Ethical considerations
The study protocol was approved by The Ethics Committee of Iwate Medical University School of Dentistry (approval no. 01340). Individuals with decision-making ability were given information regarding the study protocol and enrolled as subjects after providing documentation indicating consent. For those who lacked ability to make such a decision due to cognitive decline, study protocol information documentation was given to a closely related family member, who provided consent for participation. Individuals who refused to participate in a study survey or undergo analysis after providing consent were subsequently excluded.
Study design and participants
This was a cross-sectional observational study conducted at a nursing institution for the older people. Consent to participate in the study was received from 42 older individuals or a family member. Later, one rejected participation in the survey, after which no one withdrew their consent for participation. Consequently, 41 elders (8 males, 33 females) with an average age ± standard deviation (SD) of 84.6 ± 8.3 years (range 70-105 years) completed the present study protocol.
Collection of participant information
Information regarding gender, age, height, weight, application of special medical cares, smoking and drinking habits, intake of antibacterial or anti-fungal medication, and long-term care needs level for each subject was provided by the institution. Long-term care needs level is widely recognized in Japan as it is used in the Japanese long-term care insurance system, which was established in 2000. Following receipt of an application from a community-dweller aged 65 or older, their care needs level is determined by the applicable commission in the administration of their community based on examinations of mental and physical condition assessed by certification screening personnel, as well as a diagnosis from their primary physician. Long-term care needs consist of 7 levels, including support levels 1 and 2, and care levels 1-5, aside from not applicable. Support level 1 represents the lowest level of care needed and care level 5 the highest [28]. For the present study, the range from support level 1 to care level 5 is referred to as long-term care needs level 1-7. BMI was calculated as follows: weight (kg) / height (cm) 2.
Oral examinations
Oral examinations were performed by two well-calibrated dentists. Present tooth status including decayed and filled teeth was assessed according to the WHO criteria. Residual roots with or without coping treatment were recorded as a filled or decayed tooth, respectively. The presence of oral cancer and oral potentially malignant disorders (OPMDs), including leukoplakia, oral lichen planus, and erythroplakia, was determined using methods recommended by the WHO [29].
The moisture level of the tongue surface was measured three times using an intraoral moisture meter (Mucus®; Life, Saitama, Japan) at a point 1 cm posterior from the tip of the tongue along the median groove, as noted in a previous study [30]. Tongue coating deposits were evaluated using tongue coating index (TCI). The surface of the tongue dorsum was divided into three sections vertically and three sections laterally (total nine sections). Each section was scored from 0-2 (0: tongue coating not visible, 1: thin tongue coating, papillae of tongue visible, 2: very thick tongue coating, papillae of tongue not visible) and the total score of the 9 sections was recorded as personal TCI [31]. Comprehensive oral health status was assessed using the Oral Health Assessment Tool (OHAT), which is a validated tool used for assessment of oral health and comprises eight domains, including lips, tongue, gums and tissues, saliva, natural teeth, dentures, oral cleanliness, and dental pain, stratified into three grades (healthy, oral changes, unhealthy) [32]. In addition, at the oral examinations, denture use frequency was obtained by oral questioning of the subject or a caregiver. Denture use frequency was categorized into three levels; 1: no use, 2: used for meals, and 3: always worn except at sleeping time.
Collection and genome purification of microbial samples
Microbial samples were collected immediately after the oral examination, as follows. The dorsum of the tongue was swabbed 20 times with a sterile cotton swab, which was then immersed in 1 ml of sterile saline. Collected samples were transferred to the laboratory on ice and stored at -80°C until genome extraction. Genomic DNA was extracted and purified from the collected samples using a Wizard® Genomic DNA Purification Kit (Promega), according to the manufacturer’s instructions. The microbial samples were lysed in 50 mM EDTA, 1 mg/ml lysozyme (Thermo Fisher Scientific, Waltham, USA), 0.5 mg/ml lysostaphin (Fujifilm Wako Pure Chemical), and 1 unit/ml lyticase (Sigma-Aldrich, St. Louis, MO, USA) at 37˚C for 30 min. In addition, samples were disturbed with an ISOFECAL for Beads Beating device (Nippon Gene, Tokyo, Japan) and a μT-12 beads crusher (TAITEC, Saitama, Japan) at 3200 r/minute for 5 minutes. Purified genomic DNA was dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20˚C.
Primer sets for polymerase chain reaction (PCR) assays
A specific primer for amplifying the genome of oral streptococci was designed based on the S. mutans ATCC 25175 gene (NCBI Accession No. EF536028) and subjected to Primer-BLAST (basic local alignment search tool) (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). The primer sequences (5’ to 3’) targeting all streptococci elongation factor-Tu were CCAATGCCACAAACTCGTGAAC (forward) and GATCACGGATTTCCATTTCAACC (reverse). To test the specificity of a streptococci-specific primer, the following strains were used: Streptococcus mutans ATCC 25175, S. sobrinus ATCC 27351, S. salivarius ATCC 7073, S. oralis ATCC 10557, S. gordonii ATCC 10558, S. sanguinis ATCC 10556, S. mitis ATCC 49456, S. constellatus ATCC 27823, S. anginosus NCTC10713, S. intermedius GAI 1157, S. pyogenes ATCC 12344, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, Staph. epidermidis ATCC 14990, Fusobacterium nucleatum ATCC 25586, and Escherichia coli BL21. They were cultured in trypticase soy broth (TSB, Becton Dickinson, Sparks, MD, USA) under an anaerobic condition (80% N2, 10% CO2, 10% H2) at 37°C [33, 34].
One ng of each bacterial DNA sample was confirmed by detection with the streptococci specific primer set using KOD-Plus-Neo DNA polymerase (TOYOBO, Tokyo, Japan). The amplification cycles were as follows: 2 minutes at 98˚C for initial heat activation, then one cycle for 10 seconds at 94˚C, 10 seconds at 62 ˚C, and 5 seconds at 68˚C, for a total of 30 cycles. These PCR products were subjected to agarose gel electrophoresis using a 3.0% gel and stained with ethidium bromide, with detection performed at 302 nm with ChemiDoc XRS Plus (Bio-Rad Laboratories, Hercules, CA, USA). DNA amplicons were observed in ten oral streptococci, while no PCR products were demonstrated with DNA samples from the other six bacteria species (Figure 1). For amplifying the genome of bacterial 16S rRNA universal and eukaryotic 18S rRNA genes, primer sets reported in previous studies were used [35, 36]. The primer sequences (5’ to 3’) targeting bacterial the 16S rRNA gene were CGCTAGTAATCGTGGATCAGAATG (forward) and TGTGACGGGCGGTGTGTA (reverse), and those (5’ to 3’) targeting the 18S rRNA gene were TCTCAGGCTCCYTCTCCGG (forward) and AAGCCATGCATGYCTAAGTATMA (reverse).
Determination of microbial amounts
Stored samples were solved in room temperature. From those samples, genomic DNA was extracted and purified by the same method used for reference microorganisms. To determine microbial amounts in each sample, quantitative PCR assays were performed using a Thermal Cycler Dice Real-Time System II and with the following thermal cycle, as recommended for the TB Green Ex Taq (Takara Bio, Kusatsu, Japan) mixture: 95˚C for 30 s, then 40 cycles for 5 s at 95˚C and 1 m at 58˚C for 16S rRNA and 18S rRNA, and at 62˚C for oral streptococcal EF-Tu. Ten ng of genomic DNA from the samples was used as the template. Standard curves for each organism were plotted using Ct values obtained from amplification of genomic DNA. Those were extracted from S. salivarius ATCC 7073 (1.0 x 102 to 1.0 x 106 CFU) and C. albicans SC 5314 (1.0 x 101 to 1.0 x 106 CFU) cells. The numbers of S. salivarius and C. albicans were determined by plating culture dilutions in trypticase soy agar and YPD agar plates, respectively [35, 37]. The linearity of these assays was correlated between the Ct and microbial amounts. Correlation coefficients were 0.969 for 16S rRNA, 0.985 for oral streptococcal EF-Tu, and 0.979 for 18S rRNA. The amounts of the microorganisms were expressed as logarithm number of CFU.
Statistical analyses
A single correlation between measurements was tested by Spearman’s rank correlation coefficient analysis. For assessing nutritional condition, participants were classified as BMI < 20 (undernutrition) or ≥20 (not undernutrition) according to the criteria for Asian elderly aged 70 years or older in The Global Leadership Initiative on Malnutrition (GLIM) [38]. For OHAT, the participants were divided into low and high OHAT groups based on a cutoff value of 5 (OHAT > 5 and OHAT ≤ 5), after referring to the median of the participants in this study and a previous study [39].
After distributions of all measurements were tested by one-sample Kolmogorov-Smirnov test, measurements with normal distribution were tested by Student’s t test in comparison tests between groups of both for BMI and OHAT. In case of that measurements did not show normal distribution, Mann-Whitney’s U test or Fisher’s exact test was used in comparison tests. For multivariable analysis to elucidate factors related with BMI or OHAT, multiple logistic regression analyses were performed. SPSS for Windows software, ver. 25.0 (IBM SPSS, Tokyo, Japan), was used for all data analyses.