Lentiviral production of the sgRNA library.
Lentiviral production was carried out as previously described[37]. Briefly, HEK293T cells were seeded at about 50% confluence 1 day before transfection in DMEM supplemented with 10% fetal bovine serum. 4 μg of GeCKO library (#1000000048, Addgene), 2 μg of pV-SVg (#8454, Addgene,) and 6 ug of psPAX2 (#12260, Addgene) packing plasmids were co-transfected in a 10cm2-dish using Lipofectamine 2000 (Invitrogen) per manufacturer’s protocol. After 48h, the cell culture media was collected and centrifuged at 3,000 rpm at 4 °C for 10 min to pellet cell debris, filtered (0.45-µm pore size), and concentrated by ultracentrifugation (Beckmann) at 24,000 rpm for 2 h at 4°C. The virus preparation was finally resuspended overnight at 4°C in DMEM, divided into aliquots, and stored at −80°C.
Lentiviral transduction of the sgRNA library.
L02 cells were purchased from ATCC, cultured at 37℃, 5% CO2 in the DMEM medium containing 10% fetal bovine serum (Invitrogen). 3x108 L02 cells were infected with the GeCKO library at a multiplicity of infection (MOI) of 0.1 aiming for ensure that most cells receive only 1 viral construct with high probability in full DMEM supplemented with 10% fetal bovine serum, 4 mM l-glutamine, and 10 µg/ml penicillin and streptomycin in the presence of 10 µg/ml of Polybrene. 48 hr after infection, the medium was removed and fresh DMEM was added to the cells containing 1 ug/mL puromycin for 7 days culture.
PM2.5 resistance gene screen and DNA sequencing
Cells were exposed to PM2.5 for 48 hours and then returned to 95% air, 5% CO2, and glucose-containing medium for recovery 6h. The surviving cells were collected. The genomic DNA from surviving cells was isolated using the Blood & Cell Culture DNA Midi Kit (Quiagen, Hilden, Germany) and stored at -20°C. PCR was performed in two steps and resulting amplicons from the second PCR were sequenced using a HiSeq 2500 (Illumina) as described by Dr. Feng Zhang[14].
Forward primer: CTTGTGGAAAGGACGAAACA
Reverse primer: GCCAATTCCCACTCCTTTCA.
The raw sequencing data were processed and analyzed using customized CRISPR- Cas9 library screen pipelines. Briefly, sequencing reads were first de-multiplexed by using the barcode in the reverse primer, and processed by Cutadapt to remove sequences from beginning to sgRNA priming site primers. Trimmed reads were used to map sgRNA sequences to pooled GeCKO v2 libraries A and B. Read counts of sgRNA for each sample were quantified by MAGeCK v5.6.0. Count data were filtered and normalized, and essential sgRNA and genes were ranked by MAGeCK.
Cell culture, RNA interference
Oligo RNA was purchased from GenePharma (Shanghai, China) siRNA and control siRNA transfection was performed with Lipofectamine 2000 (Invitrogen) according to the instructions of the manufacturer, 50 pmol siRNA/well was transfected with 1 μL of Lipofectamine 2000 in the 24 wells for 48h, after RNA transfection, the cells were exposed to PM2.5 for 48 hours and then returned to 95% air, 5% CO2, and glucose-containing medium for different recovery times to induce cell apoptosis.
MTT assay
Cell viability was determined by 3, (4,5-diamethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay. Thus, 30 μL of the MTT solution was added to each well and incubated at 37 °C for 3 h. After 3 h, the wells were aspirated, and the plates were left to dry overnight. The next day, 50 μL of dimethyl sulfoxide (DMSO) was added to each well to solubilize the formazan crystals. The plates were then put on a shaker for 1 h and read spectrophotometrically at 570 nm in a plate reader. The data was then analyzed and is represented as percent cell viability.
Apoptosis assay
Cells were washed with PBS and resuspended in binding buffer before Annexin-V-FITC and propidium iodide (PI) double staining, according to the manufacturers′ instructions (BD Biosciences Pharmingen, USA). Briefly, L02 cells were collected and washed twice with PBS, followed by addition of 500 μL binding buffer, 5 μL Annexin V-FITC and 10 μL PI then were added to each group and cultures were incubated at 37℃ for 10 min in dark. The apoptosis was analyzed by flow cytometry and Cell QuestPro software (BD Biosciences).
Statistics
The data is presented as mean ± SD. The significance of differences between the groups was determined by paired Student’s t-test and/or one-way ANOVA by the GraphPad Prism 6 software, with 0.05 as the level of significance.