203/rs.3.rs-837060/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Intestinal mucosal microvascular endothelial cells (MEC) have multiple functions and play an important role in intestinal bowel diseases (IBD). Quercetin is a flavonoid found in many plants and fruits. It was reported that quercetin can treat several gastrointestinal cancers, but its effect on bacterial enteritis and pyroptosis-related diseases has been rarely studied. This article aims to explore the effect and mechanism of quercetin on inflammatory injury and pyroptosis of RIMVECs.

Methods: The inflammatory damage and pyroptosis in RIMVECs were induced by LPS and ATP. Real-time quantitative polymerase chain reaction (RT-qPCR), western blot analysis, enzyme-linked immunosorbent assay (ELISA) and immunofluorescence methods were used to detect TLR4/NF-κB/NLRP3 pathways, inflammatory factors (IL-1β and IL-18) and pyroptosis-related proteins (Caspase-1 and GSDMD). The expression and distribution of ZO-1 were detected by western blot analysis and immunofluorescence method. The late apoptosis and necrosis of cells were measured by cell flow cytometry.

Results: The results showed that different concentrations (5, 10, 20μM) of quercetin not only significantly reduced the protein and mRNA levels of TLR4, NLRP3, Caspase-1 and GSDMD, but also down-regulated the protein expression, mRNA and secretion of IL-1β and IL-18. Quercetin also inhibited the phosphorylation of NF-κB p65 and the degradation of IκB. At the same time, quercetin increased the cell migration rate and the expression level of ZO-1, and reduced the number of late apoptotic cells (P<0.05).

Conclusions: Our data indicated that Quercetin reduced the inflammatory response and pyroptosis induced by LPS/ATP through the TLR4/NF-κB/NLRP3 pathway, and protected the migration and tight junctions of RIMVECs.

Veterinary Epidemiology

Internal Medicine

Quercetin

Pyroptosis

NLRP3 inflammasome

GSDMD

Intestinal mucosal capillaries are an important part of the intestinal tract, which can regulate the circulation of metabolic wastes in blood by nourishing the intestinal mucosa, and participate in intestinal barrier and secreting of cytokine ^[1]. When the microvessels of the intestinal mucosa are damaged, it will increase vascular permeability and aggravate early endothelial damage ^[2]. Relevant studies have shown that in some colitis, microvascular disease precedes epithelial disorders ^[3]. Bacteria is one of the main reasons of infectious enteritis in newborn and juvenile animals ^[4]. The commom presenting sign in animals with infectious enteritis are diarrhea, and in the severe cause are endotoxemia or sepsis with death. Exogenous bacteria will recruit a large number of inflammatory cells and mediators after entering the intestinal blood circulatory system, resulting in a series of inflammatory reactions and tissue damage^[5].

Pyroptosis is a kind of programmed cell death between apoptosis and necrosis, which has been strongly linked to the development of bacterial enteritis ^[6]. The expression of NOD-like receptor 3 (NLRP3) inflammasome is a typical feature of infectious diseases and the critical protein of pyroptosis ^[7]. The activation of NLRP3 inflammasomes requires two signals. Pathogen signals such as Gram-negative lipopolysaccharide (LPS) are recognized first by Toll-like receptor 4 (TLR4), activating the synthetic nuclear factor κB (NF-κB) and its downstream NLRP3, also cause inflammation and production of pro-forms of IL-1β(interleukin-1) and IL-18(interleukin-18) ^[8–9]. The second signals are adenosine triphosphatase (ATP) ^[10–11], changes of ion concentration or pH value and other factors which activate Caspase-1 (cysteine aspartate proteolytic enzyme-1) to cut IL-1β, IL-18 and GSDMD (succinic acid to make gastrin D). In this way, more inflammatory factors are recruited to expand the inflammatory response, which can cause pyroptosis of microvascular endothelial cell ^[12].

Zonula Occluden 1 (ZO-1) is an important protein that constitutes tight junctions (TJ). Down-regulation or decreased activity of ZO-1 will affect the formation of TJ between cells ^[13], thereby affecting the normal function of the intestinal barrier. It also increases the risk of bacterial enteritis caused by harmful bacteria penetrating the intestinal mucosa and entering the bloodstream ^[14]. Bacterial toxins, inflammatory factors, tumor necrosis factor, etc. can cause direct damage to TJ and affect the protein activity and distribution of ZO-1^[15–16].

Based on the existing bacterial resistance problem, it is of great significance to study the application and mechanism of traditional Chinese medicine components in the treatment of bacterial enteritis. Quercetin is not only an effective ingredient of Chinese medicinal materials such as Bupleurum, mulberry leaves, Sophora japonicus and Inula, but also exists in the flowers, leaves and fruits of many plants in nature. Quercetin can impact the proliferation, metastasis, apoptosis, and metabolism of tumor cells through multiple signal pathways, and has inhibitory effects on colorectal cancer, gastric cancer, breast cancer, and leukemia ^[17–21]. Relevant studies have proved that quercetin can promote and protect the TJ barrier function of the intestine ^[22], and it can degrade some intestinal bacteria which increases in a time-dependent manner ^[23]. Regarding the regulation of NLRP3 inflammasome, quercetin can protect human retinal microvascular endothelial cells (HRMECs) from injury induced by high glucose and inhibit the expression of NLRP3, Caspase-1, IL-1 β, and IL-18^[24]. In addition, quercetin can also inhibit the protein and gene expression of NLRP3, Caspase-1, iNOS and inflammatory factors in mononuclear macrophages (RAW264.7) activated by LPS, and improve antioxidant and anti-inflammatory abilities ^[25]. Therefore, it can infer that quercetin can protect the integrity of the TJ barrier and has a regulatory effect on the NLRP3 inflammasome.

In this study, we established the model of inflammatory injury and pyroptosis on RIMVECs induced by LPS/ATP, and explored that quercetin regulates the inflammatory injury and pyroptosis of RIMVECs through the NLRP3 signaling pathway.

2.1 Main drugs and reagents

Quercetin (Batch No. Z100081) was purchased from the National Institute for Food and Drug Control. The Dulbecco's Modified Eagle Medium (DEEM), fetal bovine serum (FBS) and trypsin were purchased from Biological Industries. LPS and ATP were obtained from Sigma.

2.2 Main instruments

High-speed centrifuge (Scilogex), real-time fluorescence quantitative RCR instrument (Beijing Institute of Animal Husbandry and Veterinary Medicine), microplate reader (Thermo Scientific), protein electrophoresis instrument and electrophoresis tank (BIO-RAD).

3.1 RIMVECs cell culture

RIMVECs were obtained with isolating primary cells from rat intestinal mucosal tissue following by performing stable passages. Cells were cultured in the complete medium for normal culture of RIMVECs: 1% antibody was added to high-sugar DMEM containing 10% fetal bovine serum (FBS) (both from Gibco, Grand Island, NY, USA), and 1% penicillin–streptomycin mixed solution (Solarbio, Beijing, China) at 37°C in a humidified incubator with 5% CO2 ^[26]. RIMVECs was frozen by the cryopreservation solution: Mix DMEM, FBS and DMSO in a ratio of 5:4:1 and mix well with the cells. The medium was refreshed every 2 days, and cells were passaged using 0.05% trypsin (Gibco).

3.2 Screening of the concentration of quercetin

RIMVECs were seeded on a 96-well cell culture plate (1×10⁴/well). When the cells grown to 80% and as monolayers, the original medium was aspirated and discard. Then different concentrations of quercetin were severally added and treated for 3, 6, 9, 12, 24 and 48 hours. After discarded the liquid, CCK-8 kit (Beyotime Biotechnology, China) which was applied by DMEM medium (incubate at 37°C for 40 min in the dark) was added, and measured the absorbance at 450nm with a microplate reader.

3.3 Test grouping

This experiment was divided into control group (complete medium), model group (10µg/mL LPS + 1mM ATP), LPS alone group (10µg/mL LPS), ATP alone group (1mM ATP) and drug treatment group (10µg/mL LPS + 1mM ATP and 5, 10, 20µM quercetin). Cells in each group were stimulated for 24 hours.

3.4 Western blot analysis,

RIMVECs were grouped and processed according to the above experiment. First, the supernatant was discard (washed three times with cold PBS), then added RAIP cell lysate for ten minutes, and collected the cells with a cell scraper to extract total protein. The protein concentration was determined with BCA protein detection kit (Beyotime Biotechnology, China), separated by SDS-PAGE, and transferred to PVDF (Bedford, MA, USA) membrane. Then the cell membrane was sealed with 5% bovine serum albumin (BSA) indoors for 1 hour at room temperature to prevent non-specific binding of the antibodies and incubated overnight at 4°C with specific primary antibodies of TLR4 (1:800), NLRP3(1:1000), GSDMD(1:1000), Caspase-1(1:1000), NF-κB p65 (1:1000), p-NF-κB p65(1:400), p-I-κB(1:1000), I-κB(1:1000), IL-18(1:1000), IL-1β(1:1000), β-tublin (1:1000) and ZO-1(1:1000), followed by incubation with HRP-conjugated secondary antibodies(1:5000)(ABclonal Technology)for 1 hour at room temperature. Ultimately, the blots were performed a chemiluminescence test by using a Tanon 5200 chemiluminescence imaging system (Shanghai, China). The image was analyzed by Image J software (National Institutes of Mental Health, Bethesda, MD, USA).

3.5 Enzyme-linked immunosorbent assay to measure the secretion of IL-18 and IL-1β

RIMVECs were spread in a 12-well Transwell chambers (1.13 cm²; 0.4µm pore size, Corning Costar Crop, Cambridge, MA) at 1×10⁵/well and grown as monolayers, and washed with PBS when the cell density reached 90%. Different groups were stimulated for 24 hours, then the supernatant of cell was collected, and the secretion of IL-1β and IL-18 were measured according to the instructions of the ELISA kit (enzyme, China).

3.6 Determination of mRNA levels of TLR4, NLRP3, Caspase-1, GSDMD and inflammatory factors

RIMVECs were plated on a 6-well cell culture plate at 1×10⁵/well. Total RNA and reverse transcription were purchased from Aidlab (Beijing, China). GAPDH primers were obtained from Sangon (Shanghai, China). Reverse transcription was performed using the Prime Script RT reagent kit (TAKARA). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using CFX9600 apparatus (Bio-Rad, Hercules, CA, USA) and the RT quantitative reaction was performed as follows: 94°C pre-denaturation for 30s, 94°C denaturation for 5s, 60°C annealing for 15s, and repeat 40 reaction cycles) to expand and calculate the relative mRNA expression level. Rat monoclonal antibodies for TLR4, NLRP3, Caspase-1, IL-1β, and IL-18 were all obtained from Abcam (Shanghai, China). The reaction system was 20µL, including RCR Forward Primer (10µmol/L, 0.4µL), PCR Reverse Primer (10µmol/L, 0.4µL), cDNA 0.8µL, ddH2O (8.4µL) and qPCR Supermix (10µL).

The gene sequences of rat-derived TLR4, GSDMD, Caspase-1, IL-1β and IL-18 were checked from GenBank. Primer Premier 5.0 design software was used to design the primers, which were synthesized by Sangon. Target gene expression was calculated with normalization to GAPDH values using the 2^−ΔΔCt method and the specific primer sequences of the target gene are shown in the Table 1.

Table 1

Primer sequence
Target gene	Primer sequence (5' to 3')
IL-18-1F	ACCGCAGTAATACGGAGCAT	20
IL-18-1R	TCTGGGATTCGTTGGCTGTT	20
Caspase-1-1F	TGGAGCTTCAGTCAGGTCCAT	21
Caspase-1-1R	ATGCGCCACCTTCTTTG TTC	20
TLR4-1F	ATGCCTCTCTTGCATCTGGC	20
TLR4-1R	TAGGAAGTACCTCTATGCAGGGAT	24
IL1-6F	CAGCTTTCGACAGTGAGGAGAA	22
IL1-6R	TCTTGTCGAGATGCTGCTGT	20
GSDMD-2F	AGATCGTGGATCATGCCGTC	20
GSDMD-2R	AGGGCTTGAAGCTGGTAGAAT	21

3.7 Confocal fluorescence microscope test

Cell slides were placed in a 24-well plate, and then spread the trypsinized RIMVECs cells on the plate. According to the experimental design, the culture medium of the treatment group was added for 24 hours and then the cell slide was taken out. After washing with pre-warmed PBS for three times, and then added 500µl paraformaldehyde (PFA) to each well for fixation for 40 minutes, followed by Permeabilized with 0.2%-0.5% Triton X-100 for 20 minutes, and washed three times with PBS before and after each step. The slides were incubated with the primary antibody was 4℃ overnight, and the secondary antibody (diluted with 5% BSA) at room temperature for 1 hour, protected from light. After washing, 1ug/mL DAPI was added to each well, and fixed the film in the dark at room temperature for 20 minutes, and then washed with PBS. Followed by washed, the slides were dried on clean dust-free paper, and taken out them. The slides were sealed by nail polishes, and observed with a confocal fluorescence microscope.

3.8 Cell flow cytometry

Adherent cells were digested by the trypsin, which combined with the supernatant (centrifuge at 300g for 5 min in a centrifuge). The cells were mixed with 0.1% BSA into a 1x10⁷/mL cell suspension. The Fc receptor blockers were used to reduce non-specific staining during staining. Then the fluorescent-labeled antibody was incubated according to the recommended amount in the instructions. After mixing, cells were incubated for 30 min at 4°C in the dark, and the cell staining buffer was added to resuspend the cells to analysis by using the flow cytometry.

3.9 Cell scratch test

First, we drew several horizontal lines by a marker pen on the back of the 6-well plate (draw a line about every 0.5-1cm across the holes, and at least 5 lines for each hole). RIMVECs cells with a cell concentration of 5×10⁵ cell/mL were added to each well, and the healing rate reached 100% after overnight. The next day, we used the pipette tip to scratch the vertical cell plane according to the marking line. After washed three times in PBS, the cells were cultivated in the fresh serum-free medium (cells were put in an incubator, 37°C, 5% concentration of CO2). The cells were taken out after 0, 2, 4, 6, 12 and 24 hours respectively, and observed under a microscope and photographed with TS-View. Image J software was used to process the pictures (draw 6–8 horizontal lines randomly between the scratches to calculate the average distance between cells).

3.10 Data processing

The test results were analyzed and processed with SPSS 19.0 software, and the test data were expressed as mean ± standard error (mean ± SEM). The difference between the test groups was detected by One-way ANOVA. It was generally considered that P < 0.05 is considered to be a difference and statistically significant.

4.1 The effect of quercetin on the survival rate of RIMVECs

The effect of quercetin on the survival rate of RIMVECs cells was first detected by the CCK-8 method. The results showed that quercetin had no effect on the survival rate of RIMVECs after 3, 6, 9, 12 hours. The effect of quercetin on RIMVECs for 24 hours on cell survival was shown in Fig. 1 below. Compared with the control group, the 320µM quercetin group had a significantly lower cell survival rate (P < 0.01). However, 80, 40, 20, 10, 5, 2.5 and 1.25µM quercetin had no significant effect on the survival rate of RIMVECs (P < 0.01) Fig. 1 (A, B). Therefore, referring to relevant literature and test results, 40, 20, 10 and 5µM quercetin were chosen for the next step.

4.2 Quercetin protects RIMVECs and reduces the effect of LPS and ATP on cell survival

Initially, to define whether quercetin has a protective role of survival rate on RIMVECs induced by LPS/ATP. The cell viability of RIMVECs was significantly decreased after being co-stimulated with 10µg/mL LPS and 1mM ATP for 24 hours. 5µM and 10µM quercetin significantly improved the survival rate of RIMVECs cells (P < 0.05) Fig. 1 (C).

4.3 The effect of quercetin on the mRNA levels of NLRP3 signaling pathway related proteins and inflammatory factors

4.3.1 The effect of quercetin on the mRNA levels of TLR4, Caspase-1 and GSDMD

Compared with the control group, the mRNA levels of TLR4 and GSDMD in the LPS/ATP group increased significantly (P < 0.01).10µM quercetin significantly reduced mRNA levels of TLR4 and GSDMD in LPS/ATP group (P < 0.01), while 5 and 20µM quercetin had no obvious effect on mRNA levels of TLR4 and GSDMD Fig. 2 (A, B). 5 and 10µM quercetin prominently suppressed the level of Caspase-1 mRNA in RIMVECs stimulated by LPS/ATP (P < 0.01), while 20µM quercetin had no obvious effect on the mRNA level of Caspase-1 Fig. 2 (C).

4.3.2 Determination of quercetin on the mRNA levels of IL-1β and IL-18

After LPS and ATP co-induced, IL-1β and IL-18 mRNA increased distinctly (P < 0.01). Compared with the control group, 5, 10, 20µM quercetin visibly restrained the mRNA level of IL-1β in RIMVECs (P < 0.01) Fig. 2 (D). 10 and 20µM quercetin efficiently decreased the mRNA level of IL-18 in RIMVECs (P < 0.01), while 5µM quercetin was far less effective to the mRNA level of IL-18 Fig. 2 (E).

4.4 The effect of quercetin on the expression levels of TLR4 and downstream pyroptosis-related proteins

The co-stimulation of LPS and ATP to RIMVECs aggrandized the protein expression levels of TLR4, NLRP3, pro-caspase-1, caspase-1 and GSDMD (P < 0.01) Fig. 3. Compared with the LPS/ATP group, 5, 10 and 20µM quercetin clearly reduced the protein expression levels of TLR4, NLRP3, pro-caspase-1, caspase-1 and GSDMD (P < 0.01).

The distribution and expression of NLRP3, GSDMD and Caspase-1 were detected by the immunofluorescence. 5, 10 and 20µM quercetin had taken a drop in the expression of NLRP3, GSDMD and Caspase-1. Among them, 5 and 10µM quercetin had an obvious down-regulation on NLRP3 and Caspase-1, while 20µM had a better effect on GSDMD Fig. 4.

4.5 The effect of quercetin on the expression level of NF-κB pathway related proteins

The NF-κB pathway is an important inflammatory signaling pathway that activates the NLRP3 inflammasome Fig. 5. The expressions of p-NF-κB p65 and NF-κB p65 in the LPS/ATP group were significantly increased, while the expression of I-κB decreased (P < 0.01). On the contrary, the three concentrations of quercetin all reduced the expression of p-NF-κB p65 and NF-κB p65, and 20µM could increase the expression of I-κB (P < 0.01) Fig. 5 (A, B, C).

4.6 The effect of quercetin on the protein expression and secretion of IL-1β and IL-18

It can be seen from Fig. 5 (D, E, F, I, J) that the co-stimulation of LPS and ATP up-regulated the protein expression and secretion levels of IL-1β and IL-18 in RIMVECs. Therefore, the total expression of IL-1β and IL-18 was consistent with above (P < 0.01). Among them, the protein expression levels of pro-IL-18/IL-18 and pro-IL-1β/IL-1β in the LPS alone group were increased (P < 0.05). But ATP alone had a slight increase on the protein expression levels of pro-IL-18/IL-18 and pro-IL-1β/IL-1β. 5, 10 and 20µM quercetin sharply inhibited the protein expression levels of pro-IL-18/IL-18 and pro-IL-1β/IL-1β in RIMVECs cells (P < 0.01).5 and 10µM quercetin exerted best effect on the IL-18 secretion of RIMVECs cells (P < 0.05) Fig. 5 (G, H).

4.7 The effect of quercetin on the migration of RIMVECs induced by LPS/ATP

As shown in Fig. 6 (A), the co-stimulation of LPS and ATP and the treatment of LPS alone for 24 hours both successfully inhibited the migration of RIMVECs (P < 0.01). 5, 10, 20µM quercetin observably promoted the migration of RIMVECs induced by LPS/ATP (P < 0.01). After 5, 10 and 20µM quercetin were added, the cell migration rates were 67%, 57%, and 59% respectively. 5µM quercetin most notably boosted the improvement of cell migration Fig. 6 (B).

4.8 Protein expression and distribution of ZO-1

ZO-1 is one of the important components of TJ. It not only participates in the transport of cell material, but also in the regulation of cell proliferation and differentiation, cell migration, gene transcription and other processes. The protein levels of ZO-1 in the LPS/ATP group were markedly reduced. 5 and 20µM quercetin significantly up-regulated the protein expression levels of ZO-1(P < 0.01), while 10µM quercetin had an upward trend but no Significant Fig. 7 (B, C). The results of fluorescence immunoassay for ZO-1 showed that ZO-1 in normal cells was evenly distributed on the cell surface to form a compact structure, while ZO-1 in the LPS/ATP group was diffuse with its expression declined.5, 10 and 20µM Quercetin up-regulated the expression of ZO-1 and improved its distribution on the cell surface. Among them, 5 and 20µM quercetin had a better effect, which was consistent with the results of protein level determination Fig. 7 (A).

4.9 Cell flow test results

In view of the current flow cytometry related methods for measuring scorch is not perfect. The degree of apoptosis and necrosis in cells were tested by the flow cytometry. The results were combined with key proteins above in the pyroptosis pathway to determine whether pyroptosis occurred. The proportion of late apoptotic cells and necrotic cells in the LPS/ATP group was much less, and the total apoptotic ratio had a sharp rise (P < 0.01). 5, 10 and 20µM quercetin all restrained the proportion of late apoptosis and necrosis in cells Fig. 8.

Quercetin is one of the effective ingredients of many traditional Chinese medicines such as rutin and quercetin. In the current study, we confirmed that quercetin had a protective effect on the damage of intestinal microvascular endothelial cells, and played an anti-pyroptosis effect through the signal pathway mediated by the NLRP3 inflammasome. Based on previous studies, quercetin could protect RIMVECs from PGN-induced cell inflammatory damage. Quercetin inhibited the mRNA and protein levels of TLR2 and TLR4, and down-regulated the protein expression levels of MyD88 to reduce the release of TNF-α ^[27]. Pyroptosis is a kind of programmed cell death that is different from apoptosis and necrosis. Experiments have shown that quercetin could effectively protect the inflammatory damage of RIMVECs induced by LPS ^[28], but the effect of LPS-induced pyroptosis of RIMVECs is not ideal. The main reason is that LPS needs further stimulation of ATP after activating cells to induce inflammasome activation and pyroptosis.

Therefore, this experiment used LPS and ATP to induce RIMVECs to establish a pyroptosis model. In this way, the protective and regulatory effects of quercetin on the disease process of bacterial enteritis can be evaluated from the aspect of endothelial cell with pyroptosis. LPS is a component in the outer wall of gram-negative bacteria. It can stimulate inflammation-related cytokines by binding to the TLR4 protein on the cell membrane surface, and further induce pyroptosis under the stimulation of ATP and TNF-α ^[29]. Our results showed that the combined action of LPS and ATP for 24 hours posed a threat to the survival of RIMVECs. In addition, western blot analysis was used to determine important indicators related to pyroptosis. It was found that compared with the normal cell group, the protein expression levels of TLR4, NLRP3, Caspase-1, and GSDMD were markedly increased, and the protein expression of IL -18, IL-1β also like this. These indicated that LPS and ATP work together successfully established a pyroptosis model of RIMVECs. On the contrary, quercetin (20, 10 and 5µM) improved the survival rate of cells, and attenuated the increase in the levels of pyroptosis-related indicators and inflammatory factor proteins, which were also consistent with the results of fluorescence immunoassay. Quercetin also effectively reduced the secretion of IL-1β and IL-18 which were detected by the ELISA method. These proved that quercetin played an important role in protecting RIMVECs from reducing inflammatory and pyroptosis damage. The mRNA levels of key pyroptosis proteins and inflammatory factors were evaluated by RT-PCR technology. Quercetin reduced the mRNA expression of key pyroptosis proteins and inflammatory factors, and 5, 10µM quercetin down-regulated key pyroptosis proteins significantly. However, 20µM quercetin had failed to inhibit these indicators. Therefore, we considered that there may be a certain difference between protein expression and mRNA expression, but its specific regulatory mechanism needs further study.

Relevant studies have confirmed that NF-κB can activate NLRP3 and up-regulate the expression of NLRP3 by specifically binding to nt-1303 to -1292 and nt-1238 to -1228 in the promoter region of NLRP3 ^[30]. Its inhibitory protein I-κB is also reduced ^[31]. The results of Western blot had shown that the combined action of LPS and ATP promoted the activation of NF-κB p65 and reduced the expression of I-κB. On the contrary, quercetin inhibited the increase of NF-κB p65 in protein levels and increased the protein expression levels of I-κB induced by LPS/ATP. Combined with above results, quercetin could restrain the activation of NLRP3 by inhibiting the TLR4/NF-κB/NLRP3 pathway, and defended the damage of LPS/ATP on RIMVECs.

In addition, the activation of NF-κB will also cause the transcription of TJ to be inhibited, which affects the normal structure, morphology, growth and migration of cells ^[32–34]. Through the cell migration test, it could be seen that LPS/ATP significantly inhibited the growth and migration of cells, and physical scratches were difficult to heal within 24 hours. Quercetin effectively promoted the growth and migration of cells. 5µM quercetin made the cell migration rate reach 67%. TJ is closely related to cell growth and migration. If it is inhibited or missing, it will cause tremendous damage to cell scratch healing, in addition delay migration and decrease value increase ^[35–37]. ZO-1 is one of the important members of TJ, and it has been proven to be widely used to judge the level of intestinal mucosal barrier damage ^[38–39]. Our test also detected the expression and distribution of ZO-1. The results of fluorescence immunoassay showed that the spread of ZO-1 in LPS/ATP group was destroyed, and the structure of ZO-1 was damaged which was originally distributed around the cell membrane and nucleus, while quercetin could up-regulate the protein expression of ZO-1 and restore the distribution of ZO-1. Overall, quercetin had a protective effect on the TJ between RIMVECs. Finally, late apoptosis, necrosis and total apoptosis rate were examined by the cell flow cytometry. The results shown that quercetin significantly reduced the number of late apoptosis and necrosis cells. Relevant studies had confirmed that the membrane permeability of late apoptosis and necrotic cells will increase, and intestinal mucosal damage, apoptosis and necrosis in intestinal diseases are also related to the massive infiltration of inflammatory cells and release of inflammatory factors, which may aggravate reactions such as cell pyroptosis ^[40].

In the organism's intestinal inflammatory response, MEC acts as an intestinal barrier, which can absorb inflammatory factors in tissues and inflammatory lesions and remove bacterial pathogenic products. When LPS enters the intestinal mucosal microvascular system, TLR4 on the surface of endothelial cells first recognizes and binds to pathogens, and then activates NLRP3 Inflammasome through the TLR4/NF-κB signaling pathway. After that, it will activate Caspase-1 to cut GSDMD, causing a series of pyroptosis phenomena such as cell rupture and cell membrane pores ^[41–43], and releasing inflammatory factors such as IL-1β and IL-18 to expand the inflammatory response. At the same time, activation of NF-κB also inhibits the expression of ZO-1, affecting the TJ, and the growth and migration of cells. In summary, this study proved that quercetin can protect RIMMVECs from pyroptosis caused by LPS/ATP, and enhance the ability of the TJ between cells, and cell growth and migration. However, its effects on non-classical pathways of pyroptosis and other aspects still need to be further studied.

We have proved through research that quercetin can down-regulate the inflammatory response and pyroptosis in RIMVEC caused by LPS/ATP through the TLR4/NF-κB/NLRP3 signaling pathway. Quercetin also significantly inhibited the destruction of TJ between cells and ZO-1 protein by LPS/ATP. In addition, quercetin also contributes to promote the ability of cell migration and reduce cells in a state of late apoptosis and necrosis. The above conclusions jointly support that quercetin can be used as a drug for the treatment of bacterial enteritis and pyroptosis-related diseases.

RIMVECs=Rat intestinal mucosal endothelial cells

BCA=Bicinchoninic acid

SDS-PAGE=Sodium dodecyl sulfate-Polyacrylamide gel electrophoresis

PVDF=Poly(1,1-difluoroethylene)

I-κB=Inhibitor of NF-κB

GAPDH=Glyceraldehyde-3-phosphate dehydrogenase

DAPI=4',6-diamidino-2-phenylindole

CCK-8=Cell Counting Kit-8

PGN=Peptidoglycan

TNF-α=Tumor necrosis factor-α

Ethics approval and consent to participate

Not applicable.No animal and human test, only cell test is carried out in this project.

Consent to publish

Not applicable.

Availability of data and materials

The datasets used or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

There is no conflict of interest in this study.

Funding

This work was supported by the National Key R&D Program of China (no.2017YFD0501504), and the National Natural Science Foundation of China (no. 3197190289).

Authors' Contributions

Huixin Zhang: methodology, experimentation, data analysis, article writing; Yeye Li: conceptualization, article revision & comment; Zhongjie Liu: review, supervision, editing, and fundraising.

Acknowledgements

This work was supported by the National Key R&D Program of China (no.2017YFD0501504), and the National Natural Science Foundation of China (no. 3197190289).

Kaelin WG Jr, Ratcliffe PJ. Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Mol Cell,2008; 30, 393-402
Tolstanova G, Deng X, French SW, Lungo W, Paunovic B, Khomenko T, Ahluwalia A, Kaplan T, Dacosta-Iyer M, Tarnawski A, Szabo S, Sandor Z. Early endothelial damage and increased colonic vascular permeability in the development of experimental ulcerative colitis in rats and mice. Lab Invest ,2012, 92,9-21
H. Saijo, N. Tatsumi, S. Arihiro, T. Kato, M. Okabe, H. Tajiri and H. Hashimoto, Microangiopathy triggers, and inducible nitric oxide synthase exacerbates dextran sulfate sodium-induced colitis, Lab. Invest., 2015, 95, 728-748.
MEERA C. HELLER, MUNASHE CHIGERWE. Diagnosis and Treatment of Infectious Enteritis in Neonatal and Juvenile Ruminants. The Veterinary Clinics of North America. Food Animal Practice,2018,34,101-117.
I. Spadoni, E. Zagato, A. Bertocchi, R. Paolinelli, E. Hot, A. D. Sabatino, F. Caprioli, L. Bottiglieri, A. Oldani, G. Viale, E. Dejana and M. Rescigno, A gut-vascular barrier controls the systemic dissemination of bacteria, Science,2015, 350, 830–834.
Chen Xueliang et al. NEK7 interacts with NLRP3 to modulate the pyroptosis in inflammatory bowel disease via NF-κB signaling. Cell death & disease, 2019, 10,906-906.
Liu Beihua, Hou Liang, Luo Weijue, et al. LPS and ATP co-induce the activation of NLRP3 inflammasome in macrophages. Journal of Beijing University of Agriculture,2018,33,74-78.
Mechanism and Regulation of NLRP3 Inflammasome Activation. Trends in biochemical sciences, 2016,41,1012-1021.
Karen V. Swanson and Meng Deng and Jenny P.-Y. Ting. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nature Reviews Immunology, 2019, 19,477-489.
HE, CHANGLIANG, ZHAO, YI, JIANG, XIAOLIN, et al. Protective effect of Ketone musk on LPS/ATP-induced pyroptosis in J774A.1 cells through suppressing NLRP3/GSDMD pathway. International immunopharmacology,2019,71,328-335.
MEZZASOMA, LETIZIA, ANTOGNELLI, CINZIA, TALESA, VINCENZO NICOLA. Atrial natriuretic peptide down-regulates LPS/ATP-mediated IL-1 beta release by inhibiting NF-kB, NLRP3 inflammasome and caspase-1 activation in THP-1 cells. Immunologic Research: A Selective Reference to Current Research and Practice,2016,64,303-312.
Groß Christina J, Mishra Ritu, Schneider Katharina S, et al. K+ Efflux-Independent NLRP3 Inflammasome Activation by Small Molecules Targeting Mitochondria. Immunity,2016,45,761-773.
JING ZHANG, GUOCHAO WU, ANSHAN SHAN, et al. Dietary glutamine supplementation enhances expression of ZO-1 and occludin and promotes intestinal development in Min piglets. Acta Agriculturae Scandinavica, Section A -Animal Science,2017,67,15-21.
XU, JIA, LIU, ZHIHAO, ZHAN, WEI, et al. Recombinant TsP53 modulates intestinal epithelial barrier integrity via upregulation of ZO-1 in LPS-induced septic mice. Molecular medicine reports,2018,17,1212-1218.
Curcumin protects against the intestinal ischemia-reperfusion injury: involvement of the tight junction protein ZO-1 and TNF-α related mechanism. The Korean Journal of Physiology and Pharmacology,2016,20,147-152.
RUIZHI HU, ZIYU HE, MING LIU, et al. Dietary protocatechuic acid ameliorates inflammation and up-regulates intestinal tight junction proteins by modulating gut microbiota in LPS-challenged piglets. Journal of Animal Husbandry and Biotechnology,2021,12,328-339.
YAZICI, SELCUK, OZCAN, CANSU UNDEN, HISMIOGULLARI, ADNAN ADIL, et al. Protective Effects of Quercetin on Necrotizing Enterocolitis in a Neonatal Rat Model. American Journal of Perinatology,2018,35,434-440.
CHEN, WEISHI, ZHOU, LILI, QIAO, YONG, et al. Quality Evaluation of Ilex asprella Based on Simultaneous Determination of Five Bioactive Components, Chlorogenic Acid, Luteoloside, Quercitrin, Quercetin, and Kaempferol, Using UPLC-Q-TOF MS Study. Journal of AOAC International,2019,102,1414-1422.
TRUONG, VAN-LONG, KO, SE-YEON, JUN, MIRA, et al. Quercitrin from Toona sinensis (Juss.) M.Roem. Attenuates Acetaminophen-Induced Acute Liver Toxicity in HepG2 Cells and Mice through Induction of Antioxidant Machinery and Inhibition of Inflammation. Nutrients,2016,8,431.
ZHI, KANGKANG, LI, MAOQUAN, BAI, JUN, et al. Quercitrin treatment protects endothelial progenitor cells from oxidative damage via inducing autophagy through extracellular signal-regulated kinase. Angiogenesis,2016,19,311-324.
Zhou Xiaohong, Xu Feilong, Chen Jian. Effect of gemcitabine combined with quercetin on apoptosis of pancreatic cancer cell Panc-1. Medicine and health technology,2013,35,542-546.
Suzuki Takuya and Hara Hiroshi. Role of flavonoids in intestinal tight junction regulation. The Journal of nutritional biochemistry, 2011, 22,401-408.
Motoi Tamura, Yosuke Matsuo, Hiroyuki Nakagawa, Chigusa Hoshi and Sachiko Hori. Isolation of a Quercetin-metabolizing Bacterium 19- 20 from Human Feces. Food Science and Technology Research, 2017, 23 ,145-150.
Rong Li, Lin Chen, Guo-Min Yao, Hong-Lin Yan, Li Wang. Effects of quercetin on diabetic retinopathy and its association with NLRP3 inflammasome and autophagy. International Journal of Ophthalmology,2021,14,42-49
Su Kang Yi; Yu ChaoYuan, Chen YaPing, et al. 3,4-Dihydroxytoluene, a metabolite of rutin, inhibits inflammatory responses in lipopolysaccharide-activated macrophages by reducing the activation of NF-κB signaling. BMC Complementary Medicine and Therapies,2014, 14, 21.
Liu Ping. Establishment and characterization of a rat intestinal microvascular endothelial cell line. Tissue and Cell, 2021,72,101573.
Yifei Bian, Liu Ping, Hu Yusheng, et al. Baicalin regulates the secretion of inflammatory factors by LPS-induced rat intestinal mucosal microvascular endothelial cells through the TLR4 /NF-κB pathway. Heilongjiang Animal Science and Veterinary Medicine, 2018,19,15-18.
Yifei Bian.The protective effect of purslane on rats with experimental enteritis and its mechanism. Beijing: China Agricultural University,2018.
Chengcheng Du, Yin Ting, Rujing Ren, et al. Research progress of anti-endotoxemia mechanism based on lipopolysaccharide-Toll-like receptor 4 signaling pathway. International Journal of Pharmaceutical Research,2017,44,1107-1112.
Qiao Yu. Study on the mechanism of TLR-induced NF-κB activation and up-regulation of NLRP3 expression. Shandong University, 2012.
CHEON, PARK JIN; Nam, Hyeon Hwa; Nan, Li; Kil, Choo Byung. The Functional Effects on Anti-oxidant and Anti-inflammation of Veronica persica Poir. Extracts. Korea Journal of Organic Agriculture,2018,26, 661-676.
JIANG, WEI-DAN, WEN, HAI-LANG, LIU, YANG, et al. The tight junction protein transcript abundance changes and oxidative damage by tryptophan deficiency or excess are related to the modulation of the signalling molecules, NF-kappa B p65, TOR, caspase-(3,8,9) and Nrf2 mRNA levels, in the gill of young grass carp (Ctenopharyngodon idellus). Fish & Shellfish Immunology,2015,46,168-180.
Gill structural integrity changes in fish deficient or excessive in dietary isoleucine: Towards the modulation of tight junction protein, inflammation, apoptosis and antioxidant defense via NF-kappa B, TOR and Nrf2 signaling pathways. Fish & Shellfish Immunology,2017,63,127-138.
Park SongYi, Jang Hwanseok, Kim SeonYoung, Kim Dasarang, Park Yongdoo, Kee SunHo. Expression of E-Cadherin in Epithelial Cancer Cells Increases Cell Motility and Directionality through the Localization of ZO-1 during Collective Cell Migration. Bioengineering ,2020,8,65.
GUO G, SHI F, ZHU J, et al. Piperine, a functional food alkaloid, exhibits inhibitory potential against TNBS-induced colitis via the inhibition of IκB-α/NF-κB and induces tight junction protein (claudin-1, occludin, and ZO-1) signaling pathway in experimental mice. Human & Experimental Toxicology,2020,39,477-491.
Hippophae rhamnoides polysaccharides protect IPEC-J2 cells from LPS-induced inflammation, apoptosis and barrier dysfunction in vitro via inhibiting TLR4/NF-kappa B signaling pathway. International Journal of Biological Macromolecules: Structure, Function and Interactions,2020,155,1202-1215.
Tian Shuying, Guo Ruixue, Wei Sichen, Kong Yu, Wei Xinliang, Wang Weiwei, Shi Xiaomeng, Jiang Hongyu. Curcumin protects against the intestinal ischemia-reperfusion injury: involvement of the tight junction protein ZO-1 and TNF-α related mechanism. The Korean Journal of Physiology and Pharmacology,2016,20,147-152.
Ruiya Zhang, Lina Dong, Fengxia Li, et al. Correlation between fecal and intestinal mucosal flora and tight junction protein ZO-1 in patients with functional gastrointestinal disease. Chinese Medicine,2017,12,1193-1196.
TORNAVACA, OLGA, CHIA, MINGHAO, DUFTON, NEIL, et al. ZO-1 controls endothelial adherens junctions, cell-cell tension, angiogenesis, and barrier formation. The Journal of Cell Biology,2015,208,821-838.
Bu Nan, Wang Ye, Wang Rui, et al. Experimental study of tripterygium polyglycosides through JAK2/STAT3 signaling pathway to reduce intestinal mucosal cell apoptosis and inflammation in rats with ulcerative colitis. Modern Digestive and Interventional Diagnosis and Treatment, 2019, 24,466-470.
Zhixin Liu, Yaozhen Chen, Jinmei Xu, et al. Heme-activated pyrin domain-containing NOD-like receptor family protein 3 (NLRP3) inflammasome induces renal tubular epithelial cell pyrolysis. Journal of Cellular and Molecular Immunology, 2020, 36,809-814.
HE, CHANGLIANG, ZHAO, YI, JIANG, XIAOLIN, et al. Protective effect of Ketone musk on LPS/ATP-induced pyroptosis in J774A.1 cells through suppressing NLRP3/GSDMD pathway. International immunopharmacology,2019,71,328-335.
WENJING DONG, QIUSHUANG ZHU, BINGWEI YANG, et al. Polychlorinated Biphenyl Quinone Induces Caspase 1-Mediated Pyroptosis through Induction of Pro-inflammatory HMGB1-TLR4-NLRP3-GSDMD Signal Axis. Chemical research in toxicology,2019,32,1051-1057.

Download PDF

Version 1

posted

You are reading this latest preprint version

Quercetin Protects RIMVECs From Inflammatory Damage, Pyroptosis and Cell Migration by Inhibiting the TLR4/NF-κB/NLRP3 Pathway

Status:

Version 1

Abstract

Figures

1 Introduction

2 Material

2.1 Main drugs and reagents

2.2 Main instruments

3 Method

3.1 RIMVECs cell culture

3.2 Screening of the concentration of quercetin

3.3 Test grouping

3.4 Western blot analysis,

3.5 Enzyme-linked immunosorbent assay to measure the secretion of IL-18 and IL-1β

3.6 Determination of mRNA levels of TLR4, NLRP3, Caspase-1, GSDMD and inflammatory factors

3.7 Confocal fluorescence microscope test

3.8 Cell flow cytometry

3.9 Cell scratch test

3.10 Data processing

4 Results

4.1 The effect of quercetin on the survival rate of RIMVECs

4.2 Quercetin protects RIMVECs and reduces the effect of LPS and ATP on cell survival

4.3 The effect of quercetin on the mRNA levels of NLRP3 signaling pathway related proteins and inflammatory factors

4.3.1 The effect of quercetin on the mRNA levels of TLR4, Caspase-1 and GSDMD

4.3.2 Determination of quercetin on the mRNA levels of IL-1β and IL-18

4.4 The effect of quercetin on the expression levels of TLR4 and downstream pyroptosis-related proteins

4.5 The effect of quercetin on the expression level of NF-κB pathway related proteins

4.6 The effect of quercetin on the protein expression and secretion of IL-1β and IL-18

4.7 The effect of quercetin on the migration of RIMVECs induced by LPS/ATP

4.8 Protein expression and distribution of ZO-1

4.9 Cell flow test results

5 Discussion

6 Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1