Chemicals and antibodies.
Dulbecco’s modified medium/Ham’s F12 (DMEM/F12 1:1),Dulbecco's Modified Eagle's Medium (DMEM), B27 and anti-rabbit Alexa Fluor® 488-labeled were purchased from Life Technologies Corporation (Carlsbad, CA, USA) Fetal bovine serum (FBS) from Internegocios (Buenos Aires, Argentina). Rabbit anti-β-Tubulin III antibody from Sigma (St. Louis, MO, USA), mousse anti-synaptophysin, mousse anti- β-Actin and KT572049 from Santa Cruz (Dallas, Texas, USA) and anti-mouse Cy3-labeled from Millipore (Massachusetts, USA). Quick-Zol from Kalium (Buenos Aires, Argentina). RNase-free RQ1 DNase enzyme, Reverse Transcriptase enzyme M-MLV from Promega (Wisconsin, USA). TAQ polymerase buffer, dNTPs and TAQ polymerase from TransGen Biotech (Beijing, China). Protease inhibitor cocktail, poly-D-lysine (PDL), epidermal growth factor (EGF), human basic fibroblast growth factor (bFGF), lipopolysaccharide (LPS) and Phosphatidylcholine (P3556) from egg yolk source were from Sigma (St. Louis, MO, USA). As specified in product information, they have a purity over 99% and a fatty acid content of approximately 33% palmitic, 13% stearic, 31% oleic, and 15% linoleic. In addition the detailed fatty acid composition of the mixture of egg yolk phosphatidylcholine and phosphatidylethanolamine has been recently described50, 51.
Animal studies and fetal neural stem cells culture.
All animal experiments and related experimental protocols were approved by the Bioethics Commission for the Management and Use of Laboratory Animals of National University of Rosario, Argentina (N 6060/89). All procedures were carried out in accordance with the approved guidelines (Guide for the care and use of Laboratory Animals- 8° edition- e National Academies Press-Washington DC 2011 and in compliance with the ARRIVE guidelines). Time pregnant female C57/BL6 mice (gestation day 13) were sacrificed by cervical dislocation under supervision of the Animal Care and Use Committee. Neurospheres were obtained from E13 cortical cells as previously described52. Briefly, the lateral portion of the dorsal telencephalon (cortex) of embryonic day 13 mouse C57/BL6 was isolated. The cortices were chemically disrupted adding trypsin (0.05% w/v) for 5 minutes and then mechanically disrupted into single cells by repeated pipetting in medium DMEM/F12 (1:1) containing 10% FBS, penicillin G (100 units/ml) and streptomycin (100 μg/ml). Cells were centrifugated at 1000 rpm for 5 min and the pellet resuspended in serum-free medium DMEM/F12 (1:1). Dissociated cells were cultured at a density of 5 × 104 cells/ml in medium DMEM/F12 (1:1) supplemented with B27, 10 ng/ml bFGF and 10 ng/ml EGF, at 37 °C in a humidified 5% CO2 incubator. Within 7 days, cells grew as free coating neurospheres that were then collected by centrifugation, and chemically and mechanically dissociated to obtain a new passage. For cell differentiation, neurospheres were chemically and mechanically dissociated. After counting, 2.5 105 cells were plated on poly-D-lysine (PDL) (10 μg/ml)-coated 24 well plates, or 5 × 104 cells were plated on PDL (10 μg/ ml)-coated 96 well plates in medium DMEM/F12 (1:1) supplemented with B27.
Macrophages culture and LPS-induced stimulation.
The mouse cell line Raw 264.7 (ATCC® TIB-71™) was cultured in DMEM 10% FBS supplemented with penicillin G (100 units/ml), streptomycin (100 μg/ml) (proliferation conditions) and maintained in a 5% CO2 humidified incubator at 37 °C. For activation, cells were grown to 80% confluence in petri dishes with DMEM medium supplemented with 10% FBS. At this time, cells were centrifuged at 1500 rpm for 10 minutes. The cell pellet was resuspended in 1 ml of DMEM/F12 medium and cells were transferred to a new plate containing DMEM/F12 stem cell medium (in the absence of FBS, B-27 and growth factors). For stimulation, pure LPS was added in a final concentration of 1 µg/ml. After 18 hours of incubation, cells were centrifugated at 1000 rpm for 5 minutes and the culture medium was filtered through 0.22 μm filters (Sartorius) and stored immediately at -80 °C.
Total RNA isolation, DNase treatment and retrotranscription reaction
Murine macrophage RAW 264.7 total RNA was extracted in Quick-Zol (Kalium) following the supplier's specifications. Briefly, cells were resuspended in 1 ml Quick-Zol and incubated for 5 minutes at room temperature. Then, 0.2 ml of chloroform was added and they were centrifuged at 12,000 rpm for 10 minutes at 4 °C. Then, the aqueous phase was transferred to a new tube, 0.5 ml of isopropanol was added and the samples were incubated for 24 hours at -20 °C. The following day, they were centrifuged at 12,000 rpm for 10 minutes at 4 °C, the pellet was washed with 75% ethanol and centrifuged again at 12,000 rpm for 5 minutes at 4 °C. To evaluate the quality and quantity of the RNA obtained, absorbance measurements were made at 230, 260 and 280 nm (NanoVue Plus, General Electrics). Next, 1 µg of RNA was seeded on a 1.8% agarose gel to evaluate its integrity. To remove DNA from the samples, 10 μg of the RNA / DNA mixture was treated for 2 hours with the RNase-free RQ1 DNase enzyme (Promega) at 37 °C. The reaction was then stopped by incubating the sample at 65 °C for 10 minutes. Once the treatment was completed, the RNA concentration was determined spectrophotometrically (NanoVue Plus, General Electrics). For the reverse transcription reaction, 2 μg of RNA was treated with the Reverse Transcriptase enzyme M-MLV (Promega) strictly following manufacturer’s instructions. For a final volume of 25 μl: oligo dT 20 ng/μl, dNTPs 0.5 mM each, buffer M-MLV 5 X, RNase inhibitor 0.8 U/μl and M-MLV Reverse Transcriptase 8 U/μl were added.
Polymerase chain reaction (PCR)
The PCR reactions were performed in the following buffer for a final volume of 50 μl: 1X TAQ polymerase buffer, 3 mM MgCl2, 25 μM dNTPs each, 0.4 pmol/μl oligonucleotides each, 0.2 U/μl of TAQ polymerase (Easy TAQ, TransGen Biotech). Gene Amp (Parkin-Elmer, Shelton, CT, USA) or My Cycler (BioRad, USA) thermal cyclers were used. The oligonucleotides sequences (5’-3’) used are: IL-1β Forward TTCAGGCAGGCAGTATCACTC, IL-1β Reverse GAAGGTCCACGGGAAAGACAC; IL-6 Forward TAGTCCTTCCTACCCCAATTTCC, IL-6 Reverse TTGGTCCTTAGCCACTCCTTC; TNF-α Forward CCTGTAGCCCACGTCGTAG, TNF-α Reverse GGGAGTAGACAAGGTACAACCC. The amplification reaction started with an initial denaturation for 10 min at 94 °C followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 60 °C for 30 s and elongation at 72 °C for 30 s. The last cycle was followed by a 10-min extension step at 72 °C. The amplified products were analyzed by ethidium bromide-stained agarose gel electrophoresis.
Cell viability and proliferation assays
Cell viability was assessed by MTT-reduction assay. After cell treatment, MTT (5 mg/ml) was added to the cell culture medium at a final concentration of 0.5 mg/ml and incubated for 4 hours at 37°C, 5% CO2. The assay was stopped by replacing the MTT-containing medium with DMSO. The extent of MTT reduction was measured spectrophotometrically at 570 nm 53. Results are expressed as a percentage of the control.
Proliferation of NSCs was assayed by measuring neurosphere’s diameter 54. Briefly, 5000 living cells were seeded per well in 24-well plates and cultured for up to 96 hours to evaluate the expansion rates. Size of 100 neurospheres (expressed as neurospheres diameters) was measured in three independent experiments. Images were taken with a microscope Olympus BH-2 and analysed using the freeware image J (National Institutes of Health, freeware).
Liposome preparation
Concentrated lipid stocks were prepared as previously described55. Briefly, pure lipids were diluted in chloroform and dried in acid-washed glass centrifuge tubes under a stream of nitrogen. Phospholipid samples were suspended at 2–6 mM in phosphate-buffered saline at pH 7.2 and sonicated twice for 5 min at power setting 0.2–0.5% amplitude. All samples were sterilized with 0.22 μm-pore filters (Sartorius). The recovery of phospholipids after filtration was typically 90% or more.
Immunocytochemistry
Cells were cultured on PDL (10 μg/ml)-coated glass coverslips in 24-well plates as previously described15. After different time of incubation, cells were fixed in 4% (w/v) paraformaldehyde-sucrose for 30 min at room temperature, permeabilized with 0.2% Triton X100 and blocked for 1 hour in 5% BSA. Cells were incubated with the primary antibody overnight at 4 °C followed by incubation with the fluorescently labelled secondary antibody for 1 hour at room temperature. Primary and secondary antibodies were diluted as follows: rabbit anti-βIII-tubulin (1:500) mouse anti-synaptophysin (1:300), anti-rabbit Alexa Fluor® 488-labeled (1:500) and anti-mouse Cy3-labeled (1:300). To visualize nuclei, cells were counterstained and mounted with ProLong Gold antifade reagent containing DAPI (Molecular probes, Life technologies).
Microscopy and Image Analysis
Micrographs were acquired using a confocal microscope (Zeiss LSM 880) or the Nikon Model Eclipse 800 microscope and quantitative analyses were performed with Image J” (NIH). Cells were counted from twenty randomly selected fields per well for each individual experiment. At least three independent experiments were performed. The percentage of neuronal cell population was calculated against the DAPI-positive total cell number which includes undifferentiated stem cells and differentiated neurons. Cells bearing at least one neurite equal or longer than the soma diameter were considered to be differentiated. Soma size and number of synaptophysin containing vesicles were measured and counted manually. To differentiate dystrophic and normal neuronal populations, 100 neurons from each experiment were manually selected and analysed.
Western blot analysis
Western blot experiment was developed following protocols previously described15, 42. Neurosphere-derived cells were plated at a density of 1.5 × 105 and cultured on PDL-coated 35 mm culture dishes under differentiation conditions. Three days later, cells were collected, resuspended in lysis buffer (50 mM Tris-HCl pH 8.0, 50 mM KCl, 10 mM EDTA, Nonidet P-40 1%, 20 mM NaF, 1 mM Na3VO4, 1 mM PMSF and 1:1000 protease inhibitor cocktail) and sonicated five times at 5% amplitude for 5 s (Sonics and Materials Inc–Vibra CellTM). Protein concentration was determined using bovine serum albumin (BSA) as standard protein and “PierceTM BCA Protein Assay Kit (Thermo Scientific)”. 20 μg of cell lysate were resolved on 12% SDS-polyacrilamide gel electrophoresis (PAGE) and transferred to a nitrocellulose membrane (Amersham, GE Healthcare). After blocking overnight with 5% non-fat milk in 0.1% Tween TBS and washing, blots were incubated with anti-synaptophysin (1:300) overnight at 4 °C. Peroxidase-conjugated anti-mouse IgG (1:8000, Jackson Immuno Research) was used as secondary antibody. For loading protein control anti-β-Actin (1:6000) was used and developed with secondary antibody peroxidase-conjugated anti-mouse IgG (1:8000, Jackson Immuno Research). Labelled proteins were detected with chemiluminescence reagents (AmershamTM ECLTM Prime Western Blotting Detection Reagent, GE Healthcare).
Statistical analysis
Data represent the mean value ± SEM of at least three independent experiments and each individual experiment was performed in technical triplicate. Statistical significance was determined by either Student’s t-test or One-Way ANOVA followed by Tukey's test using Prism (GraphPad Software Inc,). p-values lower than 0.05 were considered statistically significant.