2.1 Chemicals and reagents
CPT (purity 98%, HPLC, Xian Yuxuan Biotechnology Co., Ltd.), RPMI 1640, Dulbecco's Modified Eagle Medium (DMEM), fetal bovine serum (FBS), Opti MEM medium, trypsin-EDTA and penicillin/streptomycin were purchased from Gibco (Grand Island, NY, USA). KO143, was obtained from MCE (Newark, NJ, USA). Non-denaturing non-reducing protein Beyotime Biotechnology (Shanghai, China). Mitoxantrone was brought from Meilunbio (Dalian, Liaoning, China). Rhodamine123 was purchased from Sigma-Aldrich (St. Louis, MO, USA). Doxorubicin was obtained from Bairui Biotechnology (Nanjing, China). Goat Anti-Rabbit IgG H&L FITC (Abcam, Cambridge, UK). MTS, BSA were provided by Biosharp (Hefei, Anhui, China). RIPA, PMSF were given by Dingguo Biotechnology (Beijing, China).
2.2 Cell culture
Human breast cancer cells (MCF-7 cells and MDA-MB-231 cells) were obtained from American Type Culture Collection (Manassas, VA, USA). MCF-7 cells were cultured in 1640 with 10% FBS and MDA-MB-231 cells were cultured in DMEM with 10% FBS. Doxorubicin multidrug resistant cell line MCF-7/ADR cells were purchased from Nanjing BERKE Biology Co., Ltd. MCF-7/ADR cells were cultured in 1640 with 10% FBS and 1.25 µg/ml doxorubicin. All of them were grown in a 5% CO2 and 95% air humidified atmosphere.
2.3 Cell viability assay
MCF-7 cells, MDA-MB-231 cells, MCF-7/ADR cells were seeded in a 96-well plate at a density of 1 × 104/well. After treating with drug or reagent, MTS (1:10 dilution in serum-free medium) was added and incubated at 37 °C for 4 h. Finally, the formazan was dissolved in DMSO and cell viability was evaluated through measuring the optical density (OD) at 490 nm using the BioTek Synergy2 microplate reader (BioTek Instruments, VT, USA).
2.4 HPLC analysis
CPT concentration was measured using HPLC. Cell lysates were extracted in the extraction buffer (containing methanol: water (1:1, v/v)) in the cold room for 15 min, followed by scraping and centrifuging at 17000 g for 10 min. CPT analysis was performed by HPLC (Waters E2695, Separations Module). Samples were injected into a 4.6mm × 250 mm Stable Bond column (ZORBAX Eclipse Plus C18; Agilent, CA, USA). The chromatography was run started with 45% solution A (methanol) and 55% solution B (H2O), and the volume (%) of solution A was raised to 50, 90, 100 at 10 min, 30 min, and 35 min respectively. Finally, the situation comes back to 45% solution A when the time of 45 min, and then holding up until stopped. Data were collected and analyzed by Analyst Software (AB Sciex).
2.5 Molecular docking assay
The three-dimensional structure of cryptotanshinone and mitoxantrone was achieved from PubChem Compound database (https://www.ncbi.nlm.nih.gov/pccompound/). Meanwhile, the structure of BCRP/ABCG2 (Protein Data Bank (PDB) ID: 6FFC with resolution of 3.56 Å) was retrieved from the Research Collaborator for Structural Bioinformatics PDB (Anonymous, www.rcsb.org). The molecular docking between the two compounds and BCRP/ABCG2 were evaluated by Discovery Studio (DS) 3.5 using the CDOCKER Protocol under the protein–ligand interaction section after preparing protein and ligands. The poses were scored by CDOCKER interaction energy, and the binding sites were also be showed.
2.6 Plasmids and transient transfection
The ERα shRNA (sense: 5’-GATCCCGCTACTGTTTGCTCCTAACCTCGAGGTTAGGAGCAAACAGTAGCTTTTTGGAT-3’; Antisense: 3’’AGCTATCCAAAAAGCTACTGTTTGCTCCTAACCTCGAGGTTAGGAGCAAACAGTAGCGG-5’)16 was synthesized by Genechem (Shanghai, China). MCF-7 cells were planted in 6-well plates at a density of 3 × 105cells/well. The ERα shRNA plasmid (888 ng/µL) were diluted in Opti-MEM (100µL) and then mixed with lipofectamine 2000 reagent (Life Technologies, NY, USA). After 6 h transfection, culture medium was changed to normal medium and sequentially incubated in 37 °C for 16 h. The Con-shRNA (535 ng/µL) was used as a negative control.
2.7 MX/Rh123/DOX/TOPO efflux experiment
The mitoxantrone (MX)/rhodamine/doxorubicin (DOX)/Topotecan (TOPO) efflux experiment were performed following the modified method as reference described17. Briefly, breast cancer cells (3 × 105 cells per well) were seeded in 6-well plates and incubated overnight. When the cell confluence reached about 80%, the drug was added. After the administration, the cells were collected by centrifugation in 2 ml tubes, and each tube was added with 1 ml of serum-free medium to homogenize the cells. Then, all the cells except the blank group were added with the corresponding compounds and incubated in the dark under 37 °C for 30 min. (The MX positive group given KO143 10 µmol/L for 15 min in advance). After the end of time, all cells were undergone 1500 rpm, 4 °C, 5 min centrifugation, and the supernatant was discarded. Then washed cells with pre-cooled PBS twice. Finally, resuspending cells with 400µL pre-cooled PBS to test. The fluorescence accumulation of MX/Rh123/DOX/TOPO is detected by BD Accuri C6 Flow Cytometry (Becton, Dickinson and Company, NY, USA). The detection channel was FL-4/FL-1/FL-2.
2.8 Non-reducing gradient gel electrophoresis
The non-reducing gradient gel electrophoresis was performed following the modified method as reference described18. After the end of the cell administration, membrane protein and cytoplasmic protein are extracted as described in 2.11. The protein samples were denatured with loading buffer that containing no reducing agents such as DTT or 2-ME. Samples were boiled at 100 °C for 15 min. And the remaining steps were essentially identical to western blotting. When detecting the BCRP polymer, membrane proteins were separated by 6% Tris-glycine SDS-PAGE and molecular weight markers were used multicolor broad range protein ladder ranging from 10 kDa to 260 kDa (Thermo Scientific, Waltham, MA, USA).
2.9 Fluorescence resonance energy transfer (FRET) microscopy imaging
The FRET method referred to several references and performed after appropriate modification19. The pCFP-ABCG2 plasmid and pYFP-ABCG2 plasmid were a gift from M.S. Jun Wang, Drug Discovery and Design Center, Shanghai Institute of Materia Medica, Chinese Academy of Sciences (Shanghai, China). The breast cancer cells were seeded in a 35 mm diameter confocal culture dish, and when the cell confluence reached to 70%, the plasmid transfection was performed. The cell transfection steps were primarily based on the protocol provided by manufacturer (Invitrogen, NY, USA). Plasmid pCFP-ABCG2 (191.3 ng/µL), pYFP-ABCG2 (399.3 ng/µL) and 3µL lipofectamine 2000 reagent (Life Technologies, NY, USA) were respectively mixed with 50µL Opti-MEM medium. After incubating for 5 min at room temperature, the above two mixtures were lightly mixed and cultured for 10 min at room temperature. Finally, the 100µL mixture was added dropwise to 1 ml serum-free medium, and 100µL FBS was added 6 hours later, then incubation was continued for 16 hours at 37 °C. After successfully transfection, the drug could be administrated. Finally, the living cell FRET image were collected by Leica inverted fluorescence microscope (Leica Microsystems, Solms, Germany) and analyzed by Image J software.
2.10 Immunofluorescence staining
Cells were plated on glass coverslips in 6-well plates and then treated with corresponding drug or reagents. First, stain the cell membrane with 10 µmol/L DiI (Beyotime Biotechnology, Shanghai, China) for 10 min at 37 °C. After that, cells were fixed in 4% paraformaldehyde for 20 min, blocked in BSA (1% BSA dissolved in PBS). Cells were incubated with corresponding primary antibody (1:100 dilution) overnight at 4 °C, followed by incubation with Goat Anti-Rabbit IgG H&L FITC (1:1000 dilution) for 2 h and Hoechst nuclear dye for 10 min in dark. The images were obtained from laser scanning confocal microscope (Leica TCS SP5 X, Solms, Germany).
2.11 Cell membrane protein and cytoplasmic protein extraction
Cell membrane protein and cytoplasmic protein were extracted according to the protocol provided by manufacturer (Beyotime Biotechnology, Shanghai, China). In brief, cells were seeded into a culture dish (Lab services, Waltham, MA, USA) with diameter of 150 mm, and treated with compounds when the cell coverage area reached about 80%. After the time of the administration, it was washed once with ice PBS, and then the cells were scraped off with scraper, collected in a centrifuge tube, 4 °C, 600 g, 5 min. Discarding supernatant and resuspending cell pellet with reagent A added with PMSF (1:100 dilution), and placed in ice bath about 10–15 min. Then, the cells were disrupted by liquid nitrogen, freezing and thawing twice, and centrifuged at 4 °C, 700 g, 10 min. The supernatant was collected, 4 °C, 14,000 g, 30 min to precipitate cell membrane fragments. The supernatant was cytoplasmic protein. The bottom cell pellet was resuspended with reagent B, vortexed 5 s, ice bath 5–10 min. Finally, 4 °C, 14,000 g, 5 min, the supernatant was cell membrane protein, which was stored at -80℃. Cells were centrifuged by Beckman Microfuge® 20R (Beckman Coulter, MA, USA).
2.12 Western blotting analysis
Western blot was performed and analyzed according to the reference15. The primary antibodies were used as follows: ERα, BCRP/ABCG2, MDR1/ABCB1 (Cell Signaling Technology, Danvers, MA, USA), GAPDH (Bioworld Technology, MN, USA). ABCC1 (Affinity, MA, USA) HRP-Goat Anti-rabbit IgG(H + L) was purchased from Bioworld Technology Company.
2.13 RNA isolation and real-time PCR
The RNA isolation experiment was mainly carried out according to manufacturer's guidelines. Total RNA was extracted from MCF-7 cells or MDA-MB-231 cells with Trizol (Vazyme, Nanjing, China) and then reversely transcribed to cDNA by HiScript® II Reverse Transcriptase (Vazyme, Nanjing, China). Real-Time PCR was executed of the ChamQTM SYBR® qPCR Master Mix (Vazyme, Nanjing, China), using Applied Biosystems 7500 Real-Time PCR Systems (Thermo Scientific, Waltham, MA, USA). GAPDH was considered as an invariant control, and mRNA levels were expressed as fold changes after normalizing to GAPDH. Table 1 listed out the primers (Sangon Biotech, Shanghai, China) used.
2.14 Statistical analysis
The results were determined using Student’s t test (two-group comparison) and ANOVA test by GraphPad Prism 5.0 software. P < 0.05 was considered to be statistically significant.