Recombinant adenoviruses construction
Recombinant adenoviruses Ad-apoE3, Ad-ApoE Sendai, Ad-ApoE Kyoto, and Ad-eGFP containing the entire coding regions of human apoE3, ApoE Sendai, ApoE Kyoto, and enhanced green fluorescent protein were packaged by GeneChem Co., Ltd., (Shanghai, China). All transgene expressions were under the control of the immediate early promoter of cytomegalovirus. Viruses were purified by double cesium chloride gradient ultracentrifugation, and viral titer was determined by plaque assay and expressed as plaque-forming units (pfu). Purified virus aliquots were stored at − 80 °C.
Vector validation in cultured HepG2 and 293T cells
In order to estimate the adenoviral gene transfection and expression efficiency in vitro, HepG2 and 293T cells were infected with four recombinant adenoviruses at multiplicity of infection (MOI) of 40 and 4, respectively. After incubation for 48 hours, the GFP expression and infection efficiency were determined under fluorescence microscopy. The cell protein and growth medium were collected for Western blot and ELISA analyses. The protein of the transfected HepG2 and 293T cells were extracted by a protein extraction kit (Bio Teke Corporation, China), and the protein concentration was determined by the BCA Protein Assay Kit (Bio Teke Corporation, China), according to the manufacturer’s protocol. Thereafter, total protein (15 µg) was loaded into each lane of acrylamide gel and subjected to SDS-PAGE. The membranes were incubated with antibodies against human ApoE (ab183597, Abcam) at 4 °C overnight; α-tubulin antibody (sc-8035, Santa Cruz Biotechnology) was used as an internal control to verify the basal expression level and equal protein loading. Target protein bands were captured by the chemiluminescence imager (iBright CL1000, Thermo Scientific).
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted using RNA extraction kit (Bio Teke Corporation, China), according to the manufacturer’s instructions. The reverse transcription of total RNA into cDNA was performed according to the instructions of HiScript®II Q RT SuperMix (R223-01, Vazyme, China). The TB Green™ Premix Ex Taq™ II kit (TaKaRa Bio, Dalian, China) was used for the qPCR. The results were performed using the CFX96TMreal-time PCR detection system (Bio-Rad, USA), which had the following program design: denaturation step at 95 °C for 30 secs, followed by 40 cycles of denaturation at 95 °C for 5 secs, annealing at 62 °C for 30 secs, and extension at 72 °C for 30 secs. The sequences of the primer pairs were as follows: GAPDH-F: ACGGATTTGGTCGTATTGGG; GAPDH-R: CGCTCCTGGAAGATGGTGAT; ApoE-F: CACAGGCAGGAAGATGAAGGTT; and ApoE-R: TAATCCCAAAAGCGACCCAGT. The relative amount of genes for internal control was calculated using the comparative 2−∆∆CT method and was normalized to that of GAPDH.
Animal model establishment
Male ApoE (−/−) mice on a C57BL/6 background were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., and genotype was determined before experiment. All animals were bred and housed at the animal experiment center of Sichuan University and were maintained on normal chow diet (4% fat, 0% cholesterol). As shown in Fig. 1, 27 weight- and age-matched (3 months of age) male ApoE (−/−) mice were randomly divided into five groups, as follows: ApoE Sendai (n = 6), ApoE Kyoto (n = 6), ApoE3 (n = 6), eGFP (n = 5), and ApoE (−/−) (n = 4). At multiple time points, blood was collected from the retroorbital venous plexus after a four-hour fasting. Plasma total cholesterol and triglyceride were detected by enzymatic assay kits (Wako Pure Chemical Co., Osaka, Japan). Accurate quantification of human ApoE in mouse plasma was determined by sandwich ELISA kit (Cat # EHAPOE, Thermo scientific). Urinary albumin was measured using a mouse albumin ELISA Quantification kit (Bethyl Laboratories, Montgomery, TX). Urine creatinine was determined by a creatinine assay kit (DICT-500, BioAssay System), according to the protocols of the manufacturer. The urine albumin–creatinine ratio (ACR) was calculated to estimate the amount of proteinuria.
Histologic Analysis
Kidneys were dissected after 90 days of virus injection. Renal sections were fixed in 4% paraformaldehyde, embedded in paraffin, and deparaffinized in xylene. Thereafter, the sections were stained with hematoxylin/eosin and periodic acid-Schiff. The rabbit antihuman ApoE polyclonal antibody (ab24139, Abcam) was used for immunofluorescence staining, which followed the standard protocol. Frozen sections were stained with Oil-red O. A small block of the kidney specimen was fixed with 2.5% glutaraldehyde for electron microscopy detection. Serial 5-µm-thick cryosections of the aortic valve were mounted on masked slides and stained with Oil-red O. The atherosclerotic area of the aortic valve in the five groups was quantified using the Motic images Advanced 3.2 software.
Statistical analysis
GraphPad prism 6 software was used to carry out statistical analyses, and all data were presented as mean ± SD. One-way analysis of variance test was used to compare the mean values between five groups, statistical significance for all comparisons was assigned at p < 0.05.