A Small Molecule Inhibitor of Deubiquitinase OTUD3 Promotes DR5-Induced Apoptosis in Lung Cancer Through ER Stress Modulation

doi:10.21203/rs.3.rs-871606/v1

Download PDF

Research

A Small Molecule Inhibitor of Deubiquitinase OTUD3 Promotes DR5-Induced Apoptosis in Lung Cancer Through ER Stress Modulation

https://doi.org/10.21203/rs.3.rs-871606/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Lung cancer is cancer with the highest morbidity and mortality in the world and poses a serious threat to human health. Therefore, discovering new treatments is urgently needed to improve lung cancer prognosis. The ubiquitin-proteasome system is an important target for the research of antineoplastic drugs, in which deubiquitinase inhibitors have broad clinical applications. In this study, we show that Rolapitant, an inhibitor of deubiquitinase OTUD3, can inhibit the proliferation and induce apoptosis of lung cancer cells through OTUD3.

Methods: Cell viability was measured by CCK8 assays. Apoptosis, cell cycle and surface DR5 expression on lung cancer cells were analyzed by flow cytometry. The expression of transcription level was measured by real time RT-PCR methods. Protein expression was examined in Rolapitant-treated lung cancer cells using Western blotting. Proteomics sequencing was used to detect the molecules which Rolapitant regulate. A549 xenograft nude mice were used to assess the efficacy of Rolapitant in vivo.

Result: We showed that Rolapitant enhanced the ubiquitination levels of substrate GRP78 and reduced its protein level. Proteomics sequencing indicated that Rolapitant significantly upregulated the expression of death receptor 5 (DR5). Rolapitant also promoted lung cancer cell apoptosis through upregulating cell surface expression of DR5 and enhanced TRAIL-induced apoptosis. Mechanistically, Rolapitant directly targeted the OTUD3-GRP78 axis to trigger endoplasmic reticulum (ER) stress-C/EBP homologous protein (CHOP)-DR5 signaling, sensitizing lung cancer cells to TRAIL-induced apoptosis. In the vivo assays, Rolapitant suppressed the growth of lung cancer xenografts in immunocompromised mice at suitable dosages without apparent toxicity.

Conclusions: Therefore, the present study identifies Rolapitant as a novel inhibitor of deubiquitinase OTUD3 and establishes that the OTUD3-GRP78 axis is a potential therapeutic target for lung cancer.

Cancer Biology

Oncology

lung cancer

deubiquitinase

DR5

Rolapitant

proliferation

apoptosis

Globally, cancer is a serious threat to human health and is considered to be the main cause of death¹. The latest data indicate that lung cancer has the highest mortality rate among tumors¹. Lung cancer can be divided into non-small cell lung cancer (NSCLC) and small-cell lung cancer (SCLC) according to histopathology². Among them, NSCLC accounts for about 85% of all lung cancers². In the past two decades, scientists have made a series of major advances in the treatment of lung cancer, and the use of small molecule tyrosine kinase inhibitors and immunotherapy has helped some patients experience an unprecedented survival benefit³. However, there remains a considerable population of lung cancer patients with inherent drug resistance, or who adaptively develop resistance to inhibitors and immunotherapy^4,5. Therefore, there is a need for continued research on new drug development and rational drug combination therapy to improve lung cancer prognosis.

Ubiquitination is a highly conserved form of protein post-translational modification, in which ubiquitin E3 ligase and deubiquitinases (DUBs) are the key editors of the ubiquitination process⁶. E3 ligase can transfer Ub to substrate proteins, while DUBs cleave and remove the Ub chains from substrate proteins⁷. Many studies have shown that ubiquitination plays an important role in cancer pathogenesis and progression. A larger number of studies demonstrated that targeting ubiquitination has therapeutic potential in multiple cancers^6,8,9. Scientists have developed molecular-targeted drugs that target E3 and DUBs to combat malignant neoplasms¹⁰, especially those targeting USP1¹¹, USP7^12,13, and OTUB1^14–16, which display potential for clinical application. For example, the inhibitor ML323 of deubiquitinase USP1 can potentiate cisplatin cytotoxicity in NSCLC and osteosarcoma cells¹¹. The small molecule inhibitor, P5091, is an inhibitor of deubiquitinase USP7 and induces apoptosis in Multiple Myeloma cells¹². OTUB1 promotes multiple myeloma tumor growth through stabilizing the oncogenic transcription factor c-Maf and lanatoside C (LanC), which is an inhibitor of OTUB1 that disrupts the interaction of OTUB1 and c-Maf¹⁴.

Ovarian tumor domain-containing protein 3 (OTUD3), which is a key OTU (ovarian tumor protease) family deubiquitylase, plays important roles in a variety of cancers.

Our previous study indicated that OTUD3 promoted lung tumorigenesis through stabilizing the glucose-regulated protein 78 kDa (GRP78)^2,17. GRP78, a major endoplasmic reticulum (ER) chaperone, is primarily localized to the ER and participates in unfolded protein response and ER stress¹⁸. Rolapitant [5S,8S)-8-[[(1R)-1-[3,5 bis(trifluoromethyl phenyl] ethoxy]methyl]-8-phenyl-1,7-diazaspiro[4.5]decan-2-one], also named Varubi, is a high-affinity NK1 receptor antagonist as a treatment for nausea and vomiting caused by chemotherapy and is approved by the U.S. Food and Drug Administration (FDA)¹⁹. The function of Rolapitant in the tumors has not been studied. In our recent study, we identified Rolapitant as an inhibitor of OTUD3 that can also promote ER stress DR5-induced apoptosis of lung cancer cells through disrupting the interaction of OTUD3 with GRP78.

Apoptosis includes the extrinsic and intrinsic apoptotic pathways. Death receptors 4 and 5 (DR4/5) or tumor necrosis factor-related apoptosis-inducing ligand receptors 1 and 2 (TRAIL-R1/R2) play an important role in the extrinsic pathway²⁰. TRAIL can bind the death receptors and recruit the Fas-associated protein with death domain (FADD), forming a complex known as death-inducing signaling complex (DISC) that leads to activation of caspase-8 and subsequent downstream caspase-3-dependent apoptosis of the cell^21,22. DR5, death receptor 5 (also known as Apo2, TRAIL-R2, TRICK2, or Killer/DR5), belongs to the TNF receptor gene superfamily^22,23 and is an essential component of the extrinsic apoptosis pathway. The transcription expression of DR5 can be induced by stress-related transcription factors, such as p53, FOXO3a, ATF4, and CHOP²⁴. In our study, we found that Rolapitant can promote the expression of the ER stress-induced transcription factor CHOP. Furthermore, Rolapitan upregulated the transcription expression of DR5 through CHOP.

In conclusion, Rolapitant promotes lung cancer cell apoptosis through upregulating cell surface expression of DR5 and enhancing TRAIL-induced apoptosis. Rolapitant directly targets the OTUD3-GRP78 axis to trigger ER stress-related C/EBP homologous protein (CHOP)-DR5 signaling, sensitizing lung cancer cells to TRAIL-induced apoptosis. On this basis, the purpose of this study was to clarify the relationship between OTUD3 and Rolapitant at the molecular, cell, and animal levels and omics, as well as to explore the effect and mechanism of Rolapitant on lung cancer proliferation and apoptosis. Our findings provide a novel approach for lung cancer treatment and are valuable for clinical application.

Cell Lines and Drug Sources

All cells are purchased from the American Type Culture Collection (ATCC). All cell lines were examined by DAPI DNA staining, and the mycoplasma test was negative. The human NSCLC cell lines H1299, A549, H1650, H460, H1975 or Human normal lung epithelial cells BEAS-2B, HBE were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and antibiotics. The reagents used were as follows: Rolapitant (S5476, Selleck), Estradiol Cypionate (S4046, Selleck), Recombinant Human TRAIL/Apo2L (HY-P7306, MCE), Tunicamycin (HY-A0098, MCE).

Computational virtual screening

The OTUD3 (pdb:4bou) PDB files was downloaded from the PDB (http://www.rcsb.org/). All heterogeneous atoms and the OTUD3 ligand were removed and 4bou chain A was selected for subsequent molecular docking. The OTUD3 docking grid was maximized for rolapitant docking.

PDB file (4bou chain A) were converted to the PDBQT format as macromolecules before virtual screening. The grid (ligand docking search space) was located as described above. Then, Autodock Vina 1.1.2 was used for the subsequent molecular docking.

Protein–ligand interactions were visualized using Pymol version 1.7.4.5. The amino acid residues of OTUD3 protein close to the hit ligands (≤1 Å) were highlighted as potential interactive residues involved in the protein–ligand interaction.

Antibodies

Antibodies used were anti-GRP78 (cat. no. 11587-1-AP, 1:3000, Proteintech), anti-PERK (cat. no. 20582-1-AP, 1:1000, Proteintech), anti-IgG (mouse. no. sc2025, 1:400, Santa Cruz Biotechnology), anti-P-PERK (cat. no.YP1055, 1:1000, Immunoway), anti-Ubiquitin (cat. no. sc8017, Santa Cruz Biotechnology), anti-OTUD3 (cat. no. CSBPA719399LA01HU, 1:1000, CUSABIO), anti-GAPDH (mouse. no. ab8245, 1:10000, Abcam), anti-CyclinA2 (cat. no. ab181591, 1:2000, Abcam), anti-P21 (cat. no. 2947s, Cell Signaling Technology), anti-DR5 (cat. no. 8074s, Cell Signaling Technology), anti-Cleaved-Caspase-8 (cat. no. 9496s, Cell Signaling Technology), anti-Caspase-8 (cat. no. 4790s, Cell Signaling Technology), anti-Cleaved-Caspase-3 (cat. no. 9661s, Cell Signaling Technology), anti-IRE1 (cat. no. 3294, 1:1000, Cells Signaling Technology, Inc.), anti-ATF6 (cat. no. 65880, 1:1000, Cells Signaling Technology, Inc.), anti-ATF4 (cat. no. 11815, 1:1000, Cells Signaling Technology, Inc.), anti-p-eIF2 (cat. no. 5324, 1:1000, Cells Signaling Technology, Inc.), anti-XBP-1s (cat. no. 12782, 1:1000, Cells Signaling Technology, Inc.), anti-PARP (cat. no. 9532, 1:1000, Cells Signaling Technology, Inc.), anti-CHOP (mouse.no.2895,1:1000, Cells Signaling Technology, Inc.), DR4 (cat.no.42533, 1:1000, Cells Signaling Technology, Inc.), anti-FADD (cat. no. 2782, 1:1000, Cells Signaling Technology, Inc.). The secondary antibodies used were anti-rabbit lgG, HRP-linked Antibody (7074s), anti-mouse lgG, HRP-linked Antibody (7076s). All these antibodies were dissolved with 5% skimmed milk in Tris Buffered saline Tween (TBST).

Colony formation assays

1000 cells per well of A549, H1299, H460 and H1975 and normal lung epithelial cells of BEAS-2B were planted in a 6-well plate for 24h. Then cells were treated with different concentrations (0-25 μM) of Rolapitant for 10-14 days until clones could be clearly visible. Cell culture plates were gently washed by PBS twice, fixed with 4% paraformaldehyde phosphate buffer for 15 minutes and then stained with crystal violet for 15minutes. Washing the excess stain with ddH₂o and drying them at room temperature for several hours.

Western blotting

Whole cells were digested with trypsin (Gibco) and lysed with radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Fisher Scientific, Shanghai, China) on ice. The ratio of phosphatase inhibitor and protease inhibitor to RIPA lysis buffer was 1:1:100. Proteins were separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Merck Millipore, Darmstadt, Germany). These membranes were blocked with 5% skimmed milk for 1 h and then incubate overnight with specific antibody. Washing the membranes three times with Tris Buffered saline Tween (TBST) for 10 minutes each. PVDF membranes were incubated with secondary antibodies for 1h at room temperature and then washed with TBST four times for 10 minutes each. Finally, Using the ECL Western blotting system (Thermo Scientific, Waltham, MA, USA) to detect the expression of target proteins.

Cell viability assays

Cell viability assays was performed using the CCK-8 (APEXBIO) test. 1000 cells were seeded in 96-well plates and allowed to grow for 24h. Then each well was treated with dimethyl sulfoxide (DMSO) or different drug dose of Rolapitant for 0h, 24h, 48h,7 2h and 96h. Next, the medium was removed, and 10 μl of CCK-8 which was dissolved in 90 μl of RPMI 1640 medium (Gibco). The optical density (OD) values of each well were measured at 450 nm using a SpectraMax spectrophotometer (Molecular Devices, San Jose, CA, USA) after being incubated at 37°C for 1h.

siRNA and plasmid transfection

Cells (1× 10⁵ cells/well) were seeded in 6-well plates and allowed to grow to 50% confluent at the time of transfection. Diluting 8μl of siRNA or 8μg of plasmid into 200 µl of jetPRIME buffer. Then 4 µl of jetPRIME reagent (Polyplus transfection) was added into the buffer. The buffer was mixed and incubated for 10 minutes at room temperature. Finally, the transfection mix was added into the cells. The sense and anti-sense strands of siRNAs were as follows:

DR5 siRNA sence：5′-GACCCUUGUGCUCGUUGUCTT-3′ and siRNA antisense: 5′-GACAACGAGCACAAGGGUCTT-3′.

CHOP siRNA sense: 5′-CAGUAUCUUGAGUCUAAUATT-3′ and and siRNA antisense: 5′-UAUUAGACUCAAGAUACUGTT-3′.

Immunoprecipitation

A549 and H1299 cells treated with DMSO and Rolapitant respectively were lysed in IP Lysis containing phosphatase inhibitors and protease inhibitors on ice for 30 minutes and then purified via centrifugation for 15 minutes, 12000 g at 4 °C. The supernatants were incubated with diluted anti-lgG antibody, anti-GRP78 antibody and the magenetic beads (Thermo Fisher Scientific, MA, USA) overnight at 4 °C. The proteins were eluted with 2×SDS-PAGE Sample Loading Buffer (Beyotime Biotechnology,Jiangsu, CHina) for 10 minutes at 100°C after being washed by the lysis buffer. Immunocomplexes were determined by western blot analysis.

In vivo GRP78 ubiquitylation assay

For in vivo ubiquitylation assays, A549 and H1299 cells were treated with 10 µM of the Rolapitant for 48h. Cells were lysed with NP40 lysis buffer after treated with 20 µM of proteasome inhibitor MG132 (Calbiochem) for 8 h and incubated with anti-GRP78 antibody for 3 h and protein A/G agarose beads (Santa Cruz) for a further 6 h at 4 °C. Then the beads were washed three times with PBS buffer. The proteins were released from the beads by boiling in SDS-PAGE sample buffer and analysed by immunoblotting with anti-Ub monoclonal antibody.

Flow cytometry-based apoptosis detection

Flow cytometry-based apoptosis assay was performed using the Annexin V-FITC Apopotosis Detection Kit (KeyGEN BioTECH) according to the manufacturer’s instructions. A549,H1299 and BEAS-2B cells were seeded in 6-well plates at a concentration of 2×10⁵ cells/well. Cells were lysed by Trypsin-EDTA (0.25%) (GIBCO) after being treated with different doses of Rolpitant for 24h. 500 µl of binding buffer with 5 µl of Annexin V-FITC propidium iodide were added into the plate after being washed twice by PBS. Then 5 µl of Propidium iodide (PI) was added after 10 minutes and keeping the cells in the dark. Analysis was performed on a flow cytometer (BD Biosciences) in 1h and data were processed by Modfit software.

Flow cytometry-based cell cycle analysis

A549, H1299 and BEAS-2B cells were seeded in 6-well plates at a concentration of 2×10⁵ cells/well. Cells were collected by Trypsin-EDTA (0.25%) (GIBCO) after being treated with different doses of Rolpitant for 24h. The plates were washed twice by PBS and then adding 500 μl of 70% absolute ethyl alcohol at 4°C for at least 12 h. Finally, cells were resuspended in 500 µl of PI solution in the presence of RNase. A flow cytometer (BD Biosciences) was used to determine the percentage of cell cycle and data were analyzed using Modfit software.

Flow cytometry-baesd cell surface DR5 analysis

For flow cytometric analyses, cells were lysed with Trypsin, blocked by PBS, 10% FBS for 10 min on ice and subsequently incubated with 5 μl of PE-labeled mouse isotype-mached Control lgG1 (eBioscience, invitrogen) and 5 μl of CD262 (DR5) monoclonal antibody conjugated with PE fluorochrome (eBioscience, invitrogen). All stains were performed using PBS, 10% FBS for 30 minutes in the dark at either RT or 4°C. Cells were suspended in 400 µl of PBS after two washing steps by PBS and then analyzed on flow cytometer (BD Biosciences). Data was processed and presented using Modfit software.

RT-qPCR

Total RNA was collected using Takara MiniBEST Universal RNA Extraction Kit (Takara Biotechnology CO., Ltd) according to the manufacturer’s instructions. The concentration and quality of RNA were detected by 260/280 nm absorbance. Using PrimeScript RT Master Mix (Takara biotechnology Co., Ltd) reverse transcripts RNA into high-volume DNA. Quantitative real-time PCR was performed with ABI 7300 PCR system (Applied Biosystems, CA, USA), using SYBR Green Master Mix (Termo Fisher Scientific, USA). All primers were designed and synthesized by Sangon Biotechnology Co. (Shanghai,China),according to the gene sequence in Genbank. Following an initial denaturation at 95 °C for 30 s, 45 cycles of PCR amplification were performed at 95 °C for 5 s and 60 °C for 30 s. Relative expression of target gene mRNA was normalized to GAPDH as an internal control and calculated using 2⁻^△△CT. The primer sequences are as following: GRP78 forward: 5’-CTGTCCAGGCTGGTGTGCTCT-3’ and GRP78 reverse: 5’-CTTGGTAGGCACCACTGTGTTC-3’, DR5 forward: 5′-GCCCCACAACAAAAGAGGTC-3′ and DR5 reverse: 5′-AGGTCATTCCAGTGAGTGCTA-3′, GAPDH forward: 5′-ACGGATTTGGTCGTATTGGG-3′ and GAPDH reverse: 5′-CGCTCCTGGAAGATGGTGAT-3′,

CHOP forward: 5′- AGCCAAAATCAGAGCTGGAA-3′ and CHOP reverse: 5′- TGGATCAGTCTGGAAAAGCA-3′, p21 forward: 5′- AGTGTGCCGTTGTCTCTTCG-3′ and p21 reverse: 5′- ACACCAGAGTGCAAGACAGC -3′, CyclinA2 forward: 5′-TGATGAAACTATGACCATGATGTCC-3′ and CyclinA2 reverse: 5′- TTCACAGAACGCAGACCACC-3′.

Human Tumor Xenograft Models

The animal experimental protocols were approved by the Animal Care and Use Committee of Nanjing Medical University, China. Female BALB/c nude mice (4-6-weeks-old) were purchased from Charles River Labs (Wilmington, MA, USA). Mice were received a 200µl A549 cells suspensions (2×10⁷cells per mL) by subcutaneous injection under the armpit. Then mice were randomized into three groups when the tumor size reached approximately 150-200mm³. Rolapitant was dissolved in 10%DMSO, 40%PEG300, 5%Tween-80, 45%saline, 4% Tween-80 at the final concentration of 100mg/ml. Eight mice in treatment group were given 75 or 50 mg/kg/d Rolapitant every three days. Control mice were injected with drug vehicle. The experiment was complete when the tumor size of the control group reached 2000mm³. The weight and tumor size of the mice were monitored every 3 days. Tumor tissues were collected immediately and detected when the mice were killed.

Statistical Analysis

All experiments were performed independently at least three times and in triplicate each time. Data were analyzed with GraphPad Prism 8.0. All Statistical analysis were calculated by Student’s t-test or the analysis of variance (ANOVA). The criterion for statistical significance was P-values < 0.05.

Rolapitant is a selective inhibitor of OTUD3

Our previous study indicated that deubiquitinase OTUD3 promoted the progression of lung cancer through stabilizing GRP78². Artificial intelligence (AI) and big data play an important role in the discovery of novel targeted drugs^25,26. Here, we used computational virtual screening to screen 17 inhibitors of OTUD3 from the FDA-approved drugs library (Figure 1A). Then, A549 and H1299 cells were incubated with 50 μM of each compound, and their survival was observed under a microscope. We found that compounds Estradiol Cypionate and Rolapitant can kill A549 and H1299 cells (Figure 1A). Rolapitant significantly inhibited the proliferation of lung cancer cells at lower concentrations (Figure 1B). Therefore, we chose Rolapitant for further study. Figure 1C shows the morphology of A549 treated with different concentrations of Rolapitant. The interaction of OTUD3 and Rolapitant was simulated with PyMol software, and the free energy was calculated as -7.4 kcal/mol (Figure 1D). This suggests that Rolapitant is likely to combine with OTUD3. Moreover, when OTUD3 was knocked down, the growth of lung cancer cells was less affected by Rolapitant (Figure 1E). These results imply that Rolapitant suppresses the proliferation of lung cancer cells via OTUD3.

Rolapitant affects the protein stability and ubiquitination of OTUD3 substrate GRP78

OTUD3 stabilizes its substrate GRP78². Therefore, we examined the effect of Rolapitant on GRP78 protein expression. A549 and H1299 cells were treated with different concentrations of Rolapitant (10, 15, 20, 25 μM), followed by western blot assays to detect the expression of GRP78 and OTUD3. Rolapitant markedly decreased the expression of GRP78 compared with the blank control and DMSO solvent groups but had no effect on OTUD3 expression (Figure 2A). We then found that Rolapitant can disrupt the interaction between OTUD3 and GRP78 by immunoprecipitation (Figure 2C, D). This is likely the mechanism that Rolapitant uses to inhibit the OTUD3/GRP78 interaction to downregulate GRP78 protein levels, which decreases lung cancer cell viability.

Given that OTUD3 is the deubiquitinase of GRP78, we investigated whether Rolapitant could interfere with GRP78 ubiquitination levels. A549 and H1299 cells were treated with Rolapitant for 48 h followed by immunoprecipitation/western blot assays (Figure 2E, F). These findings demonstrate that Rolapitant prevented GRP78 from polyubiquitination, suggesting that Rolapitant antagonized OTUD3/GRP78 interactions to promote the ubiquitination level of GRP78 (Figure 2E, F). These results thus collectively show that Rolapitant promotes GRP78 polyubiquitination and degradation in association with OTUD3 inhibition.

Rolapitant decreases lung cancer cell viability and induces their apoptosis

Next, we detected the effects of Rolapitant on lung cancer cell viability using human normal lung epithelial cells BEAS-2B, HPAEPIC, and lung cancer cell lines A549, H1299, H1975, and H460. The cells were treated with different concentrations of Rolapitant for 24, 48, 72, and 96 h (Figure 3A). The following CCK8 assay showed that Rolapitant significantly reduced lung cancer cell viability within 10 μM for 48, 72, 96 h and had no effect on the proliferation of the human normal lung epithelial cells in 10 μM (Figure 3A). The IC₅₀ values for all cell lines are shown in Supplementary Figure 1A, and the human normal lung epithelial cells had a smaller IC₅₀ value than lung cancer cells. Moreover, colony formation experiments evaluated the effects of Rolapitant on lung cancer cells and BEAS-2B (Figure 3B, C). The results showed that Rolapitant significantly suppressed the colony formation of lung cancer cells in a concentration-dependent manner but had smaller effects on the proliferation of BEAS-2B cells (Figure 3B, C). To find out whether Rolapitant induced lung cancer cells apoptosis, lung cancer cells treated with different concentrations Rolapitant were subjected to flow cytometry (Figure 3D). The results revealed that Rolapitant induced marked apoptosis of A549 and H1299 cells but had no effect on the apoptosis of BEAS-2B cells (Figure 3D). Taken together, these findings indicate that Rolapitant displays potent antiproliferative and pro-apoptotic activity.

Rolapitant leads to cell cycle arrest in G1/S

Since we observed that Rolapitant suppresses the growth of human lung cancer cells, we speculated whether it could cause cell cycle arrest. To investigate this hypothesis, we first detected the impact of Rolapitant on human lung cancer cells with flow cytometry. Flow cytometric analysis and bar graph results showed that the percentage of G0/G1 phase was remarkably aggrandized, and the S phase was reduced following the increase of Rolapitant treatment in A549 and H1299 cells (Fig. 4A). However, there was little change in the G2/M phase. Furthermore, the cell cycle of normal lung epithelial cells (BEAS-2B) was almost unaffected by Rolapitant. Consistently, the results of transcriptome sequencing indicated that the cell cycle was one of the most important enrichment pathways (Fig. 4B). We also detected the cell cycle-related proteins by western blot and qRT-PCR. Western blot analysis illustrated that expression of Cyclin A2 was dramatically decreased and P21 was significantly increased with the growing concentration of Rolapitant, which is consistent with the above data (Fig. 4C). In conclusion, Rolapitant arrested cell in G0/G1 phase by regulating the level of CyclinA2 and P21.

Rolapitant promotes apoptosis of lung cancer cells by upregulating DR5

As Rolapitant can induce apoptosis in human lung cancer cells, we performed proteome sequencing to further explore its mechanism for apoptosis. The analysis of proteome sequencing showed that DR5 may play an important role in modulating apoptosis upon using Rolapitant (Fig. 5A). To investigate whether Rolapitant impacts the level of DR5, we employed flow cytometry in A549 and H1299 cells treated with different concentrations of Rolapitant. Flow cytometric analysis showed that the cell surface expression of DR5 was raised following increasing concentrations of Rolapitant (Fig. 5B). We then established A549 and H1299 cells with stable knockdown of DR5 by interfering small RNA (siRNA) to verify whether Rolapitant triggered apoptosis through DR5. Flow cytometric analysis illustrated that knocking down DR5 significantly decreased the percentage of apoptosis in A549 and H1299 cells treated with Rolapitant compared to control siRNA (Fig. 5C). Consistently, there was little change between control siRNA in the presence of Rolapitant and Rolapitant alone. Previous studies have elucidated that TRAIL is a member of TNF superfamily, which can activate the apoptosis pathway by binding to related death receptor DR4 or DR5 in cancer cells²⁷. Hence, we further tested the percentage of apoptosis in A549 and H1299 treated with Rolapitant in the presence or absence of TRAIL. Flow cytometric analysis showed that the combination of Rolapitant and TRAIL dramatically increased the rate of apoptosis, compared to Rolapitant or TRAIL alone (Fig. 5D). However, there was no change in normal lung epithelial cells (BEAS-2B) with either Rolapitant alone, TRAIL, or a combination of the two drugs. In addition, apoptosis was significantly induced by the co-treatment of Rolapitant/TRAIL, as indicated by cleaved-caspase8, cleaved-PARP, and cleaved-caspase3 through upregulating DR5 (Fig. 5E, F). It is worthwhile to note that there was no significance between DMSO and TRAIL alone, which is consistent with the clinical observation that patients can easily acquire resistance to TRAIL²⁸. In conclusion, Rolapitant facilitated the apoptosis of human lung cancer cells by upregulating DR5 and had little impact on normal human lung epithelial cells. Moreover, Rolapitant may have the potential to reverse TRAIL resistance in clinical settings.

Rolapitant facilitates activation of the DR5 signaling pathway and apoptosis of lung cancer cells by upregulating CHOP

The results above indicated that Rolapitant induced apoptosis via upregulating DR5. Consequently, we further investigated the upstream regulator of DR5. Published studies suggest that the apoptosis of cancer cells can be induced by the CHOP-DR5 axis²⁹. Thus, we hypothesized that Rolapitant could promote DR5 signaling pathway by upregulating CHOP. First, we detected the transcriptional level of DR5 by qRT-PCR.

The transcriptional expression of DR5 was dramatically increased with increasing concentrations of Rolapitant (Supplementary Fig. 3A). A previous study revealed that transcription factor CHOP can upregulate the transcriptional expression of DR5³⁰. Then, we tested the expression of CHOP, DRs, and apoptosis-associated proteins. Western blot analysis showed that CHOP, DR5, and apoptosis-associated protein levels in A549 and H1299 cells were dramatically increased with increasing concentrations of Rolapitant (Fig. 6A, B). However, the expression of DR4 remained basically unchanged (Fig. 6A, B). Next, we established A549 and H1299 cells with stable knockdown of CHOP by siRNA. The western blot analysis illustrated that the levels of CHOP, DR5, and apoptosis-associated proteins were significantly reduced by CHOP siRNA in the presence of Rolapitant compared to the Rolapitant alone (Fig. 6C, D). Together, these data indicate that Rolapitant positively modulated DR5 by upregulating CHOP.

Rolapitant upregulates CHOP by triggering ER stress through modulating the OTUD3-GRP78 axis in lung cancer cells

The ER is a peculiar structure where a number of important substances in the cell, such as proteins, lipids, and sugars, are synthesized, in addition to nucleic acids^31,32. ER homeostasis is therefore crucial to maintaining the biological functions of the eukaryotic cell³¹. Any changes in the extracellular can trigger the accumulation of misfolded proteins in the ER, which then causes stress and activates the unfolded protein response (UPR)³¹. Any physiological or pathological stimulation can cause ER stress. The ER stress sensor pathway, containing IRE1/sXBP1, PERK/EIF2, and ATF6, regulates major functions to ensure ER homeostasis³¹. Previously, it was discovered that ER stress can initiate apoptosis induced by CHOP and DR5^33,34. Accordingly, we hypothesized that Rolapitant could trigger ER stress, which initiates apoptosis induced by the CHOP-DR5 axis. Western blot analysis showed that the levels of PERK, p-PERK, p-EIF2α, ATF4, ATF6, IRE1, and XBP1S in A549 and H1299 cells were significantly increased with the increase of Rolapitant concentration (Fig. 7A). At the same time, the expression of EIF2α did not change. These results indicate that Rolapitant could trigger ER stress through influencing all three ER stress sensor pathways. We detected the expression of ATF4, CHOP, DR5, Caspase3, Cleaved-Caspase3, Cleaved-Caspase8, Caspase8, PARP, and Cleaved-PARP in A549 and H1299 cells treated with Rolapitant in the presence or absence of Tunicamycin (TM), an ER stress inducer (Supplementary Fig. 4A, B). Western blot analysis showed that the levels of apoptosis-related proteins were remarkably increased when combined with TM compared to the single drug Rolapitant or TM, indicating that Rolapitant triggers apoptosis through ER stress (Supplementary Fig. 4A, B).

Some research has indicated that GRP78 can bind and inactivate all three ER stress transducers to regulate the UPR³⁵. GRP78 releases the UPR sensors and leads to the activation of the UPR pathways with GRP78 binding to misfolded proteins in the ER³⁵.

On the contrary, the UPR can be spontaneously triggered with GRP78 depleted or inactivated³⁵. Therefore, the protein level of GRP78 is significant for ER homeostasis. Fig. 2 indicates that Rolapitant can downregulate the GRP78 through disrupting the interaction of OTUD3 and GRP78. Based on this finding, we investigated whether Rolapitant can trigger ER stress-induced apoptosis through the OTUD3-GRP78 axis. The western blot analysis illustrated that the levels of CHOP and DR5 were potentiated in control shRNA in the presence of Rolapitant (Fig. 7C, D). Moreover, the expressions of CHOP, DR5, and apoptosis-associated proteins were remarkably reduced in OTUD3 shRNA compared with the control shRNA in the absence of Rolapitant (Fig. 7C, D). All these results suggest that Rolapitant activates the ER stress-CHOP-DR5 pathway through modulating the OTUD3-GRP78 axis.

Rolapitant inhibits lung cancer cell growth in vivo

As expected, Rolapitant could significantly suppress the proliferation of human lung cancer cells in vitro. To further verify the effects in vivo, 24 nude mice bearing A549 tumors were randomly assigned into three groups: treatment groups that were injected with Rolapitant at 75 mg/kg or 50 mg/kg via gavage, and the control group. There was no significant difference in average body weight between the control and treatment groups (Fig. 8D). Tumor volume and weight were dramatically increased in control mice and were significantly decreased in treatment groups, especially in the 75 mg/kg group (Fig. 8B, C). The observation of tumors was consistent with the data of tumor volume and weight, indicating that Rolapitant has a tumor-suppressive activity in human lung cancer cells (Fig. 8A). Immunohistochemical results showed that the level of Ki67 and GRP78 was significantly increased in the control compared to the treatment group (Fig. 8E). In addition, the expressions of Cleaved-Caspase3, Cleaved-Caspase8, and DR5 were remarkably decreased in the control group compared to treatment group.

Afatinib is the first irreversible blocker of the ErbB family, and Gefitinib is a reversible EGFR tyrosine kinase inhibitor (TKI)³⁶. Both are approved for the first-line treatment of EGFR mutation-positive NSCLC and later settings³⁷. Afatinib and Gefitinib have significantly improved progression-free survival and response rates³⁸. However, drug-related adverse events, such as diarrhea, acneiform skin rash, and paronychia, inevitably occurred and the disease unavoidably progressed in recent years³⁸. Approximately 60% of patients acquired therapeutic resistance to the EGFR TKIs³⁶. The discovery of new drugs and combinations of treatments is therefore urgently needed. Hence, we detected the effects of combination treatments containing Afatinib and Gefitinib in the presence or absence of Rolapitant. The results provide powerful evidence that combined treatments induce greater reduction in cell viability than signal agents, indicating that combination of Rolapitant and targeted drugs can remarkably accelerate synergistic anti-lung cancer activity (Supplementary Fig. 5C). In summary, Rolapitant suppresses the growth of human lung cancer cells in vivo and significantly reduces the cell viability when combined with targeted drugs, demonstrating that Rolapitant has the potential for development as a new anti-tumor agent.

About 100 DUBs have been identified in humans, which can be divided into six families: ubiquitin-specific proteases (USPs), ubiquitin C-terminal hydrolases (UCHs), ovarian tumor proteases (OTUs), motif interacting with ubiquitin containing novel DUB family, Josephins (also termed MJDs), and Jad1/Pad/MPN-domain-containing metalloenzymes.³⁹ DUBs act as oncogenes or tumor suppressors in different types of cancers⁴⁰. OTUD3, as a DUB, plays a context-dependent role in diverse cancer types. OTUD3 could deubiquitylate and stabilize the tumor suppressor PTEN in breast cancer at the protein level. Furthermore, OTUD3 transgenic mice have shown increased PTEN protein levels and reduced susceptibility to breast tumorigenesis⁴¹, while OTUD3 knockout (KO) mice exhibited the opposite trends. However, we recently observed OTUD3 transgenic mice are more susceptible to Kras^G12D-driven lung cancer, while OTUD3 KO mice are less susceptible², indicating an oncogenic role of OTUD3 in lung cancer. OTUD3 is overexpressed in lung cancer, and the increased expression of OTUD3 is associated with short survival and poor prognosis in lung cancer patients². Mechanistically, OTUD3 promotes the proliferation of lung adenocarcinoma through deubiquitylation and stabilization of GRP78². GRP78—a major ER chaperone—is overexpressed in multiple cancers and involved in promoting tumor growth and metastasis, which can also accelerate protein folding and participate in the unfolded protein response. Consequently, tumor growth and metastasis can be inhibited by targeting cell surface-localized GRP78 in cancers. Therefore, inhibition of OTUD3-GRP78 signaling axis has been proposed as an anti-cancer therapeutic target in lung cancer. In our most recent study, we identified Rolapitant from FDA-approved drugs as an inhibitor of OTUD3. Rolapitant, a high-affinity NK1 receptor antagonist that was approved in September 2015 as a treatment for nausea and vomiting caused by chemotherapy¹⁹, has not been reported in tumors as an antiemetic drug at present. The Rolapitant targets the OTUD3-GRP78 axis and displays DR5-induced anti-lung cancer activity in both in vitro and in vivo models.

Anticancer agents can initiate the death receptor–induced (extrinsic) apoptosis, which is one of the most important cytotoxic pathways^42–45. TRAIL is considered to be an attractive agent for cancer therapy because it can induce apoptosis of cancer cell without causing toxicity²⁸. However, most cancer cell lines and primary tumors such as NSCLC develop TRAIL resistance²⁷, resulting in general treatment failure with advanced cancer patients⁴⁶. Resistance of tumor cells to TRAIL-induced apoptosis continues to be an important factor in the failure of clinical trials, which indicates that only when a TRAIL sensitizer is used can cancer therapy containing TRAIL be effective. There is increasing evidence that TRAIL death receptors (DRs) are dysfunctional in various cancer cell types⁴⁷. Hence, reconstitution of TRAIL receptors in cancer cells is an efficient strategy for the development of biotherapy drugs to conquer TRAIL resistance. Recent studies have shown that TRAIL resistance can be reversed by upregulating DR5 with chemotherapeutic agents^48,49 and ER stress can trigger the augment of DR5 level in a range of human cancers through the transactivation of the transcription factor CHOP²⁹. Moreover, some previous findings demonstrated that CHOP regulated ER stress-induced apoptosis by enhancing the expression of DR5 in some types of human cancer cells. CHOP could trigger the increased expression of DR5, an ER stress inducer, by binding to the 5’ untranslated region of DR5 promoter²⁹. This discovery provides clues for developing TRAIL-sensitizing agents. Many ER stress inducers, for example, thapsigargin, have been reported to possess anticancer impacts in combination with TRAIL⁵⁰. Nevertheless, the stability and safety of these drugs for the clinical application remain unknown. A promising strategy is to find new chemotherapeutic agents from FDA-approved compounds combined with TRAIL to ensure safety and efficacy in the clinic. In our study, we successfully identified Rolapitant as a potential TRAIL-receptor agonist from a FDA drugs library. Our in vitro and in vivo studies provide evidence that Rolapitant regulates ER stress through targeting the OTUD3-GRP78 axis to induce CHOP-DR5 signaling, exerting synergistic lethal effects with TRAIL on lung cancer.

Chaperone proteins are located in the ER and assist with transmembrane transport as well as the correct folding of growth factors and transmembrane receptors ⁵¹. The chaperone binding immunoglobulin protein (BiP) is the major folding protein in the ER, which is known as GRP78⁵¹. GRP78 regulates the unfolded protein response (UPR) by binding to and inactivating all three ER stress transducers: PRKR-like ER kinase (PERK; also known as eukaryotic translation initiation factor 2α kinase 3), inositol-requiring enzyme 1 (IRE1; also known as ERN1), and activating transcription factor 6 (ATF6)^52,53. GRP78 binds to the misfolded proteins accumulated in the ER and then releases the UPR sensor, resulting in the activation of UPR pathways ⁵⁴. On the contrary, UPR can be triggered spontaneously when GRP78 is depleted or inactivated, leading to different physiological consequences ^55,56. Our previous study showed that OTUD3 stabilized the GRP78 protein in lung cancer cells². But we found that when Rolapitant was added to lung cancer cells, Rolapitant disrupted the interaction between OTUD3 and GRP78, thereby promoting GRP78 ubiquitination and resulting in its degradation. Furthermore, Rolapitant leads to GRP78 separation from the three ER stress transducers PERK, IRE1, and ATF6, activating the three UPR sensors and triggering ER stress. The resulting ER stress upregulates CHOP signaling and promotes the transcriptional activity of DR5.

These findings imply that Rolapitant promotes DR5-induced apoptosis through causing ER stress. Although ER stress can promote the transcriptional activity of GRP78, OTUD3 loses the ability to stabilize GRP78 in the presence of Rolapitant. For the first time, we demonstrated that the inhibition of OTUD3-GRP78 axis with Rolapitant induces ER stress-DR5-mediated extrinsic apoptosis to significantly inhibit the growth of human lung cancer.

Based on our data, we propose that Rolapitant directly suppresses the interaction of OTUD3 and GRP78 through binding to OTUD3 to cause the downregulation of GRP78 protein levels. The dissociation of GRP78 from ER stress sensors leads to the activation of the PERK, IRE1, and ATF6 signaling pathway, triggering ER stress. Then, the ER stress promotes DR5 expression in a CHOP-dependent manner. This finding underlines the potential of Rolapitant targeting the OTUD3-GRP78 axis in the clinical treatment of TRAIL-resistant lung cancers.

DR5: death receptor 5, ER: endoplasmic reticulum, CHOP: C/EBP homologous protein, NSCLC: non-small cell lung cancer, SCLC: small-cell lung cancer, DUBs: deubiquitinases, LanC: lanatoside C: OTUD3: Ovarian tumor domain-containing protein 3, OTU: ovarian tumor protease, GRP78: glucose-regulated protein 78 kDa, Rolapitant:[5S,8S)-8-[[(1R)-1-[3,5bis(trifluoromethylphenyl]ethoxy]methyl]-8-phenyl-1,7-diazaspiro[4.5]decan-2-one], FDA: Food and Drug Administration: TRAIL-R1/R2: tumor necrosis factor-related apoptosis-inducing ligand receptors 1 and 2, FADD: Fas-associated protein with death domain, DISC: death-inducing signaling complex, AI: Artificial intelligence, UPR: unfolded protein response, TM, Tunicamycin: TKI: tyrosine kinase inhibitor, USPs: ubiquitin-specific proteases, UCHs: ubiquitin C-terminal hydrolases, BiP: immunoglobulin protein, PERK: PRKR-like ER kinase, IRE1: inositol-requiring enzyme 1, ATF6: activating transcription factor 6

Acknowledgments

We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

Authors’ contributions

J F and T D conceived and designed the concept. T D, J W and J J carried out the experiments. J W, Y L and R M are responsible for data collection and analysis. T D, J W and J F wrote the manuscript. H C and C X provide some comments and revisions. All authors read and approved the final version.

Funding

This study was supported by Jiangsu Provincial Key Medical Discipline (Grant No. ZDXKA2016009 to J.F.), China Postdoctoral Science Foundation（No. 2020M671543 to T.D.）and Jiangsu Planned Projects for Postdoctoral Research Funds（No. 2020Z009 to T.D.）.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Ethics approval and consent to participate

This study was conducted in accordance with the standards of the declaration of Helsinki and in line with the current ethical guidelines approved by the ethics committee of Nanjing Medical University.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Author details

¹The Affiliated Cancer Hospital of Nanjing Medical University, Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, No.42, Baiziting Street, Nanjing 210009, Jiangsu, China. ²Research Center for Clinical Oncology, Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing 210009, Jiangsu, China. ³Institute of Pharmacologic Science, China Pharmaceutical University, Nanjing, China.

Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. 71, 209-249, doi:10.3322/caac.21660 (2021).
Du, T. et al. The deubiquitylase OTUD3 stabilizes GRP78 and promotes lung tumorigenesis. 10, 2914, doi:10.1038/s41467-019-10824-7 (2019).
Herbst, R., Morgensztern, D. & Boshoff, C. J. N. The biology and management of non-small cell lung cancer. 553, 446-454, doi:10.1038/nature25183 (2018).
Sarmento-Ribeiro, A. et al. The emergence of drug resistance to targeted cancer therapies: Clinical evidence. 47, 100646, doi:10.1016/j.drup.2019.100646 (2019).
Sharma, P., Hu-Lieskovan, S., Wargo, J. & Ribas, A. J. C. Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. 168, 707-723, doi:10.1016/j.cell.2017.01.017 (2017).
Harrigan, J., Jacq, X., Martin, N. & Jackson, S. J. N. r. D. d. Deubiquitylating enzymes and drug discovery: emerging opportunities. 17, 57-78, doi:10.1038/nrd.2017.152 (2018).
Komander, D., Clague, M. & Urbé, S. J. N. r. M. c. b. Breaking the chains: structure and function of the deubiquitinases. 10, 550-563, doi:10.1038/nrm2731 (2009).
Hoeller, D. & Dikic, I. J. N. Targeting the ubiquitin system in cancer therapy. 458, 438-444, doi:10.1038/nature07960 (2009).
Wertz, I. & Wang, X. J. C. c. b. From Discovery to Bedside: Targeting the Ubiquitin System. 26, 156-177, doi:10.1016/j.chembiol.2018.10.022 (2019).
Deng, L. et al. The role of ubiquitination in tumorigenesis and targeted drug discovery. 5, 11, doi:10.1038/s41392-020-0107-0 (2020).
Liang, Q. et al. A selective USP1-UAF1 inhibitor links deubiquitination to DNA damage responses. 10, 298-304, doi:10.1038/nchembio.1455 (2014).
Chauhan, D. et al. A small molecule inhibitor of ubiquitin-specific protease-7 induces apoptosis in multiple myeloma cells and overcomes bortezomib resistance. 22, 345-358, doi:10.1016/j.ccr.2012.08.007 (2012).
Gavory, G. et al. Discovery and characterization of highly potent and selective allosteric USP7 inhibitors. 14, 118-125, doi:10.1038/nchembio.2528 (2018).
Xu, Y. et al. Targeting the Otub1/c-Maf axis for the treatment of multiple myeloma. 137, 1478-1490, doi:10.1182/blood.2020005199 (2021).
Xu, Y. et al. Anti-bacterial and anti-viral nanchangmycin displays anti-myeloma activity by targeting Otub1 and c-Maf. 11, 818, doi:10.1038/s41419-020-03017-4 (2020).
Sun, T. et al. Inhibition of the Otub1/c-Maf axis by the herbal acevaltrate induces myeloma cell apoptosis. 19, 24, doi:10.1186/s12964-020-00676-w (2021).
Zhang, P. et al. Ubiquitin ligase CHIP regulates OTUD3 stability and suppresses tumour metastasis in lung cancer. 27, 3177-3195, doi:10.1038/s41418-020-0571-7 (2020).
Munro, S. & Pelham, H. J. C. An Hsp70-like protein in the ER: identity with the 78 kd glucose-regulated protein and immunoglobulin heavy chain binding protein. 46, 291-300, doi:10.1016/0092-8674(86)90746-4 (1986).
Glass, S. et al. Rolapitant Is a Reversible Inhibitor of CYP2D6. 47, 567-573, doi:10.1124/dmd.118.085928 (2019).
Ralff, M., El-Deiry, W. J. E. r. o. p. m. & development, d. TRAIL pathway targeting therapeutics. 3, 197-204, doi:10.1080/23808993.2018.1476062 (2018).
Suliman, A., Lam, A., Datta, R. & Srivastava, R. J. O. Intracellular mechanisms of TRAIL: apoptosis through mitochondrial-dependent and -independent pathways. 20, 2122-2133, doi:10.1038/sj.onc.1204282 (2001).
Dickens, L. et al. A death effector domain chain DISC model reveals a crucial role for caspase-8 chain assembly in mediating apoptotic cell death. 47, 291-305, doi:10.1016/j.molcel.2012.05.004 (2012).
Lam, M., Marsters, S., Ashkenazi, A. & Walter, P. J. e. Misfolded proteins bind and activate death receptor 5 to trigger apoptosis during unresolved endoplasmic reticulum stress. 9, doi:10.7554/eLife.52291 (2020).
Twomey, J. et al. Spatial dynamics of TRAIL death receptors in cancer cells. 19, 13-21, doi:10.1016/j.drup.2015.02.001 (2015).
Liu, B. et al. Artificial intelligence and big data facilitated targeted drug discovery. 4, 206-213, doi:10.1136/svn-2019-000290 (2019).
He, H. et al. Big data and artificial intelligence discover novel drugs targeting proteins without 3D structure and overcome the undruggable targets. 5, 381-387, doi:10.1136/svn-2019-000323 (2020).
Dianat-Moghadam, H. et al. TRAIL in oncology: From recombinant TRAIL to nano- and self-targeted TRAIL-based therapies. 155, 104716, doi:10.1016/j.phrs.2020.104716 (2020).
Wong, S. et al. The TRAIL to cancer therapy: Hindrances and potential solutions. 143, 81-94, doi:10.1016/j.critrevonc.2019.08.008 (2019).
Li, Y., Guo, Y., Tang, J., Jiang, J. & Chen, Z. J. A. b. e. b. S. New insights into the roles of CHOP-induced apoptosis in ER stress. 47, 146-147, doi:10.1093/abbs/gmu128 (2015).
Chen, P. et al. Neddylation Inhibition Activates the Extrinsic Apoptosis Pathway through ATF4-CHOP-DR5 Axis in Human Esophageal Cancer Cells. Clinical cancer research : an official journal of the American Association for Cancer Research 22, 4145-4157, doi:10.1158/1078-0432.Ccr-15-2254 (2016).
Chen, X. & Cubillos-Ruiz, J. R. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nature reviews. Cancer 21, 71-88, doi:10.1038/s41568-020-00312-2 (2021).
Di Conza, G. & Ho, P. C. ER Stress Responses: An Emerging Modulator for Innate Immunity. Cells 9, doi:10.3390/cells9030695 (2020).
Liu, Z. et al. Activating Transcription Factor 4 (ATF4)-ATF3-C/EBP Homologous Protein (CHOP) Cascade Shows an Essential Role in the ER Stress-Induced Sensitization of Tetrachlorobenzoquinone-Challenged PC12 Cells to ROS-Mediated Apoptosis via Death Receptor 5 (DR5) Signaling. Chemical research in toxicology 29, 1510-1518, doi:10.1021/acs.chemrestox.6b00181 (2016).
Moon, D. O., Park, S. Y., Choi, Y. H., Ahn, J. S. & Kim, G. Y. Guggulsterone sensitizes hepatoma cells to TRAIL-induced apoptosis through the induction of CHOP-dependent DR5: involvement of ROS-dependent ER-stress. Biochemical pharmacology 82, 1641-1650, doi:10.1016/j.bcp.2011.08.019 (2011).
Lee, A. S. Glucose-regulated proteins in cancer: molecular mechanisms and therapeutic potential. Nature reviews. Cancer 14, 263-276, doi:10.1038/nrc3701 (2014).
Huang, L., Jiang, S. & Shi, Y. Tyrosine kinase inhibitors for solid tumors in the past 20 years (2001-2020). Journal of hematology & oncology 13, 143, doi:10.1186/s13045-020-00977-0 (2020).
Park, K. et al. Afatinib versus gefitinib as first-line treatment of patients with EGFR mutation-positive non-small-cell lung cancer (LUX-Lung 7): a phase 2B, open-label, randomised controlled trial. The Lancet. Oncology 17, 577-589, doi:10.1016/s1470-2045(16)30033-x (2016).
Hsu, W. H., Yang, J. C., Mok, T. S. & Loong, H. H. Overview of current systemic management of EGFR-mutant NSCLC. Annals of oncology : official journal of the European Society for Medical Oncology 29, i3-i9, doi:10.1093/annonc/mdx702 (2018).
Mevissen, T. & Komander, D. J. A. r. o. b. Mechanisms of Deubiquitinase Specificity and Regulation. 86, 159-192, doi:10.1146/annurev-biochem-061516-044916 (2017).
Cheng, J. et al. Functional analysis of deubiquitylating enzymes in tumorigenesis and development. 1872, 188312, doi:10.1016/j.bbcan.2019.188312 (2019).
Yuan, L. et al. Deubiquitylase OTUD3 regulates PTEN stability and suppresses tumorigenesis. 17, 1169-1181, doi:10.1038/ncb3218 (2015).
Wang, G. et al. Small-molecule activation of the TRAIL receptor DR5 in human cancer cells. 9, 84-89, doi:10.1038/nchembio.1153 (2013).
Liu, X. et al. The proteasome inhibitor PS-341 (bortezomib) up-regulates DR5 expression leading to induction of apoptosis and enhancement of TRAIL-induced apoptosis despite up-regulation of c-FLIP and survivin expression in human NSCLC cells. 67, 4981-4988, doi:10.1158/0008-5472.Can-06-4274 (2007).
Brooks, A., Jacobsen, K., Li, W., Shanker, A. & Sayers, T. J. M. c. r. M. Bortezomib sensitizes human renal cell carcinomas to TRAIL apoptosis through increased activation of caspase-8 in the death-inducing signaling complex. 8, 729-738, doi:10.1158/1541-7786.Mcr-10-0022 (2010).
Nagalingam, A., Kuppusamy, P., Singh, S., Sharma, D. & Saxena, N. J. C. r. Mechanistic elucidation of the antitumor properties of withaferin a in breast cancer. 74, 2617-2629, doi:10.1158/0008-5472.Can-13-2081 (2014).
Mert, U., Sanlioglu, A. J. C. & CMLS, m. l. s. Intracellular localization of DR5 and related regulatory pathways as a mechanism of resistance to TRAIL in cancer. 74, 245-255, doi:10.1007/s00018-016-2321-z (2017).
Trivedi, R. & Mishra, D. J. F. i. o. Trailing TRAIL Resistance: Novel Targets for TRAIL Sensitization in Cancer Cells. 5, 69, doi:10.3389/fonc.2015.00069 (2015).
Shishodia, G., Koul, S., Dong, Q. & Koul, H. J. M. c. t. Tetrandrine (TET) Induces Death Receptors Apo Trail R1 (DR4) and Apo Trail R2 (DR5) and Sensitizes Prostate Cancer Cells to TRAIL-Induced Apoptosis. 17, 1217-1228, doi:10.1158/1535-7163.Mct-17-1157 (2018).
Kim, B. et al. RUNX3 enhances TRAIL-induced apoptosis by upregulating DR5 in colorectal cancer. 38, 3903-3918, doi:10.1038/s41388-019-0693-x (2019).
Ma, Z. et al. Thapsigargin sensitizes human esophageal cancer to TRAIL-induced apoptosis via AMPK activation. 6, 35196, doi:10.1038/srep35196 (2016).
Lee, A. J. N. r. C. Glucose-regulated proteins in cancer: molecular mechanisms and therapeutic potential. 14, 263-276, doi:10.1038/nrc3701 (2014).
Wang, M. et al. Role of the unfolded protein response regulator GRP78/BiP in development, cancer, and neurological disorders. 11, 2307-2316, doi:10.1089/ars.2009.2485 (2009).
Luo, B. & Lee, A. J. O. The critical roles of endoplasmic reticulum chaperones and unfolded protein response in tumorigenesis and anticancer therapies. 32, 805-818, doi:10.1038/onc.2012.130 (2013).
Wu, J., Kaufman, R. J. C. d. & differentiation. From acute ER stress to physiological roles of the Unfolded Protein Response. 13, 374-384, doi:10.1038/sj.cdd.4401840 (2006).
Li, J. et al. The unfolded protein response regulator GRP78/BiP is required for endoplasmic reticulum integrity and stress-induced autophagy in mammalian cells. 15, 1460-1471, doi:10.1038/cdd.2008.81 (2008).
Wang, M. et al. Essential role of the unfolded protein response regulator GRP78/BiP in protection from neuronal apoptosis. 17, 488-498, doi:10.1038/cdd.2009.144 (2010).

SupplementaryFigures.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

A Small Molecule Inhibitor of Deubiquitinase OTUD3 Promotes DR5-Induced Apoptosis in Lung Cancer Through ER Stress Modulation

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1