Data collection and preprocessing
According to GDC data portal (https:// portal.gdc.cancer.gov/), the row count expression matrix and FPKM expression matrix of TCGA-HNSC cohort was acquired. Tumors in the oral cavity consist of, oral cavity, buccal mucosa, alveolar ridge, lip, hard palate and tongue. Cases with no clinical data or incomplete details were excluded. The STRING website (https://string-db.org/) was employed to discover their associations and establish a PPI network. Transcription factor prediction for LHPP was carried out based on GCBI database (https://www.gcbi.com.cn/gcanalyze/html/generadar/index).
Bioinformatic analysis
We used the R package “edgR” for differentially expressed gene (DEG) analysis and the cutoff values for mRNAs exhibiting the differential expression were set as: |log2 FC|>1 and FDR < 0.05. R package “ggplot2” was employed in terms of dot plots, boxplots and volcano-plots (R version 3.6.1).
Tissue Sample
In total, 23 OSCC histopathological samples were obtained from School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University, patients provided informed consent before operation. The tumor grade was classified according to the WHO classification of histological differentiation. This research was carried out with the approval of the Ethics Committee of Shandong University School of Stomatology (No. 20210119). The researchers implemented the overall procedure according to the principles of the Declaration of Helsinki.
Cell Culture and Reagents
The Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China) offered oral squamous carcinoma cell lines (SCC15, SCC25). All OSCC cell lines were cultured in DMEM-F12 medium supplemented with 1% penicillin-streptomycin as well as 10% FBS (Gibco, Grand Island, NY, USA), and incubated in a 5% CO2, 37°C humidified incubator. Antibodies to LHPP, Akt, PI3K,p-Akt, p-PI3K, Bax, Bcl-2, Cleaved-Caspase 3 were purchased from Abcam (MA, USA). Proteintech (Wuhan, China) offered anti-GAPDH.
Cell transduction and treatment
SCC15 and SCC25 cells were trans ducted with lentivirus: Ubi-MCS-3FLAG-SV40-puromycin (Genechem, Shanghai, China) at a multiplicity of infection (MOI) of 50 and 20 for 14h, HitransG P and HitransG A virus infection reagents were added, respectively, then co-culture with 1ug/ mL and 5ug/ mL puromycin for 14 days, finally, we obtained the SCC15 and SCC25 cells line that stably expressed LHPP. The full-length transcript of LHPP was in NM_022126.4. The OE-LHPP group is the cells that overexpress LHPP. The Vector group is the control blot for OE-LHPP, that is, it is infected with lentivirus but does not express LHPP. The OE-LHPP group cells were pretreated with 8µg/ml AKT activator SC79, which was bought from MedChemExpress.
Cell proliferation Assay
We seeded the NC, Vector, OE-LHPP group cells of SCC15 and SCC25 in the 96-well plate at the density of 5 × 103 cells per well. After the incubation for 24 h, 48 h and 72 h, the viability of cells was ascertained based on the Cell Counting Kit-8 assays (CCK8, solarbio, Beijing, China).
The ethynyl deoxyuridine (EdU) incorporation assay was used to test the effect exerted by LHPP on the cell proliferation of SCC15 and SCC25. We seeded NC, Vector, OE-LHPP group cells of SCC15 and SCC25 in a 48-well culture plate at the density of 1× 104 cells per well. Incubated for 24 hours, added EdU regents (RIBOBIO, Guangzhou, China) to each well and incubated for 2 hours. And then, fixed with 4% paraformaldehyde, cleaned by PBS, Apollo stained for 30 minutes, DNA stained for 30 minutes, and fully washed with PBS. Finally, photographed under an optical microscope (Olympus BX53, Tokyo, Japan) for cell proliferation analysis.
Invasion Assay
We performed the transwell invasion assay for detecting the effect exerted by LHPP on the invasion ability of SCC15 and SCC25. First, the 8 µM pore-sized transwell chambers coated with matrigel were inserted in 24-well plate. Subsequently, 800 µL of a medium containing 10% FBS was introduced to the lower chambers. Next, cells suspended with serum-free DMEM-F12 were plated into the upper chamber. After the incubation was performed for different periods, the cells penetrating the cell membrane were fixed in 4% paraformaldehyde and received the 30 min staining with crystal violet. A cotton swab was used to to take out the cells inside the upper chamber. Rinsed with PBS, then pictures were captured based on an optical microscope (Olympus BX53, Tokyo, Japan). Lastly, the cells were counted.
Scratch Assay
The NC, Vector, OE-LHPP group cells of SCC15 and SCC25 were plated in 6-well plates, when cells reached 50% confluence, using a pipette tip to create a vertical scratch on the surface of the plate. Next, the mentioned plates were cleaned by using a serum-free medium. Afterwards, this study carried out the incubation of the plates by using DMEM medium with 1% FBS contained. Finally, at the specified time, we took pictures on the use of an optical microscope (Olympus BX53, Tokyo, Japan).
Clone Formation Assay
The NC, Vector, OE-LHPP group cells of SCC15 and SCC25 were seed in 6-well plates 600 cells per well. Subsequently, the 14-day culture was performed, and the clone mass grew into a mass containing 50 cells. The cells were cleaned by using PBS. They received the fixing in 4% methanol and then the dying with 0.1% crystal violet. Furthermore, the colonies with over 50 cells covered were counted.
Immunohistochemical (IHC) staining
The OSCC specimens and paraffin-embedded xenografts were made into 5 µm sections, fixed on the slides. The tissue on the slides were then dewaxed, hydrated, 1% BSA blocked for 20 minutes. LHPP antibody (1:200) was incubated overnight at 4℃, and Goat-Anti-Rabbit antibody (1:300) was incubated at 37℃ for 1 h. Satisfied staining was obtained under the use of diaminobenzidine (DAB) (Sigma, Mo, USA). Lastly, we used methyl green to stain, gradient alcohol and xylene to dehydrate, a neutral adhesive to seal, and a fluorescence microscope (Olympus, Tokyo, Japan) to observe. The degree of LHPP expression in the tissue is shown in the image as the depth and area of the immunostain. Image analysis software (IPP 6.0) can be used to quantitatively measure the degree of IHC staining. As one of the commonly used indexes in quantitative analysis of IHC results, the mean optical density (MOD) value can better reflect the protein intensity expressed by positive cells. So, we used the MOD value calculated by IPP to reflect the LHPP expression.
HE staining
After the samples were deparaffinized and hydrated, they were stained with hematoxylin for 10 min, cleaned with PBS. Then they were stained with eosin for 10 minutes and washed with PBS. Finally, dehydration and sealing with neutral gum, got the image under a fluorescent microscope.
Immunofluorescence staining
First fix SCC15 and SCC25 cells with 4% formaldehyde, permeabilize with 0.5% Triton X-100, block with 5% BSA, LHPP antibody (1:200) was incubated overnight at 4℃, and then incubation with the Goat-Anti-Rabbit antibody (1:300) for 1 h at room temperature, followed by incubated with DAPI for 10 min. Lastly, the fluorescent microscope (Olympus, Tokyo, Japan) was used for observing the cells.
Apoptosis Flow-Cytometry Assay
The present study carried out the seeding process for cells in 6-well plates 3 × 105 cells/ well, then the 24h culture. After the trypsinization, the cells were cleaned 2 times by using cold PBS and then received the suspension in 500 µl of binding buffer. The cells received the 20 min incubation in Annexin PI and V-FITC (KeyGEN, Nanjing, China) at ambient temperatures in the dark. Lastly, an investigation was conducted on the cells by flow cytometry with the use of Accuri C6 plus software (Becton Dickinson).
Western blotting
RIPA lysis buffer (Beyotime, Beijing, China) with 1% protease and 1% phosphatase inhibitors contained was added to lysed cells and OSCC tissues. A BCA kit (Beyotime, Beijing, China) was employed to determine the protein concentration of the corresponding group. One-quarter volume of 5X SDS loading buffer was added to the respective sample, and then it received the 5 min heating at 100°C to denature the protein. The proteins (30µg per sample) were separated according to different molecular weights: the denatured proteins underwent 10–15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Then, proteins of different molecular weights are transferred to the PVDF membrane. Blocking in 5% BSA at room temperatures for 1 hour, different primary antibody was introduced to the PVDF membrane and incubated at 4°C overnight. PVDF membrane were cleaned 3 times in 1% TBST and incubated with relevant secondary antibodies for 1 hour at room temperature. Washing in TBST, finally, captured by the FluorChem E System (ProteinSimple, Santa Clara, CA, USA).
Real-time PCR analysis
Total RNA was acquired from cells with the use of Trizol (Invitrogen). We use a microspectrophotometer (LASPEC, Shanghai, China) to get RNA concentrations. And obtained the cDNA with the use of cDNA synthesis kit (Accurate Biology, Hunan, China). The SYBR green I Mix (Accurate Biology, Hunan, China) and real-time polymerase chain reaction (RT-PCR) detection system (Heal Force, Shanghai, China) to perform RT-PCR analysis. Lastly, GAPDH acted as an internal control indicator, and the data was analyzed with the use of the 2−ΔΔCt method. The complete list of RT-PCR primer sequences was displayed in Table 1.
Table 1
Primer sequences for RT-PCR
Resource
|
Gene name
|
Primer sequence: (5–3)
|
Human
|
GAPDH
|
Forward: CCTGCACCACCAACTGCTTA
Reverse: GGCCATCCACAGTCTTCTGAG
|
Human
|
LHPP
|
Forward: CAAACTGTGTGGTAATTGCAGA
Reverse: CCAGAGGTCTCCTTGTAGTAAC
|
Human
|
Snail
|
Forward: CCTTCGTCCTTCTCCTCTACTT
Reverse: GCTTCGGATGTGCATCTTGA
|
Human
|
MMP-2
|
Forward: TGCTGGAGACAAATTCTGGA
Reverse: TTGGTTCTCCAGCTTCAGGT
|
Human
|
N-cadherin
|
Forward: CGATAAGGATCAACCCCATACA
Reverse: TTCAAAGTCGATTGGTTTGACC
|
Human
|
E-cadherin
|
Forward: AGTCACTGACACCAACGATAAT
Reverse: ATCGTTGTTCACTGGATTTGTG
|
Human
|
Bax
|
Forward: CGAACTGGACAGTAACATGGAG
Reverse: CATCTGGTCTGGAGTACGTATC
|
Human
|
Bcl-2
|
Forward: AAGAATGGCCAGACAATGAATG
Reverse: CATCTGGTCTGGAGTACGTATC
|
Mouse xenograft tumor model
The Institutional Animal Care and Use Committee (IACUC) of Shandong University released the approval (No. 20210120) for the animal experiment. Athymic nude BALB/c female mice (Pengyue, Jinan, China) which were aged 4–6 weeks received the housing process within a specific pathogen-free environment based on free water and food as well as 12h light/12h dark cycle, and they were feed for 7 days to adapt to the environment. The mice received the random separation in 3 cohorts (n = 6) and the subcutaneous injection in right upper limb back with 2×106 SCC15 NC, Vector, OE-LHPP group cells /mice. Tumor size were detected once three days with the use of a slide caliper, the tumor volume was calculated with the use of 0.5×A×B2, where B represents the width and A denotes the tumor length. After feeded for 30 days, the mice were euthanized, the tumors received the isolation, weighed process, photographyed and immediate fixed by adopting 4% paraformaldehyde to conduct the following investigation.
Statistical analysis
The data have the expression of the mean ± SD of 3 independent tests. Based on GraphPad Prism 6 software (San Diego, CA, USA), the statistical investigation was carried out. T-test was employed for testing the difference of the two groups. This study employed a one-way analysis of variance (ANOVA) for testing the distinctions of the groups.