Materials
E. coli XL-10 Gold (Agilent, Santa Clara, CA, USA) and SHuffle T7 Express lysY (New England Biolabs Japan, Tokyo, Japan) were used for general cloning and protein expression, respectively. EBY100 (ATCC, Manassas, VA, USA) was used for yeast cell surface display. Plasmid pYD1-mSA encoding N-terminal Aga2 protein and monomeric streptavidin was kindly given by Sheldon Park (Addgene #39865). The In-Fusion HD cloning kit, minimal SD base, -Trp/-Ura DO supplement, and TALON metal affinity resin were obtained from Takara-Bio (Shiga, Japan). Restriction enzymes were purchased from New England Biolabs (Tokyo, Japan). KOD-plus-neo and Ligation High Ver. 2 were from Toyobo (Osaka, Japan). The PureYield plasmid miniprep, Wizard SV Gel and PCR clean-up kits were purchased from Promega (Madison, WI, USA). The Frozen-Ez Yeast Transformation II kit was purchased from Zymo Research (Irvine, CA, USA), while the yeast nitrogen without amino acids and FITC-5-maleimide was obtained from Thermo Fisher Scientific. Anti-FLAG M2 magnetic beads, 3 × DYKDDDDK peptide, Biotin-PEG2-amine, and HSA were obtained from Sigma-Aldrich (St. Louis, MO, USA). 5-TAMRA-C6-mal cells were obtained from Setareh Biotech LLC (Eugene, OR, USA). MTX and zymolyase 100T were obtained from Nacalai Tesque (Kyoto, Japan). PE anti-DYKDDDDK IgG and streptavidin-PE were purchased from Miltenyi Biotec. Unless otherwise indicated, all other chemicals and reagents were obtained from Sigma-Aldrich, Dojindo (Kumamoto, Japan), or Fujifilm-Wako Pure Chemicals (Osaka, Japan). The water used was purified using a Milli-Q water purification system (Merck Millipore, Burlington, MA, USA).
The following oligonucleotides (5ʹ- 3ʹ) were synthesized by Eurofins Genomics (Tokyo, Japan):
pYD1_back: AGTAACGTTTGTCAGTAATTGC
pYD1_for: GTCGATTTTGTTACATCTACAC
NheI_back: TCAGCTAGCATGGCTGAAATCGCTGC
BamHI_for: GTGGTGGTGGTGGTGGTGCTC
BspEI_back: CGTTCCGGACGCGTTCCTGAAACGC
Infusion_AgeI_back_Z1: GAAGGGAGGCACCGGTGAGGTGCAGCTCGTG
Infusion_AgeI_back_Z4: GAAGGGAGGCACCGGTCAGGTGCAGCTCGTG
Infusion_AgeI_back_Z9: GAAGGGAGGCACCGGTCAGTTGCAGCTCGTG
Infusion_AgeI_back_Z30: GAAGGGAGGCACCGGTGAGTTGCAGCTCGTG
Infusion_BamHI_for_Z: CCTTGTAGTCGGATCCTGCGGCCGCAGAGG
Inf_XhoI_Z_for: GGTGGTGGTGCTCGAGTGCGGCCGCAGAGGC
The following peptides were synthesized at LifeTein (Hillsborough, NJ, USA):
K4-C: NH2-KIAALKEKIAALKEKIAALKEKIAALKEC-COOH (M.W. 3137)
FITC-K4-C: FITC-NH-KIAALKEKIAALKEKIAALKEKIAALKEC-COOH (M.W. 3639)
Construction of yeast display plasmids
pYD1-E4 and pYD1-E4-MTXVHH were constructed to prove the concept of the yeast-displayed Q-body. Initially, two DNA fragments encoding the E4 peptide and the other encoding MTX-VHH with N-terminal E4 peptide were amplified from pE4-MTXVHH as a template using primers NheI_for and BamHI_back, or NheI_for and T7 terminator, respectively. After the DNA fragments were digested using NheI and BamHI, both were cloned into the NheI- and BamHI-digested vector of pYD1-mSA using Ligation High ver. 2.
Twenty-eight pYD1-HSAVHH clones encoding different VHH sequences were constructed using two methods. Five plasmids encoding Z02, Z06, Z08, Z18, and Z19 were constructed using In-Fusion cloning, and the other 23 plasmids were constructed simultaneously using homologous recombination in the yeast cell. Initially, pYD1-E4-BGPscFv, in which the restriction site of AgeI on the GAL1 promoter was removed using BspEI_back, was constructed. Then, 28 HSAVHH genes were amplified using Infusion_AgeI_back_Zn (n = 1, 4, 9, 30) and Infusion_BamHI_for, respectively. The DNA fragments encoding Z02, Z06, Z08, Z18, and Z19 were cloned into AgeI- and BamHI-digested pYD1-E4-BGPscFv by In-Fusion cloning, and the DNA fragments encoding the other 23 HSA VHH genes were mixed with AgeI- and BamHI-digested pYD1-BGPscFv at a molar ratio of 5:1, followed by homologous recombination in the cell.
Nanobody display on the yeast cell surface
The constructed plasmid or vector/insert mixture was transformed into EBY100 using the Frozen-Ez Yeast Transformation II kit and cultured at 30 °C for 2-3 days in a culture plate containing minimal synthetic defined base (including a yeast nitrogen base, ammonium sulfate, glucose), -Trp/-Ura DO supplement [SD (-W/-U)], and 2% agar. A single colony was picked and grown at 30 °C in 3 mL of SD (-W/-U) medium overnight, and ~1 mL of this culture was used to inoculate 20 mL of SD (-W/-U) medium at 0.2-0.3 OD600, followed by culturing at 30 °C. After the OD600 reached 0.4-0.6, the medium was exchanged with SG (-W/-U) medium, in which a glucose of SD (-W/-U) medium was replaced with a galactose, and the cells were incubated for an additional 18-24 h at 20 °C to display the proteins encoded on the plasmid.
Preparation of K4-probe
One of the coiled-coil forming peptides, K4, was labeled with TAMRA via a maleimide-thiol reaction, as previously described 24. Briefly, K4 peptide with C-terminal cysteine (10 nmol) and 5-TAMRA C6 maleimide (11 nmol) were dissolved in 50 µL of Milli-Q water and vigorously mixed for 2 h at 25 °C. The labeled peptide (FITC-K4-TAMRA) was purified using RP-HPLC (Chromaster, Hitachi High-tech, Tokyo, Japan) and identified by MALDI-TOF-MS (UltrafleXtreme, Bruker, Billerica, MA, USA).
Preparation of yeast-displayed Q-body
After inducing the display, the yeast cells (~0.5 × 106 cells) were collected by centrifugation at 14,000 × g for 1 min at 4 °C, and the pellet was washed with 1 mL phosphate-buffered saline (PBS) containing 5% immunoblock (DS Pharma Biomedical, Osaka, Japan) (PBS-B). After the pellet was resuspended in 100 µL PBS-B, FITC-K4-TAMRA was added at a final concentration of 100 nM, followed by incubation for 15 min at 4 °C, followed by two washings with 1 mL PBS-B.
Microscopic observation
After the yeast displayed Q-body was resuspended in 50 µL PBS-B, microscopy was performed with an IX 71 inverted microscope (Olympus, Tokyo, Japan). Samples were observed under a 60x objective lens. Fluorescein was excited at 460–480 nm and emission at 495-540 nm was observed. TAMRA was excited at 545–580 nm and emission at >610 nm was observed.
Analysis and selection of yeast-displayed Q-body by FACS
After the yeast-displayed Q-body was resuspended in 500 µL of PBS-B, flow cytometric analysis was performed using an SH-800 cell sorter (Sony, Tokyo, Japan). Three thousand events were measured in each analysis. A blue laser (488 nm) and two detection filters (525/50 and 585/30) were used to measure the fluorescence intensities of FITC and TAMRA, respectively. The obtained data were analyzed using the control software, and the means of FITC and TAMRA were calculated to check the quenching in the absence of the antigen, and the fluorescence response in the presence of the antigen. About 5000 cells in the gate that showed quenching or de-quenching were sorted and used for the next round of analysis.
The yeast cells selected by FACS were cultured in 2 mL SD (-W, -U) medium for 2 days, and the nanobody display and selection procedure were continued. Finally, 1-day culture medium was subsequently cultivated on SD (-W, -U) agar plates for 2 days. A single colony was picked, and a nanobody display was performed.
Subcloning of selected nanobody and expression in E. coli
pSQ-Z20 and Z33 were constructed to express Z20 and Z33, respectively, in E. coli. Initially, two fragments, one encoding Z20 and the other encoding Z33, were amplified from pYD1-Z20 and pYD1-Z33 in zymolyase-treated yeast cells as a template using pYD1-back and Inf_XhoI_for, respectively. The DNA fragments were cloned into the AgeI- and XhoI-digested vectors of pSQ-MTXVHH using Ligation High ver.2. The constructed plasmid was transformed into SHuffle T7 Express lysY cells, and the nanobodies were expressed and purified as previously described 11.
Q-body preparation and dose-dependency measurement
The purified Z20 and Z33 were labeled with maleimide dye as previously described 11, and the fluorescence intensity was measured using a fluorescence plate reader (Clariostar, BMG Labtech). Initially, each mini Q-body was diluted to 5 nM in PBS supplemented with 0.05% Tween 20 (PBST) or 7 M guanidium hydrochloride (GdmHCl) containing 100 mM dithiothreitol (DTT) in PBST to denature the protein and measure the degree of quenching. In addition, HSA was added to the solution at nine concentrations (0.1, 0.3, 1, 3, 10, 30, 100, 300, and 1000 nM) to confirm the dose-dependency. Each solution (80 μL) was applied to a 96-well black microplate and fluorescence was measured at 535 nm excitation and 585 nm emission wavelengths. Dose-response curves were drawn by fitting the intensities at the maximum emission wavelength using the curve fitting function of MATLAB (Mathworks, Natick, MA). The EC50 value was calculated from the curve fitting to a modified 4-parameter logistic (4PL) equation, as previously described 11.
In addition, 5-TAMRA C6 labeled Z33 was dimerized using anti-FLAG IgG or captured on anti-FLAG magnetic beads. For these tests, 5-TAMRA C6 labeled Z33 was purified using a His spin trap column instead of anti-FLAG M2 magnetic beads. The purified Z33 was reacted with anti-FLAG M2 IgG at a ratio of 2:1 at 25 °C for 30 min to be dimerized via an anti-FLAG M2 IgG molecule. To mimic the yeast surface display, 5-TAMRA C6 labeled Z33 was kept on anti-FLAG M2 magnetic beads without elution during the purification steps, in which the 5-TAMRA C6 labeled Z33 was captured on the bead surface via anti-FLAG M2 IgGs. The dose-dependencies for the both samples were confirmed according to the aforementioned procedure.
Fluorescence analysis of yeast-displayed mini Q-body
The dose-response of the yeast-displayed mini Q-body was measured using either a fluorescence spectrophotometer Model FP-8500 (Jasco, Tokyo, Japan) or a fluorescence microplate reader Clariostar (BMG Labtech Japan, Saitama, Japan). After the yeast-displayed mini Q-body was assembled as described previously, it was diluted to 0.3 OD600, and the antigen (MTX or HSA) was added to the solution at eight concentrations (1, 3, 10, 30, 100, 300, 1000, and 3000 nM). For fluorescence spectral measurements, each solution (250 μL) was added in a 5 mm × 5 mm quartz cell (Starna Scientific, Hainault, UK), and the fluorescence spectrum was measured at 485 nm excitation and 510-650 nm emission wavelengths. The measurement temperature, excitation/emission bandwidths, and scanning speed were set to 25°C, 5 nm, 200 nm/min, respectively. For fluorescence ratiometric measurement, each solution (80 μL) was applied to a 96-well black microplate and fluorescence was measured at 483 nm excitation and 535 nm or 585 nm emission wavelengths. Dose-response curves were drawn by fitting the fluorescence intensity of each concentration at 585 nm normalized to that at 535 nm (R/G ratio) using a curve fitting function as described.
The shaving of the yeast-displayed mini Q-body was performed using a mild reduction treatment. Initially, the yeast-displayed Z33 (~0.5 × 107 cells) was reduced using tris(2-carboxyethyl) phosphine hydrochloride (TCEP-HCl) at 2.5 mM in 100 µL PBST at 30 °C for 20 min. The unreacted TCEP was oxidized by 10 mM 4-azidobenzoic acid (ABA) 31, and the reduced mini Q-body was collected by centrifugation. The pellet (yeast cell) was labeled with PE-conjugated anti-FLAG IgG to confirm the degree of shaving. The antigen-binding activity of the supernatant (reduced Z33) was confirmed by ELISA. Briefly, HSA was immobilized in the wells of a transparent polystyrene microplate (Costar 3590, Corning-Costar Japan, Tokyo, Japan) at 4 °C overnight, blocked with 20% ImmunoBlock (DS Pharma Biomedical, Osaka, Japan) in PBS at 25 °C for 2 h, and washed three times with PBST. The twice-diluted supernatant in 80 μL of PBST containing 5% ImmunoBlock was applied and incubated for 1 h at 25 °C, followed by three washes with PBST. The bound nanobodies were probed with 100 μL of 1/10000 diluted horseradish peroxidase-conjugated anti-FLAG antibody in PBST containing 5% ImmunoBlock for 30 min at 25 °C. After washing three times with PBST, 100 μL of substrate solution (200 μg/mL 3,3ʹ,5,5ʹ-tetramethylbenzidine and 0.3 μL/mL (v/v) hydrogen peroxide in 100 mM sodium acetate, pH 6.0) was applied to the well. After incubation for 2-3 min, the reaction was stopped with 50 μL per well of 1 M sulfuric acid, and the absorbance was determined at 450 nm with a reference at 655 nm using a microplate reader (SH-1000Lab, Corona Electric, Ibaraki, Japan). The yeast-displayed E4-peptide and Z33 (~0.5 × 107 cells) labeled with FITC-K4-TAMRA were shaved using the aforementioned procedure, and fluorescence intensity in the presence or absence of 10 µM HSA was confirmed using a fluorescence plate reader in the same manner as with the 5-TAMRA C6 labeled mini Q-body.