Hcfc1a regulates neural precursor proliferation and asxl1 expression in the developing brain

doi:10.21203/rs.2.18231/v1

Download PDF

Research article

Hcfc1a regulates neural precursor proliferation and asxl1 expression in the developing brain

https://doi.org/10.21203/rs.2.18231/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background: Precise regulation of neural precursor cell (NPC) proliferation and differentiation is essential to ensure proper brain development and function. The HCFC1 gene encodes a transcriptional co-factor that regulates cell proliferation, and previous studies suggest that HCFC1 regulates NPC function. However, the molecular mechanism underlying these cellular deficits has not been completely characterized.

Methods: Here we created a zebrafish harboring mutations in the hcfc1a gene (the hcfc1a^co60/+ allele), one ortholog of HCFC1, and utilized immunohistochemistry and RNA-sequencing technology to understand the function of hcfc1a during neural development.

Results: The hcfc1a^co60/+allele results in an increased number of NPCs, neurons, and radial glial cells. These deficits are associated with the abnormal expression of asxl1, a polycomb transcription factor, which we identified as a downstream effector of hcfc1a using high throughput RNA sequencing technology. Inhibition of asxl1 activity and/or expression in larvae harboring the hcfc1a^co60/+allele completely restored the number of NPCs to normal levels.

Conclusion: Collectively, our data demonstrate a novel pathway in which hcfc1a regulates NPCs and neurogenesis.

Neurology

HCFC1

neural precursor cells (NPCs)

brain development

asxl1

Neural precursor cells (NPCs) give rise to the differentiated cells of the central nervous system and defects in the number produced, their proliferation, and/or cell death can result in a variety of neural developmental disorders. These disorders include intellectual disability (1), cognitive dysfunction (2), behavioral impairment (3), microcephaly (4), epilepsy (5), autism spectrum disorders (6), and cortical malformations (7). Previous studies have demonstrated a complex network of transcription factors that are responsible for modulating NPC function including SOX2 (8), SOX1 (9), NESTIN (10), and PAX transcription factors (11). Recent evidence suggests that the HCFC1 gene, which encodes a transcriptional cofactor, is essential for stem cell proliferation and metabolism (12,13) in a variety of different tissue types, including neural precursors (14–17). These data strongly suggest that HCFC1 is part of a more global transcriptional program modulating NPC proliferation and differentiation.

HCFC1 regulates a diverse array of target genes and has been shown to bind to the promoters of more than 5000 unique downstream target genes (18). Consequently, the molecular mechanisms by which HCFC1 regulates NPC proliferation and differentiation are complex. Mutations in HCFC1 cause methylmalonic acidemia and homocysteinemia, cblX type (cblX) (309541). cblX is an X-linked recessive disorder characterized by defects in cobalamin (vitamin B12) metabolism, nervous system development, neurological impairment, intractable epilepsy, and failure to thrive (19). Functional analysis of cblX syndrome has provided a platform whereby the function HCFC1 in discrete organs and tissues can be elucidated. For example, in vitro analysis has demonstrated that HCFC1 regulates metabolism indirectly by regulating the expression of the MMACHC gene (12,14,15,19). These data are further supported by in vivo analysis using transient knockdown in the developing zebrafish (16,20). Additional mouse models exist and have demonstrated a function for HCFC1 in diverse cell populations (21,22), including a subset of NPCs (17). However, although it is clear that HCFC1 is essential for NPC function (17), previous studies have not yet determined a mechanistic basis for the cellular phenotypes observed. Thus, additional studies examining the function of HCFC1 in NPCs are warranted.

We have created a zebrafish harboring a mutation in the hcfc1a gene (hcfc1a^co60/+allele) using CRISPR/Cas9. Zebrafish have two orthologs of HCFC1 and in previous studies, we demonstrated that hcfc1b is important for NPC function (16). The two zebrafish paralogs have been shown to have divergent functions, as the knockdown of hcfc1b causes facial dysmorphia, but knockdown of hcfc1a does not (20). Therefore, we asked whether germline mutations in the hcfc1a gene cause defects in neural development. Our results demonstrate that the hcfc1a^co60/+allele results in increased numbers of proliferating NPCs (Sox2+). Subsequent RNA sequencing on whole brain homogenates obtained from the hcfc1a^co60/+allele identified increased expression of asxl1, which encodes a transcription factor known to modulate the cell cycle (23,24). Furthermore, inhibition of asxl1 expression in larvae carrying the hcfc1a^co60/+allele restored the number of NPCs to normal levels. Collectively, our study demonstrates a molecular mechanism by which hcfc1a regulates NPC proliferation and differentiation.

Experimental Model and Subject Details

The experimental model used in this study is the zebrafish, Danio rerio. The hcfc1a^co60/+allele was produced using CRISPR/Cas9 methodology as described (25). Briefly, a guide RNA (GGTTCATACCAGCCGTTCGT) was designed using publicly available software (ZiFit) (26). Oligonucleotides from the forward and reverse strand were annealed and ligated into the DR274 vector as described (27). Guide template DNA was synthesized using PCR amplification with primers (DR274 FWD: TTTGAGACGGGCGACAGAT and DR274 Rev: TTCTGCTATGGAGGTCAGGT) and RNA was synthesized using the MEGAscript T7 in vitro transcription kit. Cas9 was synthesized using the T7 mMessage machine after linearization with PmeI (New England Biolabs) of the Cas9 vector (pMLM3613). A solution (0.2M KCl with phenol red indicator) containing a final concentration of 500ng Cas9 and 70 ng of guide RNA was injected at a volume of 2nL into the single celled embryo and the embryos were grown to adulthood. The hcfc1a^co60/+allele was generated from a single founder (F₀), which was outcrossed with 3 independent wildtype (AB) fish to generate 3 families of F1 carriers. Each family consisted of approximately 20 total fish with equal numbers of males and females. To generate subsequent generations, we outcrossed a minimum of 3 F1 individuals with wildtype (Tupfel Long Fin) to obtain a minimum of 3 families of F2 carriers. We subsequently outcrossed F2 carriers (minimum of 3) with wildtype (AB) fish to produced an F3 generation of approximately 3 total families with equal numbers of males and females. Sanger sequencing confirmed mutation and experiments were initiated in the F3 generation.

The Tg(hsp701:HCFC1) was created using Gateway cloning technology. Briefly, the p5e-hsp701, pME-HCFC1 (created from pcDNA6.1 reported in (20)), p3E-polyA, and the pDestTol2PA were recombined via LR recombination. The resultant vector was co-injected with transposase mRNA synthesized from the pCS2FA vector as previously described (28). The experiments described herein were performed in the F2 generation, which was produced from a single founder (F₀). The positive F₀ carrier was outcrossed with wildtype (AB) to produce 2 families of F1 individuals and a minimum of 3 carriers of the F1 generation were outcrossed to produce 3 families of F2 carriers that were utilized for the experiments described.

For all experiments, embryos (prior to sexual dimorphism) were obtained by crossing AB wildtype, Tupfel Long Fin wildtype, Tg(hsp701:HCFC1), or hcfc1a^co60/+. Experiments were performed at developmental stages only (0-5DPF). All embryos were maintained in embryo medium at 28^◦ C.

Genotyping

Genotyping of the hcfc1a^co60/+ allele was performed by lysing excised larval tissue or fin clips (adults) in lysis buffer (10mM Tris pH 8.2, 10mM EDTA, 200mM NaCl, 0.5% SDS, and 200ug/ml proteinase K) for 3 hours at 55◦ C. DNA was isolated according to standard phenol chloroform : ethanol precipitation procedures. Primers pairs were developed that specifically bind to and amplify the mutated allele and did not amplify the wildtype allele. The fragment of interest was amplified by standard PCR at an annealing temperature of 64^◦(FWD: CCAGTTCGCCTTTTTGTTGT and REV: ACGGGTGGTATGAACCACTGGC). Positive amplification indicates positive carriers of the allele (Figure 1). Genotyping of the Tg(hsp701:HCFC1) allele was performed with the following primers: forward primer (TGAAACAATTGCACCATAAATTG) present in the hsp701 promoter and reverse primer in the HCFC1 open reading frame (CGTCACACACGAAGCCATAG). Amplification indicates the genotype of interest.

Immunohistochemistry

Embryos/larvae were fixed in 4% paraformaldehyde (Electron Microscopy Sciences) for 1 hour at room temperature (RT). For each time point, a small piece of caudal tissue was excised for genotyping and the remaining rostral tissue was embedded in 1.5% agarose (Fisher) produced in 5% sucrose (Fisher) and embryo medium. Embedded blocks were incubated overnight in 30% sucrose (Fisher) and then snap frozen with dry ice and cryosectioned (12-20uM). Sections were washed twice in 1X phosphate buffered saline (PBS) pH 7.4 at RT for 30 minutes each and blocked for 1 hour in blocking buffer (2mg/ml bovine serum albumin (Fisher), 2% goat serum (Fisher) diluted in 1X PBS). Primary antibody (1:200 anti-Sox2 (Abcam) or 1:500 anti-HuC/D (Fisher) was incubated overnight at 4◦C and then washed twice in 1X PBS for 30 minutes each at RT. Alexa fluor antibodies (Fisher) were diluted 1:200 and incubated on each slide for 1 hour at RT. All slides were cover slipped using Vectashield (Vector Laboratories) and imaged on a Zeiss LSM 700 at 20X-63X magnification. For cell proliferation, larvae were pulsed in 20mM EdU (Fisher) diluted in 10% dimethyl sulfoxide (DMSO) (Fisher) for 30 minutes at RT prior to fixation. EdU was detected using the EdU Click-It technology (Fisher) according to manufacturer protocol.

Cell Quantification

For cell quantification, sections were first divided into forebrain, midbrain, and hindbrain regions using two zebrafish brain atlases 1) Atlas of Zebrafish Development (29) and 2) Atlas of Early Zebrafish Brain Development (30). To specify brain regions, major hallmark sub-divisions of each brain section were separated based on age of larvae and the published sections and demarcations present in (30). For example, sections of the developing brain are organized by letters: A-F indicate forebrain sections, G-L are midbrain, and M-R are hindbrain according to the zebrafish brain atlas. After standardization of the brain region by atlas, cells from each section (12-20uM) were counted using the ImageJ cell counter. The ImageJ cell counter allows for the manual counting of cells by marking each cell with a colored square and adds the tallied cell to the quantification sheet. The cell counter allows for the tally 4 independent groups separately with a different color square. Cells were easily visible across all replicates. Only biological replicates with high tissue integrity were quantified. For comparison of representative images equivalent sections are shown to ensure that minor changes in tissue geometry do not affect the overall conclusion. These sections are standardized from the zebrafish brain atlas. For bar graphs, the average number of cells across each brain region were utilized for quantification using approximately, 10-20 equivalent sections/brain region/fish were quantified. The number of animals per group is described in each figure legend. To determine the relative increase/decrease in total cell number, the number of total cells/section was divided by the average number of cells present in wildtype siblings for each brain region analyzed and multiplied by 100. All statistical analysis was performed using total numbers of cells/section/brain region. All immunohistochemistry was validated with quantitative real time PCR (QPCR) of each gene analyzed.

QPCR and in situ hybridization

Whole mount in situ hybridization ISH was performed as described by Thisse and Thisse (31). Briefly, embryos were harvested and dechorionated at the indicated time point and fixed in 4% paraformaldehyde (PFA) (Electron Microscopy Sciences) for 1 hour at room temperature (RT). Embryos were permeabilized with proteinase K (10ug/ml) for the time indicated by Thisse and Thisse (32). Permeabilized embryos were prehybridized in hybridization buffer (HB) (50% deionized formamide (Fisher), 5X SSC (Fisher), 0.1% Tween 20 (Fisher), 50mg ml^-1 heparin (Sigma, St. Louis), 500mg ml^-1 of RNase-free tRNA (Sigma), 1M citric acid (Fisher) (460ml for 50ml of HB)) for 2-4 hours and then incubated overnight in fresh HB with probe (50-100ng) at 70°C. Samples were washed, blocked in 2% sheep serum, and incubated with anti-DIG Fab fragments (1:10,000) (Sigma) overnight at 4°C. Samples were developed with BM purple AP substrate (Sigma) and images were collected with a Zeiss Discovery Stereo Microscope fitted with Zen Software. The asxl1 cDNA probe sequence was amplified using the following primers: FWD: CATCAACACACGGACCTTTG and REV: CAGTGAGTGGGGTGGAAGTT, purified using a DNA purification kit (Fisher), then ligated into the pGEM-T easy vector using the pGEM T-easy Plasmid Ligation Kit (Promega).

For QPCR, RNA was isolated from embryos at the indicated time point using Trizol (Fisher) according to manufacturer’s protocol. Reverse transcription was performed using Verso cDNA synthesis (Fisher) and total RNA was normalized across all samples. PCR was performed in technical triplicates for each sample using an Applied Biosystem’s StepOne Plus machine with Applied Biosystem’s software. Sybr green (Fisher) based primer pairs for each gene analyzed are as follows: mmachc fwd: GCTTCGAGGTTTACCCCTTC, mmachc rev: AGGCCAGGGTAGGGTCCTG, hcfc1a fwd: ACAGGGCCTAACACAGGTTG, hcfc1a rev: TCCTGTGACTGTGCCAAGAG, asxl1 fwd: CCAGAGCTGGAAAGAACGTC, asxl1 rev: ACATCTCCAGCTTCGCTCAT, rpl13a fwd: TCCCAGCTGCTCTCAAGATT, rpl13a rev: TTCTTGGAATAGCGCAGCTT, sox2 fwd: AACTCCTCGGGAAACAACCA, sox2 rev: ATCCGGGTGTTCCTTCATGT, elavl3 fwd: TAACGGCCCTGTCATTAGCA, elavl3 rev: CGTGTTGATAGCCTTGTCGG, gfap fwd: GGCCAACTCTAACATGCAGG, gfap rev: ATTCCAGGTCACAGGTCAGG, olig2 fwd: TTCTGTAGGCCACACACCAG, and olig2 rev: TTAACTCCGGTGGAGAATCG. Analysis was performed using 2^DD^ct.

For RNA sequencing analysis, total RNA was isolated from brain homogenates (N=12/group from 3 biological replicates), analyzed for RNA integrity, and sequenced at The University of Texas El Paso Border Biomedical Research Center Genomics Core Facility. RNA sequencing was performed in biological triplicate. RNA integrity was assessed with a TapeStation 2200 and the library was prepared with a TruSeq stranded mRNA library preparation kit. Sequencing was performed on a NextSeq500 (Illumina) using a high output kit V2 (150 cycles). For analysis, the sequences were quality trimmed using Trimmomatic (33) and aligned to the Danio rerio genome (build GRCz11) obtained from Ensembl v95 using Tophat2 (34). Cufflinks (35) was used to determine the differential expression patterns between mutant and wildtype samples.

Tg(hsp701:HCFC1) analysis and rescue experiments.

F2 carriers of the Tg(hsp701:HCFC1) were incrossed and grown at 28^◦ for 24 hours and then split into two groups, non-heat shock and heat shock. Heat shock was performed for 30 minutes at 38^◦and then allowed to acclimate at room temperature for 20 minutes. Heat shock was initiated at 24 HPF and performed every 8 hours until 5 DPF. For LY294002 (Selleck Chemicals) rescue, the drug was dissolved in 100% Dimethyl-Sulfoxide (DMSO) (Fisher) and embryos were treated at 24 hpf with a 12uM concentration for a period of 24 hours. Media was removed and embryos were dechorionated and fixed for immunohistochemistry.

For morpholino rescue, 2 nL of a 0.1 mM solution of asxl1 targeting translation inhibiting morpholinos (GTTTGTCCTTCATTTCCTCAGTGTT) or random control morpholinos (Gene-Tools) were injected into offspring of the hcfc1a^co60/+ allele. Injected embryos were fixed at 2 DPF and simultaneously stained for the number of Sox2+ and/or EdU+ positive cells. Cells were counted as described above.

Quantification and Statistical Analysis

For all assays, statistical significance was calculated using a Student’s T-test to compare the means of two groups. All assays were performed in biological duplicate and triplicate and all QPCR was performed in technical triplicate. For each assay, the total number of animals (N) is indicated in the figure legend. Number of animals was determined based on power analysis conducted from preliminary studies. For all graphs, statistical significance between groups and the P-value is demonstrated in the figure legends. For cell quantification, the number of Sox2+ or EdU+ cells were counted per section and normalized according to the Material and Methods Section above. All sections were sub-divided based on landmarks in the Atlas of Early Zebrafish Brain Development, 2^nd Edition and then separated into specific brain regions (forebrain, midbrain, and hindbrain). All graphs represent error bars as standard error of the mean (SEM).

Production of the hcfc1a^co60/+allele.

Previous studies suggest that HCFC1 regulates NPC function in vitro and in mouse models (14–17). HCFC1 is highly conserved across species (19) and zebrafish have been used in previous reports as a model system to understand the mechanisms by which mutations in HCFC1 cause disease (16,20). Therefore, we developed a zebrafish harboring a germline mutation in the hcfc1a gene using CRISPR/Cas9 technology. We developed a specific guide RNA (sgRNA) that targets exon 4 of the hcfc1a gene (Figure 1A). The sgRNA was injected at the single cell stage and resulted in the net insertion of 13 nucleotides (Figure 1A). The introduction of these nucleotides is predicted to introduce a premature stop codon and encode a peptide of 94 amino acids in length (Supplemental Figure 1). Full length hcfc1a is 1778 amino acids in length. Genotyping of the hcfc1a^co60/+ allele was developed according to the Materials and methods section, using a reverse primers unique to the mutant allele in the amplification strategy (Figure 1A). Positive amplification was indicative of positive carriers (Figure 1B), as the primers did not bind to or amplify the wildtype allele. Initial crosses between heterozygous carriers of the hcfc1a^co60/+failed to generate homozygous progeny and did not obey Mendelian inheritance patterns. These results indicate that Hcfc1a is required for early development, which is consistent with previously published studies (21,22), however the mechanism for embryonic lethality of the homozygous allele was not explored further here. However, since knockdown of hcfc1a is not homozygous lethal (20), we surmised that heterozygous carriers of the hcfc1a^co60/+ allele would have defects in overall hcfc1a expression and potential defects in brain development. Therefore, we measured the expression of hcfc1a in carriers of the hcfc1a^co60/+allele and their wildtype siblings using quantitative real time PCR (QPCR). We designed primers to detect hcfc1a expression downstream of Exon 4 that span exons 15 and 17 so as to ensure that such primers were capable of detecting changes in total mRNA expression and not deficiencies in Exon 4 only. As shown in Figure 1C, at 2 DPF carriers of the hcfc1a^co60/+allele had a 50% decrease in total hcfc1a mRNA (P<0.05).

Hcfc1a regulates NPC number in vivo.

Several studies suggest that mutation or disruption of Hcfc1 (mouse) mRNA disrupts NPC function. Moreover, we have previously published that hcfc1a is expressed in the developing brain across the forebrain, midbrain, and hindbrain (20). Therefore, we asked whether the decrease in hcfc1a mRNA expression in carriers of the hcfc1a^co60/+resulted in abnormal NPC development in vivo. To test this, we first measured the expression of sox2 and pax6 using QPCR at 5 days post fertilization (DPF). We used sox2 and pax6 as a readouts for NPCs because they are co-localized and established markers of NPCs in the field (36–38). At 5DPF, the expression of both sox2 and pax6 were up-regulated in hcfc1a^co60/+larvae relative to their wildtype siblings (Figure 2A). We next compared the total number of Sox2+ cells in hcfc1a^co60/+larvae and their wildtype siblings over the course of development at 1, 2, and 5 DPF. Increased NPCs were not observed until 2 DPF (Figure 2C) and were sustained until 5 DPF (Figure 2D). hcfc1a^co60/+larvae had increased numbers of NPCs in the forebrain, midbrain, and hindbrain regions, with NPCs highly enriched in the ventricular region of the developing brain (Figure 2E-H and E’-F’, arrowheads indicate cells). There was approximately 25-30% more Sox2⁺cells per brain region based upon our quantification (Figure 2).

The hcfc1a^co60/+allele disrupts cell proliferation.

Based upon previously published data (17), we hypothesized that the excess NPCs produced undergo cell death. To measure cell death, we performed immunohistochemistry with anti-active caspase 3 antibodies and anti-Sox2 antibodies. We quantified the number of Sox2+ cells undergoing apoptosis in hcfc1a^co60/+larvae. As shown in Figure 3A, the hcfc1a^co60/+allele increased the number of caspase positive NPCs (red bars), however the vast majority of NPCs in both wildtype and hcfc1a^co60/+larvae were not caspase positive (gray bars), indicating that a significant fraction of NPCs survive. Because of this survival, we next analyzed cell proliferation in hcfc1a^co60/+larvae and their wildtype siblings using 5-ethynyl-2’-deoxyuridine (EdU) and EdU click-it technology. The hcfc1a^co60/+ allele resulted in a statistically significant increase in the number of EdU positive cells in both the midbrain and hindbrain regions (Figure 3B) and an increase in EdU positive cells in the forebrain, although the increase in the forebrain was not significant across multiple biological replicates (P=0.06). Collectively, these data suggest the hcfc1a^co60/+allele results in an increase in NPC proliferation, whereby a sub-population of these NPCs undergo cell death, while the majority of those NPCs produced, survive.

The hcfc1a^co60/+allele is associated with abnormal differentiation.

The hcfc1a^co60/+allele is associated with increased proliferation and an increased number of NPCs. Importantly, the majority of these cells did not undergo cell death and therefore, we asked if the excess NPCs undergo differentiation. We measured the expression of 3 established markers of differentiation; elavl3 (neurons) and gfap (radial glial cells) by immunohistochemistry. As shown in the Figure 4A’&B’, Gfap and Elavl3 expression were increased in hcfc1a^co60/+larvae at 5 DPF.. Next, we quantified the level of expression of each marker and one additional marker of differentiation (olig2) using QPCR at 5DPF. QPCR demonstrated an increase in the level of mRNA expression of each marker (Figure 4C) in hcfc1a^co60/+larvae relative to their wildtype siblings (P<0.05).

Overexpression of HCFC1 reduces the number of NPCs and decreases the number of differentiated cells.

Our data demonstrates that haploinsufficiency of hcfc1a disrupts NPC function. Previous studies have shown that over-expression of Hcfc1 (mouse) in vitro has the opposite effect (15). We tested this possibility by creating a transgenic zebrafish expressing human HCFC1 under the control of the heat shock promoter for the hsp701 gene. The efficacy of the hsp701 promoter in zebrafish has been widely established in previous studies (28,39–43). We activated expression of HCFC1 by performing a heat shock as described in the materials and methods for a period of 5 days. We first measured the expression of sox2, elavl3 (HuC/D), gfap, and olig2. Activation by heat shock in the Tg(hsp701:HCFC1) allele resulted in decreased expression of all markers analyzed (Figure 5A; P<0.05). We next analyzed the number of Sox2+ cells in the presence and absence of heat shock. Activation of the Tg(hsp701:HCFC1) was associated with a decreased number of NPCs across the forebrain (P=4.88568E-05), midbrain (P=0.004359), and hindbrain (P=0.0776) (Figure 5B).

Asxl1 is overexpressed in animals with the hcfc1a^co60/+allele.

HCFC1 is known to regulate metabolism and craniofacial development via the modulation of MMACHC expression (14,19,20). Therefore, we hypothesized the neural phenotypes associated with mutations in hcfc1a were the direct consequence of defects in mmachc expression. We measured the expression of mmachc in hcfc1a mutants and their wildtype siblings in whole brain homogenates. As shown in Figure 6A, QPCR analysis demonstrated that mmachc expression was unchanged by the hcfc1a^co60/+allele. Based upon these data, we hypothesized that hcfc1a regulates brain development in an mmachc independent manner. To better understand the mechanisms downstream of hcfc1a, we performed RNA-sequencing at 2 DPF using whole brain homogenates from wildtype and hcfc1a^co60/+ larvae (Table 1). Using literature analysis, we identified the asxl1 gene as one a possible downstream effector of Hcfc1a in the developing brain. asxl1 encodes a transcriptional regulator that is essential for proper cell proliferation and whose deletion causes cellular senescence (24,44). More importantly, mutations in ASXL1 have been associated with Boring Opitz Syndrome (605039), which has been characterized by profound intellectual disability (45). According to in situ hybridization, asxl1 expression was restricted to the developing zebrafish brain (Figure 6B&B’) and QPCR analysis of brain homogenates validated a 14-fold increase of asxl1 expression at 2 DPF in hcfc1a^co60/+larvae relative to wildtype siblings (Figure 6C).

Inhibition of asxl1 restores the NPC phenotype in hcfc1a^co60/+larvae.

Deletion of Asxl1 in mouse embryonic fibroblasts (MEFs) causes growth retardation because Asxl1 regulates the cell cycle via AKT-E2F (24). Based upon these data, we hypothesized that over-expression of asxl1 in hcfc1a^co60/+larvae promotes proliferation of NPCs. To test this hypothesis, we designed a translational blocking morpholino to inhibit asxl1 expression in hcfc1a^co60/+larvae. We determined the concentration for injection empirically and selected the highest concentration that promoted >70% survival of injected embryos. We injected asxl1 morpholinos or random control morpholinos into hcfc1a^co60/+larvae and their wildtype siblings at the single cell stage and we analyzed the number of EdU positive cells at 2 DPF. As shown in Figure 6D, the injection of random control morpholinos into hcfc1a mutants and their wildtype siblings had no detrimental effects and recapitulated the NPC phenotype previously observed (i.e. increased NPCs, Figure 2). However, the injection of asxl1 morpholinos completely restored the number of NPCs to wildtype levels in all brain regions (Figure 6D, red bars).

Morpholinos can display off-target effects (46) and therefore we sought an alternative route of asxl1 inhibition in hcfc1a^co60/+larvae. Youn and colleagues have demonstrated that ASXL1 (mouse) promotes cell proliferation by binding to AKT kinase and promoting AKT phosphorylation (24) (Figure 7A). However, this function can be inhibited by decreasing the activity of PI3K/AKT. Therefore, we treated hcfc1a^co60/+larvae and their wildtype siblings with LY294002, as described in (24). hcfc1a^co60/+embryos were treated at 24HPF with 12uM LY294002 or vehicle control (DMSO). Vehicle treatment of wildtype and hcfc1a^co60/+larvae recapitulated the NPC phenotype present in hcfc1a^co60/+larvae across all brain regions as both the number of Sox2+ cells and the number of EdU+ were increased in hcfc1a^co60/+larvae (Figure 7B&C). In contrast, treatment with LY294002 reduced the number of cycling cells (EdU+) and the number of NPCs (Sox2+) in hcfc1a^co60/+larvae, consistent with our hypothesis (Figure 7B&C, red bars). To complement these data, we next performed mRNA expression analysis of sox2, asxl1, and cyclin E (ccne1) in treated and untreated hcfc1a^co60/+larvae at 5 DPF. As shown in Figure 7D, treatment with LY294002 resulted in decreased expression of sox2 and asxl1, which was correlated with decreased cyclin E expression (P<0.05).

Here we demonstrate that the hcfc1a^co60/+allele results in an increase in the number of NPCs during early brain development. This increase in NPC number is a direct consequence of over proliferation of NPCs. Mutations in HCFC1 cause cblX syndrome, a multiple congenital anomaly syndrome, associated with cobalamin deficiencies and significant neurological deficits, among other phenotypes (15,19). HCFC1 encodes for a transcriptional co-activator that regulates genes important for metabolism and proliferation (12). It is suggested that HCFC1 binds to and regulates the expression of >5000 different genes (18), with various different interacting partners including THAP11 (13) and ZNF143 (47), where mutation of either can cause a cblX like disorder (16,48).

Previous reports suggest that HCFC1 regulates NPC function (14–17). In vitro, decreased Hcfc1 (mouse) expression increases the number of NPCs and reduces the expression of markers associated with differentiation (14). These data are consistent with the known function of Hcfc1 in cell proliferation (49–51). Mutation of Hcfc1 (mouse) is embryonically lethal (21) and consequently, the in vivo function of HCFC1 has been difficult to characterize. Our results are consistent with this observation as we did not detect homozygous mutant larvae. We sequenced larvae from an incross of hcfc1a^co60/+larvae at 2, 4, and 8 hours post fertilization (HPF) and even at the earliest time point we detected only heterozygous carriers. We did not explore this mechanism further, however in previous studies the murine Hcfc1 mutant allele was subject to compensatory mechanisms and only the paternally inherited allele was viable (21). Zebrafish do not have sex chromosomes, but future studies are warranted that characterize the inheritance of the Co60 allele.

Recently a cell-type specific mutant allele was created in which Hcfc1 (mouse) was deleted from a sub-population of neural precursors (NKX2.1+). This cell type specific deletion of Hcfc1 (mouse) induces cell death and defects in differentiation without affecting proliferation. The discrepancy between these results could be explained by many factors including the propagation of neurospheres in vitro and the inability to decipher how the developing microenvironment affects normal physiology. However, some studies have helped to shed light on the latter explanation because the in vivo knockdown of hcfc1b, one of the zebrafish orthologs of HCFC1, resulted in increased NPC proliferation (16). Thus, the function of HCFC1 is complex, with several unknown cell-type specific functions that can be affected by the surrounding microenvironment of the developing brain.

Here we developed a zebrafish harboring a germline mutation in the hcfc1a gene. We analyzed the effects of this mutation on NPC function. Consistent with the literature (14–16), our allele resulted in an increase in the number of Sox2+ cells and increased cellular proliferation without significant deficits in cell survival. Increased cell proliferation was observed across different brain regions. Strikingly, the vast majority of additional NPCs produced in our system did not undergo apoptosis, but instead differentiated and over produced neurons and glia. Future analysis that monitor brain volume and the ratio of gray and white matter are essential because the increases in neurons and glia are unique from the differentiation defects observed in previous studies (14,17). However, we suspect the difference in phenotype is associated with the type of mutation introduced, the brain microenvironment, the cell population analyzed, and the region of the brain of interest. For example, Minocha and Herr (17) deleted exons 2 and 3 of Hcfc1 using a Cre-Lox system with a cell type specific promoter. The resulting approach introduces the formation of a truncated protein, whereas, our system results in decreased overall expression (Figure 1) more consistent with previous in vitro assays and haploinsufficiency. However our haploinsufficient allele advances the field because unlike the previous in vitro assays (14,15), our allele accounts for the broad expression of Hcfc1 which was recently documented by Minocha and colleagues (17).

HCFC1 regulates a myriad of downstream target genes (12,18) and therefore, the mechanisms by which HCFC1 regulates NPC function are not clear. The majority of the literature focuses primarily on the function of HCFC1 at the MMACHC promoter in the human syndrome, cblX. cblX disorder is the result of mutations in the HCFC1 gene and these mutations disrupt protein function causing a decrease the expression of MMACHC and a metabolic disorder (14,19). Interestingly, mutations in MMACHC cause cblC disorder, which has many overlapping phenotypes with cblX including neurodevelopmental defects (52). These data led us to hypothesize that HCFC1 regulates NPC function by modulating MMACHC expression. However, the hcfc1a^co60/+allele did not disrupt mmachc expression. These data suggest that hcfc1a^co60/+allele disrupts NPC function by a novel molecular mechanism. In addition, these data suggest some divergent function between hcfc1a and hcfc1b, as the latter has been shown to regulate mmachc expression and craniofacial development (20).

Our results strongly suggest an mmachc independent mechanism underlying the neural developmental phenotypes associated with the hcfc1a^co60/+allele, but we cannot completely rule out that hcfc1b regulates brain development via mmachc expression. RNA-sequencing of brain homogenates provided us a list of potential downstream candidate effectors of hcfc1a. Of those candidates, the asxl1 gene was afforded high priority because of its known role regulating cellular proliferation (24,44,53) and for its documented function in mouse embryonic stem cells and neural differentiation (23). Interestingly, the hcfc1a^co60/+allele causes a 14-fold induction of asxl1 expression. In mouse embryonic fibroblasts, the deletion of Asxl1 causes cellular senescence. We observed increased cellular proliferation and therefore, postulated that an increased level of Asxl1 protein was promoting NPC proliferation in hcfc1a mutant larvae. Consistent with the known function of asxl1 and our hypothesis, knockdown of asxl1 in hcfc1a mutant larvae restored the defects in cellular proliferation, resulting in normal numbers of Sox2+ cells.

Interestingly, ASXL1 has been shown to regulate cell proliferation in other cell types (53,54) and this activity has been associated with activation of AKT . Based upon these data, we attempted to restore the phenotypes present in the hcfc1a^co60/+ allele by inhibiting ASXL1 activity downstream of PI3K (24). Consistent with this role, the inhibition of ASXL1 activity using pharmacological inhibition completely restored the NPC deficits present in hcfc1a mutants. Thus, our data suggest a mechanism whereby hcfc1a regulates the expression of Asxl1, and the cell cycle during early brain development. However, whether hcfc1a regulates asxl1 by directly binding to the asxl1 promoter is still not known, but interestingly ASXL1 and HCFC1 interact with one another in myeloid cells to regulate proliferation and differentiation (55). Thus, these two proteins may regulate the activity of one another at multiple levels.

Our study focuses on the function of hcfc1a, one ortholog of HCFC1, during brain development. Specifically, we focus on the function of hcfc1a in modulating NPC number and proliferation. We demonstrate that HCFC1 is essential for the proliferation and differentiation of NPCs. Importantly, we connect these cellular deficits to a molecular mechanism whereby hcfc1a indirectly regulates asxl1 to control cellular proliferation. Thus, we propose that our system has the potential to inform about the transcriptional program regulating NPC function.

Ethics Approval

All experiments were performed according to protocol 811689-5 approved by The University of Texas El Paso Institutional Animal Care and Use Committee (IACUC).

Consent to Participate

Not applicable

Availability of Data

The RNA-sequencing data sets generated during this study have been deposited into the GEO database with accession number GSE132864 and a summary is included within the article. All files are also available from the corresponding author upon request.

Competing Interests

Authors report no competing financial interests.

Funding

These studies were supported by grants from the National Institutes of Health (National Institute on Minority Health and Health Disparities-2G12MD007592 to The University of Texas El Paso, National Institutes of General Medical Sciences RL5GM118969, TL4GM118971, R25GM069621-11, UL1GM118970 to The University of Texas El Paso, and National Institute of Neurological Disorders and Stroke 1K01NS099153-01A1 to Anita M. Quintana.

Author Contributions

AMQ synthesized the hypothesis, wrote the manuscript, analyzed data, performed statistical analysis, genotyped, performed QPCR maintained zebrafish lines. VLC cryosectioned, imaged, counted cells, performed immunohistochemistry, performed injections, drug treatments, RNA analysis and QPCR, and aided in the study design. JFR performed cryosectioning, immunohistochemistry, genotyping, and cell counts. AMQ produced the germline mutant and transgenic heat shock animal. NRN performed cell counts, imaging, and genotyping. DP performed genotyping.

Acknowledgements

Authors thank and acknowledge the help and support of Valerie Caro, Jose Hernandez, and Tamim Shaikh, and Bruce Appel.

Trazzi S, Mitrugno VM, Valli E, Fuchs C, Rizzi S, Guidi S, et al. APP-dependent up-regulation of Ptch1 underlies proliferation impairment of neural precursors in Down syndrome. Hum Mol Genet. 2011 Apr 15;20(8):1560–73.
Wang J, Weaver ICG, Gauthier-Fisher A, Wang H, He L, Yeomans J, et al. CBP histone acetyltransferase activity regulates embryonic neural differentiation in the normal and Rubinstein-Taybi syndrome brain. Dev Cell. 2010 Jan 19;18(1):114–25.
Dugani CB, Paquin A, Kaplan DR, Miller FD. Coffin-Lowry syndrome: a role for RSK2 in mammalian neurogenesis. Dev Biol. 2010 Nov 15;347(2):348–59.
Paronett EM, Meechan DW, Karpinski BA, LaMantia A-S, Maynard TM. Ranbp1, Deleted in DiGeorge/22q11.2 Deletion Syndrome, is a Microcephaly Gene That Selectively Disrupts Layer 2/3 Cortical Projection Neuron Generation. Cereb Cortex. 2015 Oct;25(10):3977–93.
Roy A, Skibo J, Kalume F, Ni J, Rankin S, Lu Y, et al. Mouse models of human PIK3CA-related brain overgrowth have acutely treatable epilepsy. Elife. 2015;4.
Sugathan A, Biagioli M, Golzio C, Erdin S, Blumenthal I, Manavalan P, et al. CHD8 regulates neurodevelopmental pathways associated with autism spectrum disorder in neural progenitors. Proc Natl Acad Sci USA. 2014 Oct 21;111(42):E4468-4477.
Paquin A, Hordo C, Kaplan DR, Miller FD. Costello syndrome H-Ras alleles regulate cortical development. Dev Biol. 2009 Jun 15;330(2):440–51.
Cimadamore F, Amador-Arjona A, Chen C, Huang C-T, Terskikh AV. SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors. Proc Natl Acad Sci USA. 2013 Aug 6;110(32):E3017-3026.
Pevny LH, Sockanathan S, Placzek M, Lovell-Badge R. A role for SOX1 in neural determination. Development. 1998 May;125(10):1967–78.
Mignone JL, Kukekov V, Chiang A-S, Steindler D, Enikolopov G. Neural stem and progenitor cells in nestin-GFP transgenic mice. J Comp Neurol. 2004 Feb 9;469(3):311–24.
Curto GG, Gard C, Ribes V. Structures and properties of PAX linked regulatory networks architecting and pacing the emergence of neuronal diversity. Semin Cell Dev Biol. 2015 Aug;44:75–86.
Dejosez M, Levine SS, Frampton GM, Whyte WA, Stratton SA, Barton MC, et al. Ronin/Hcf-1 binds to a hyperconserved enhancer element and regulates genes involved in the growth of embryonic stem cells. Genes Dev. 2010 Jul 15;24(14):1479–84.
Dejosez M, Krumenacker JS, Zitur LJ, Passeri M, Chu L-F, Songyang Z, et al. Ronin is essential for embryogenesis and the pluripotency of mouse embryonic stem cells. Cell. 2008 Jun 27;133(7):1162–74.
Jolly LA, Nguyen LS, Domingo D, Sun Y, Barry S, Hancarova M, et al. HCFC1 loss-of-function mutations disrupt neuronal and neural progenitor cells of the developing brain. Hum Mol Genet. 2015 Jun 15;24(12):3335–47.
Huang L, Jolly LA, Willis-Owen S, Gardner A, Kumar R, Douglas E, et al. A Noncoding, Regulatory Mutation Implicates HCFC1 in Nonsyndromic Intellectual Disability. Am J Hum Genet. 2012 Oct 5;91(4):694–702.
Quintana AM, Yu H-C, Brebner A, Pupavac M, Geiger EA, Watson A, et al. Mutations in THAP11 cause an inborn error of cobalamin metabolism and developmental abnormalities. Human Molecular Genetics. 2017 Aug;26(15):2838–2849.
Minocha S, Herr W. Cortical and Commissural Defects Upon HCF‐1 Loss in Nkx2.1‐Derived Embryonic Neurons and Glia [Internet]. Developmental Neurobiology. 2019 [cited 2019 Jul 19]. Available from: https://onlinelibrary.wiley.com/doi/abs/10.1002/dneu.22704
Michaud J, Praz V, Faresse NJ, Jnbaptiste CK, Tyagi S, Schütz F, et al. HCFC1 is a common component of active human CpG-island promoters and coincides with ZNF143, THAP11, YY1, and GABP transcription factor occupancy. Genome Res. 2013 Apr 25;
Yu H-C, Sloan JL, Scharer G, Brebner A, Quintana AM, Achilly NP, et al. An X-Linked Cobalamin Disorder Caused by Mutations in Transcriptional Coregulator HCFC1. Am J Hum Genet. 2013 Sep 5;93(3):506–14.
Quintana AM, Geiger EA, Achilly N, Rosenblatt DS, Maclean KN, Stabler SP, et al. Hcfc1b, a zebrafish ortholog of HCFC1, regulates craniofacial development by modulating mmachc expression. Dev Biol. 2014 Dec 1;396(1):94–106.
Minocha S, Sung T-L, Villeneuve D, Lammers F, Herr W. Compensatory embryonic response to allele-specific inactivation of the murine X-linked gene Hcfc1. Dev Biol. 2016 Apr 1;412(1):1–17.
Minocha S, Bessonnard S, Sung T-L, Moret C, Constam DB, Herr W. Epiblast-specific loss of HCF-1 leads to failure in anterior-posterior axis specification. Dev Biol. 2016 Oct 1;418(1):75–88.
An S, Park U-H, Moon S, Kang M, Youn H, Hwang J-T, et al. Asxl1 ablation in mouse embryonic stem cells impairs neural differentiation without affecting self-renewal. Biochem Biophys Res Commun. 2019 Jan 15;508(3):907–13.
Youn HS, Kim T-Y, Park U-H, Moon S-T, An S-J, Lee Y-K, et al. Asxl1 deficiency in embryonic fibroblasts leads to cellular senescence via impairment of the AKT-E2F pathway and Ezh2 inactivation. Sci Rep. 2017 Jul 12;7(1):5198.
Ablain J, Durand EM, Yang S, Zhou Y, Zon LI. A CRISPR/Cas9 vector system for tissue-specific gene disruption in zebrafish. Dev Cell. 2015 Mar 23;32(6):756–64.
Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, et al. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Mar;31(3):227–9.
Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, et al. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Mar;31(3):227–9.
Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, et al. The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev Dyn. 2007 Nov;236(11):3088–99.
Atlas of Zebrafish Development [Internet]. Elsevier; 2012 [cited 2019 Nov 25]. Available from: https://linkinghub.elsevier.com/retrieve/pii/C20090016171
Atlas of Early Zebrafish Brain Development [Internet]. Elsevier; 2016 [cited 2019 Nov 25]. Available from: https://linkinghub.elsevier.com/retrieve/pii/C20130006391
Thisse C, Thisse B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat Protoc. 2008;3(1):59–69.
Thisse C, Thisse B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat Protocols. 2008 Jan;3(1):59–69.
Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014 Aug 1;30(15):2114–20.
Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013 Apr 25;14(4):R36.
Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 2012 Mar 1;7(3):562–78.
Bergsland M, Ramsköld D, Zaouter C, Klum S, Sandberg R, Muhr J. Sequentially acting Sox transcription factors in neural lineage development. Genes Dev. 2011 Dec 1;25(23):2453–64.
Ellis P, Fagan BM, Magness ST, Hutton S, Taranova O, Hayashi S, et al. SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult. Dev Neurosci. 2004 Aug;26(2–4):148–65.
Hutton SR, Pevny LH. SOX2 expression levels distinguish between neural progenitor populations of the developing dorsal telencephalon. Developmental Biology. 2011 Apr 1;352(1):40–7.
Shen M-C, Ozacar AT, Osgood M, Boeras C, Pink J, Thomas J, et al. Heat-shock–mediated conditional regulation of hedgehog/gli signaling in zebrafish. Developmental Dynamics. 2013;242(5):539–49.
Pinto D, Delaby E, Merico D, Barbosa M, Merikangas A, Klei L, et al. Convergence of genes and cellular pathways dysregulated in autism spectrum disorders. American Journal of Human Genetics. 2014 May;94(5):677–694.
Gou Y, Guo J, Maulding K, Riley BB. sox2 and sox3 cooperate to regulate otic/epibranchial placode induction in zebrafish. Dev Biol. 2018 Mar 1;435(1):84–95.
Pan X, Sittaramane V, Gurung S, Chandrasekhar A. Structural and Temporal Requirements of Wnt/PCP Protein Vangl2 Function for Convergence and Extension Movements and Facial Branchiomotor Neuron Migration in Zebrafish. Mech Dev. 2014 Feb;131:1–14.
Wong T-T, Collodi P. Inducible Sterilization of Zebrafish by Disruption of Primordial Germ Cell Migration. PLoS One [Internet]. 2013 Jun 27 [cited 2019 Nov 25];8(6). Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3694954/
Uni M, Kurokawa M. Role of ASXL1 mutation in impaired hematopoiesis and cellular senescence. Oncotarget. 2018 Dec 7;9(96):36828–9.
Hoischen A, van Bon BWM, Rodríguez-Santiago B, Gilissen C, Vissers LELM, de Vries P, et al. De novo nonsense mutations in ASXL1 cause Bohring-Opitz syndrome. Nat Genet. 2011 Aug;43(8):729–31.
Stainier DYR, Raz E, Lawson ND, Ekker SC, Burdine RD, Eisen JS, et al. Guidelines for morpholino use in zebrafish. PLOS Genetics. 2017 Oct 19;13(10):e1007000.
Vinckevicius A, Parker JB, Chakravarti D. Genomic Determinants of THAP11/ZNF143/HCFC1 Complex Recruitment to Chromatin. Mol Cell Biol. 2015 Dec;35(24):4135–46.
Pupavac M, Watkins D, Petrella F, Fahiminiya S, Janer A, Cheung W, et al. Inborn Error of Cobalamin Metabolism Associated with the Intracellular Accumulation of Transcobalamin-Bound Cobalamin and Mutations in ZNF143, Which Codes for a Transcriptional Activator. Hum Mutat. 2016 Sep;37(9):976–82.
Mangone M, Myers MP, Herr W. Role of the HCF-1 basic region in sustaining cell proliferation. PLoS ONE. 2010;5(2):e9020.
Goto H, Motomura S, Wilson AC, Freiman RN, Nakabeppu Y, Fukushima K, et al. A single-point mutation in HCF causes temperature-sensitive cell-cycle arrest and disrupts VP16 function. Genes Dev. 1997 Mar 15;11(6):726–37.
Julien E, Herr W. Proteolytic processing is necessary to separate and ensure proper cell growth and cytokinesis functions of HCF-1. EMBO J. 2003 May 15;22(10):2360–9.
Carrillo-Carrasco N, Chandler RJ, Venditti CP. Combined methylmalonic acidemia and homocystinuria, cblC type. I. Clinical presentations, diagnosis and management. J Inherit Metab Dis. 2012 Jan;35(1):91–102.
Zhang P, Chen Z, Li R, Guo Y, Shi H, Bai J, et al. Loss of ASXL1 in the bone marrow niche dysregulates hematopoietic stem and progenitor cell fates. Cell Discov. 2018;4:4.
Yang H, Kurtenbach S, Guo Y, Lohse I, Durante MA, Li J, et al. Gain of function of ASXL1 truncating protein in the pathogenesis of myeloid malignancies. Blood. 2018 18;131(3):328–41.
Inoue D, Fujino T, Sheridan P, Zhang Y-Z, Nagase R, Horikawa S, et al. A novel ASXL1-OGT axis plays roles in H3K4 methylation and tumor suppression in myeloid malignancies. Leukemia. 2018;32(6):1327–37.

Table 1: RNA-Sequencing reveals 36 upregulated and downregulated genes.

Gene Name	Gene ID	Fold Change
si:dkey-222f8.6	XLOC_021011	14.4930988
asxl1	XLOC_016905	3.85582801
ccl44	XLOC_003025	3.76589623
zgc:112970	XLOC_030718	3.45845584
si:dkey-15j16.6	XLOC_014036	2.66543586
mucms1	XLOC_001109	2.59007221
CR388052.1	XLOC_023401	2.44522307
si:dkey-15j16.3	XLOC_014035	2.39033346
CABZ01017723.1	XLOC_031170	2.23752184
cart3	XLOC_028234	2.10261498
SLC22A3	XLOC_009181	1.97809228
camk1gb	XLOC_017012	1.91222151
vtg1,vtg4,vtg5,vtg6,vtg7	XLOC_016435	1.91072755
si:dkey-208m12.2	XLOC_016485	1.88711718
usp48	XLOC_003342	1.88552791
si:dkey-85k7.7	XLOC_027050	1.86192429
znf319	XLOC_018986	1.75290426
si:dkey-14o1.18	XLOC_029699	1.73919114
cry-dash	XLOC_018109	1.68379868
si:ch73-60p2.1	XLOC_016151	1.67438066
hbbe3	XLOC_004139	1.64033724
c3b.1,c3b.2	XLOC_016458	1.53598227
hcfc1a	XLOC_003246	0.68365388
fut9d	XLOC_028523	0.6648173
si:ch211-183d21.1	XLOC_017905	0.58211004
exosc3	XLOC_031084	0.55764572
si:dkey-147f3.4	XLOC_016723	0.55397064
cox6b1	XLOC_018338	0.54151104
BX530067.1	XLOC_011301	0.53422498
si:dkey-57c15.9	XLOC_016192	0.50905352
si:dkey-9l20.3	XLOC_016618	0.47144985
slc23a3	XLOC_030187	0.34691461
wu:fi09b08	XLOC_031057	0.34631257
hsp70l	XLOC_028453	0.27760694
si:dkey-51a16.10	XLOC_004659	0

Illumina Sequencing was performed on triplicates of whole brain homogenates from 2dpf hcfc1a+/^co60 allele zebrafish larvae (N=12). Analysis revealed 23 upregulated (Green cells) and 14 downregulated (Red Cells) genes with statistical significance of 2.5 x 10 ^-5 or greater.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Hcfc1a regulates neural precursor proliferation and asxl1 expression in the developing brain

Status:

Version 1

Abstract

Figures

Background

Material and Methods

Results

Discussion

Conclusions

Declarations

References

Table

Status:

Version 1