Isolation and cultivation of C. guttulatus
A C. guttulatus Zhejiang strain was isolated from a severely diarrheic rabbit. Approximately 0.5 grams of intestinal content were diluted to about 500 vegetative cells of C. guttulatus per milliliter with sterilized distilled water. Then, 20 microliters of the suspension were added to 10 milliliter YPG (pH 1.5) medium supplemented with 100mg/L ampicillin. It was cultured on a 96-well culture plate with 100 microlitres of medium per well at 37℃ with 10% CO2 for 2 hours. Wells with a single C. guttulatus vegetative cell were further cultured for 5 days before monoclonal cells of C. guttulatus were smeared and cultivated on solid YPG plate (pH 4.5) supplemented with 100 mg/L ampicilin at 37℃ with 10% CO2. A single colony of C. guttulatus was transferred to liquid YPG medium (pH 4.5) and cultivated at 37℃ on a orbital shaker (Zhichu, China) at a constant rotating speed of 200 rpm. Yeast multiplication was monitored using an automatic microbial growth curve analyser (Bioscreen, Finland) and an optical density scanner (Bug Lab, USA).Culture conditions were optimized by varying the medium pH and culture temperature.
C. guttulatus identification
The morphology of C. guttulatus Zhejiang strain was observed under a light microscope with 400× magnification. Molecular identification was undertaken by PCR and gene sequencing. Two specific primer pairs for the small subunit (18S) and large subunit (26S) ribosomal RNA genes were synthesized according to Kurtzman CP (1998) [23]. The primer pairs were: 18S upper primer (TACGGTGAAACTGCGAATGG), 18S lower primer (GCTGATGACTTGCGCTTACT), 26S upper primer (GCATATCAATAAGCGGAGGAAAAG) and 26S lower primer (GGTCCGTGTTTCAAGACGG). The PCR conditions for the 18S DNA fragment were initial denaturation at 95 °C for 5 min, followed by 30 cycles of 94 °C denaturation for 45 sec, primer annealing at 55 °C for 45 sec, and extension at 72 °C for 90 sec. A final primer extension of 10 min at 72 °C completed the amplification process. The amplification for 26S was the same as for 18S except for extension at 72 °C for 120 sec during the PCR cycles. C. guttulatus vegetative cells were directly used as the template for PCR. The PCR products were examined and separated by 1% agarose gel electrophoresis. The target bands were purified by a gel extraction kit and sequenced by Sangon Biotech (Shanghai, China). The sequenced 18S and 26S gene fragments of the C. guttulatus Zhejiang isolate were submitted to Genbank with the Bankit procedure and blasted in the NCBI (National Center for Biotechnology Information, USA) database. Similar reference sequences were retrieved. The phylogenetic analysis was performed using the MegAlign program (DNAstar Inc., USA). The phylogenetic tree was constructed using the Clustal W method. Informations about C. guttulatus isolates and other yeast species used the construction of the phyogenetic trees are listed in Table 1.
Animals
Specific-pathogen-free (SPF) rabbits were purchased from Pizhou Dongfang Rabbit Breeding Co., Ltd (Pizhou, China) and reared in our institute. Pre-weaning SPF rabbits were supplied with carrots and 0.5% milk powder in drinking water. No coccidia oocysts and C. guttulatus were detected in feces of these rabbits before use.
Inoculation of Cyniclomyces guttulatus in rabbits and examination of yeast colonization in the gastrointestinal tract
Three groups of 20 day-old SPF rabbits (n=4) were orally inoculated with 1×106, 1×107 or 1×108 C. guttulatus vegetative cells per rabbit, and designated as G1, G2 and G3, respectively. Another group (G4) was not inoculated with the yeast and served as the control. Body weight, activities, appetite and excreta were recorded before and after yeast inoculation. Feces from all groups were collected daily and examined for yeast cells under a light microscope.
All rabbits were euthanized 18 days after inoculation. Contents and the mucous layer of the stomach, duodenum, jejunum, and ileum were collected, smeared and microscopically examined. Because the yeast was observed in the stomach (see Results), tissues from different regions of the stomach were immediately frozen for microscopic examination, and fixed in 10% formalin for preparation of paraffin sections for microscopic observation after staining with PAS (Periodic acid-schiff) and in 5% glutaraldehyde for preparation of electron-microscope sections for observation by transmission electron microscopy.
Co-infection of Cyniclomyces guttulatus and Eimeria intestinalis in rabbits
Two groups (designated as CG and CG/EI) of 28 day-old SPF rabbits were orally inoculated with 4×107 C. guttulatus cells per rabbit (n=4). After 14 days, CG/EI and another group (designated as EI, without C. guttulatus inoculation) were infected with 1×104 sporulated oocysts of E. intestinalis. One group (designated as NON) served as un-infected control. Body weight, activities, appetite and excreta were recorded before and after inoculation. Feces were collected for coccidial oocysts and yeast cell counting. E. intestinalis oocysts in feces were counted between 10-16 days after infection using the McMaster method as described previously (Jeffers, 1975). Vegetative cells of C. guttulatus were counted 2 days before to 14 days after the infection of E. intestinalis. Briefly, one gram of feces was mashed with a glass stick and mixed with 60 milliliter of tap water. The fecal suspension was filtered through a 100-mesh sieve. C. guttulatus cells in the filtrate were counted in a haemocytometer under a light microscope with 100× magnification.
Prevalence survey
Fecal samples were collected from 253 healthy rabbits in four regions including Fuyang, Haining, Deqing and Wencheng (abbreviated names: FY, HN, ZX and WC) in Zhejiang province of China. The sample numbers from FY, HN, DQ and WC were respectively 50, 50 49 and 104. Among the surveyed rabbits, 66 were below 60 days old and 187 above 60 days old. The collected samples were stored at 4℃ and examined within one week. The examination was performed as follows: 2 grams of feces were mixed with 60 milliliter of tap water. The mixture was filtered through a 100-meshsieve. Then, 100 microliter of filtrate was collected for wet mount examination under a light microscope with 100× magnification. Twenty fields were observed for each sample.
Statistical analysis
Statistical analyses were performed for C. guttulatus cell counts, rabbit body weight, and E. intestinalis oocyst counts by GraphPad Prism 5.01. Data were expressed as mean±standard deviation, and the t-test was used to analyse differences between the mean values. Differences between groups with p values < 0.05 were considered statistically significant.