Collection of ovaries
The use of human tissue for this study was approved by the Ethics Committee of Hospices Civils de Lyon. After obtaining informed consent, both oral and written, ovarian tissues were collected by hysterectomy and oophorectomy from 5 transsexual women (female to male) aged 23–40 years old, suffering from gender identity disorder at Centre Hospitalier Lyon Sud. Ovaries were immersed in Leibovitz L-15® (Eurobio, Couraboeuf, France) and transported to the laboratory at 10°C within 30 minutes. First, ovaries were cut in two hemi-ovaries using a scalpel in a Petri dish under sterile conditions. Then, the medulla was removed with a sterile chisel in order to obtain two hemi-cortexes. Finally, cortexes were cut into small pieces of 200mg ± 20mg, representing dimensions of approximately 5 mm (length) x 3 mm (width) 1 mm (thickness). The same ovary was cut into several pieces to be studied fresh (control tissue), after slow freezing and vitrification.
Slow freezing protocol and thawing procedure
OT was frozen according to the method described by our team that allowed live birth ewes (22)(23) which we have modified by 10% replacing fetal calf serum (FCS, Sigma-Aldrich, St Quentin Fallavier, France) with 10% serum substitute supplement (SSS, Irvine scientific, Santa Ana, USA). After OT dissection, fragments were incubated in BM1 (Eurobio) and placed in 800 µL of freezing solution composed of 14.2% (2M) dimethyl sulfoxide (DMSO: Sigma-Aldrich), 10% SSS and BM1 within a sterile straw (CryoBioSystem, L’Aigle, France) for ten minutes at room temperature between 20 and 23°C, then subsequently freezing solution composed of 14.2% (2M) dimethyl sulfoxide (DMSO; Sigma-Aldrich), 10% SSS and BM1 within a sterile straw (CryoBioSystem, L’Aigle, France) for ten minutes at room temperature between 20 and 23°C then subsequently frozen with a semi-automatic self-seeding programmable freezer (Minicool 40 PC, Air Liquide Santé, France) held at 20°C. The cooling rate was − 2°C/min from 20°C to -35°C, at which point temperature nucleation was induced by semi-automatic seeding. The semi-automatic seeding was performed by the release of negative calories at -11°C. Then the temperature was lowered to -150°C at 25°C/min. When the temperature reached − 150°C, the straws were plunged in liquid nitrogen for storage. For thawing, straws were removed and immersed in a water bath at 37°C for one minute. OT were removed from the straw and placed in three successive thawing solutions composed of BM1 for five minutes at room temperature. Thawed OT were placed in 4% formaldehyde (VWR, Strasbourg, France) for investigation of morphology.
Vitrification protocol and warming procedure
OT were vitrified in a solution composed of DMSO, ethylene glycol (Sigma-Aldrich), SSS and sucrose (Dutscher, Brumath, France). The protocol was based on several vitrification protocols described in the literature (17, 37). Fragments were incubated in equilibration solution (BM1 containing 5.58% (1M) ethylene glycol, 3.55% (1M) DMSO 2.50% SSS and 0.125 M (sucrose) for five minutes at room temperature between 20 and 23°C. Then they were placed into a second bath (BM1 containing 11.16% (2M) ethylene glycol, 7.10% (1M) DMSO, 5.00 % SSS, and 0.25 M sucrose) for seven minutes at room temperature between 20 and 23°C, after which they were placed in the vitrification solution (BM1 containing 22.32% (4M) ethylene glycol, 14.20% (2M) DMSO, 10% SSS, and 0.5 M sucrose) at 4°C for ten minutes. OT were placed on a piece of semi-rigid 1 mm thick absorbent paper developed by our team, then cooled by direct contact with liquid nitrogen. For warming, OT were removed from straws and placed in a warming solution of 0.4 M sucrose for five minutes at room temperature, and then in sucrose-free BM1 for five minutes at room temperature. Warmed OT were placed into 4% formaldehyde for investigation of follicle morphology.
Histological evaluation
Five fresh, five frozen/thawed, and five vitrified/warmed OT were fixed in formaldehyde 4% for 24 hours at room temperature, paraffin embedded after dehydration, and cut into 4 µm serial sections. Ten sections were stained with hematoxylin (Millipore, Burlington, USA), eosin (Sigma-Aldrich) and safran (RAL Diagnostic, Martillac, France). The entire section was photographed to make a count and classification of the follicles using the Image J software. Then sections were checked by light microscopy to evaluate follicle morphology. The follicles were counted by two blind operators and were classified according to the description of reported by Gougeon and counted as altered or intact (Fig. 2). Follicles were classified as altered if there were at least one sign of oocyte or granulosa cell degeneration: the presence of pycnotic oocyte or follicular cell nuclei, detachment of the oocyte from surrounding granulosa cells, vacuolization of ooplasm, partially degenerated granulosa cells, or detachment of the basal membrane.
RNA extraction and complementary DNA synthesis for molecular assessment
Total RNA was extracted from fresh OT, frozen/thawed OT and vitrified/warmed OT using an RNeasy® Plus Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. We used the whole warmed tissue. Before the RNA samples were treated with DNase to remove any genomic DNA contamination prior to proceeding DNA synthesis. RNA was eluted twice in 30 µL of RNase free-water after extraction and consecutively collected in a final volume of 30 µL and was conserved at -80°C. The RNA concentration was determined by spectrophotometry; the ratio of the readings at 260 nm and 280 nm (A260/A280) provided an estimate of the purity of RNA. A total of 500 ng of the extracted RNA was used for cDNA synthesis using the High- Capacity RNA-to-cDNA® kit (Applied Biosystem, Waltham, Massachusetts, US). The cDNA synthesis was performed at 37°C for 60 minutes and stopped by heating to 95°C for five minutes. The obtained cDNA was stored at -20°C and prepared for real-time PCR analyses.
Real-time reverse transcription polymerase chain reaction
The primers for real-time RT-PCR were found by literature review (Table 1) or by our own design. Each primer was verified by using the University California, Santa Cruz (UCSC) Genome browser (https//genome.ucsc.edu) to check their specificity, target region, and size. Only verified primers were used for the PCR analyses. A total of six genes were analyzed: CYP11A (Cytochrome P450 Family 11 Subfamily A Member 1), STAR (Steroidogenic Acute Regulatory Protein), GDF9 (Growth Differentiation Factor 9), ZP3 (Zona Pellucida Glycoprotein 3), CDK2 (Cyclin Dependant Kinase 2), and CDKN1A (Cyclin-Dependant Kinase Inhibitor 1A). We chose to evaluate GDF9 and ZP3 due to their dominant role in follicular development, in which they code for proteins produced by the oocyte. CYP11A and STAR encode proteins secreted by granulosa cells and are essential for the proper functioning of steroidogenesis. Finally, CDK2 and CDKN1A are involved in cell-cycle regulation. CDK2 is involved in the control of the cell cycle; essential for meiosis, but non-essential for mitosis. CDKN1A encodes an inhibitory protein to regulate cell growth and cell response to DNA damage. One-step RT-PCR was performed using the StepOneplus real-time thermal cycler (Applied Biosystems) and using the Quantitect SYBR Green RT-PCR kit (Thermofisher, Waltham, USA). The reference gene was GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase). Prior to quantitative analysis, optimization procedures were performed by running real time RT-PCR with or without a template to verify the reaction condition, including the annealing temperatures of the primers and specific products. The real-time thermal conditions included a holding step at 50°C for two minutes and 95°C for two minutes, a cycling step at 95°C for 15 seconds, 60°C for 15 seconds, followed by a melt curve step 95°C for 15 seconds, 60°C for one minute and 95°C for 15 seconds. Each sample was analyzed in triplicate; water was used as negative control.
Table 1
Oligonucleotide primer sequences for PCR.
Accession number | Target gene | Primer sequence Forward (5’->3’) : F Reverse (3’->5’) : R |
NM_002046 | GAPDH (Wang et al. 2016) | R : GGATTTGGTCGTATTGGG F : GGAAGATGGTGATGGGATT |
NM_005260 | GDF9 (Wang et al. 2016) | F : CGTCCCAACAAATTCCTCCTT R : AGGCCAGCTCTGTCTCTCTCAT |
NM_001110354 | ZP3 (Wang et al. 2016) | F : GAGGCAGCCTCATGTCATG R : AGGCAAAGCCCACTGCTC |
NM_000349 | STAR (Wang et al 2016) | F : CCTGCTGTTCCCAACTGTG R : AGCCTCATCCCTGTTTTCTTG |
NM_000781 | CYP11A (Wang et al. 2016) | F : TGGAGTCGGTTTATGTCATCG R : GGCCACCCGGTCTTTCTT |
NM_001798 | CDK2 | F : GGCCATCAAGCTAGCAGACT R : GAATCTCCAGGGAATAGGGC |
NM_078467 | CDKN1A | F : AGGTGGACCTGGAGACTCTCAG R : TCCTCTTGGAGAAGATCAGCCG |
Statistical analysis
The analysis was performed with the R software (R Core Team 2014). In order to compare non-independent proportions a Generalized Linear Mixed Model (GLMM) was used. In this way, the ratios estimated by the GLMM were not a simple division of two values but the inverse of a logit function. However, the estimated ratios by the GLMM were near the ratios calculated by a simple division. Moreover, in order to take account of the overdispersion of the values, a quasibinomial distribution was used for the calculation and the test of the difference among the ratios. Thus, a precise analysis was performed, with ratios correctly calculated. To perform this study the so-called glmmPQL function of the MASS package was used. The Kruskal-Wallis non-parametric test was used to analyze the results of real-time RT-PCR data. A test was considered statistically significant when the p value was under 0.05.