Cell resuscitation and Incubation
The frozen epithelioma papulosum cyprini (EPC) cells were stored in liquid nitrogen cell storage container at the College of Veterinary Medicine. The cryopreserved tubes were immersed into a 37 ℃ sterile water bath immediately, and shaken tubes to accelerating melting rate in succession. The melted liquid was transferred into medium mixture which containing 10% fetal bovine serum (Biological Industries, Beit HaEmek, Israel) and 1% double antibody (Sigma-Aldrich, St. MO, USA) of M199 cell culture medium. Transferred cell culture medium into the 25 cm2 culture flasks which placed into automatic incubator at 27 ℃.
Cytoxicity Test
In the present study, the cytotoxicity of CPF was determined by using the Cell Counting Kit-8 assay (CCK-8 MedChemExpress, Monmouth Junction, NJ, USA). CPF (purity 99%) was purchased from Aladdin (C109843, China) and prepared in dimethyl sulfoxide (DMSO) (purity 99%). DMSO were applied to dissolve the CPF, and culture medium was added to estimate target CPF concentration. The final concentration of DMSO in the culture media was maintained below 0.05 % in all experiments. The cells were transfered into 96-well plates (NEST, Wu Xi, China) by using trypsin digestion solution (0.25%), and treated respectively with the different concentrations of CPF (0, 0.5, 1, 3, 5, 7 or 9 µM). After 24 h incubation, and CCK-8 assay were processed to detect cell viability. The culture medium was substitued with 10% CCK-8 working solution into each well. After incubation for 1 h, Cytation™ 5 cell Imaging Multi-Mode Reader (Biotek Instrument, Vermont, USA) was operated to measure the absorption (450 nm). In accordance with the cell viability determinations, three concertation of CPF as 3, 5 and 7 µM were applied into consequent cells incubation.
Determination of Antioxidant Parameters
In present study, commercial kits were used in the present study to detect whether CPF treatment can cause oxidative stress in EPC. Total antioxidative capacity (T-AOC, product No.A015-1-2), catalase (CAT, product No.A007-1-1), total superoxide dismutase (SOD, product No.A001-3) and malondialdehyde (MDA, product No.A003-1-1) were detected with assay kits (Nanjing Jianchang Bioengineering Research Institute, Nanjing, China) and all experimental operations were in accordance with instructions of kits.
AO/EB Staining
The cells of all groups were collected and resuspended with PBS. Base on the operation protocol, the AO/EB staining work solution (meilunbio, Dalian, China) were loaded to ultimate concertation as 10 µL/mL for 5 min. The live, apoptotic and necroptotic cells were photographed by fluorescence microscope (Thermo Fisher Scientific, USA). The cells were analyzed by using Image J software (National Institutes of Health).
Flow Cytometry Analysis
Each group cells were gathered respectively and twice rinsed with PBS, and suspended in PBS. The Annexin V-FITC/PI apoptosis kit (product No.KGA106, keygen BioTECH, China) was applied to cell death quantification. Base on the operation protocols, EPC cells were staining with the working solution which containing 5 µL of Annexin V-FITC, 5 µL of PI and 490 µL of binding bufferc. The live, apoptotic and necrotic cells were quantified by flow cytometry (BD FACSAria™ II, BD Biosciences, USA). In addition, flow cytometry was applied to determine the effects of CPF on MMP in EPC cells. JC-1 assay kit (product No.C2006, Shanghai Beyotime Biotechnology, Shanghai, China) was performed base on the manufacturer’s instructions, and flow cytometry were subsequently used to assy the cells in all group which were loaded with JC-1 prob.
Ca2+ Imaging
The Ca2+ level was detected with three different Ca2+-fluorescent probe, Fluo-4 acetoxymethylester (AM) (product No. F14201, 5 µM, Invitrogen, Thermo Fisher Scientific, USA) were applied to determine the cytoplasmic Ca2+ level, Rhod-2 AM (product No.R1244, 10 µM, Invitrogen, Thermo Fisher Scientific, USA) were used for determine the mitochondria Ca2+ level, and Mag-Fluo-4 AM (product No.M14206, 5 µM, Invitrogen, Thermo Fisher Scientific, USA) were demanded for the ER Ca2+ level. The cell of each groups was loaded respective Ca2+ probes for 30–60 min at 27 ℃, then the mitochondria and ER were labeled with Mito-Tracker Green FM (product No.M7514, 5 µM, Invitrogen, Thermo Fisher Scientific, USA) and ER-Tracker Red (product No.C1041, 1 µM, Shanghai Beyotime Biotechnology, Shanghai, China) respectively. Fluorescence microscope (Thermo Fisher Scientific, USA) were performed to the image acquisition and Image J software (National Institutes of Health) were applied to quantitated fluorescence intensity.
MMP Assay
In order to investigate whether CPF can negatively affect mitochondrion, we measured MMP with JC-1 assay kit (product No.C2006, Shanghai Beyotime Biotechnology, Shanghai, China). Base on the instructions, cells were incubated at 27 ℃ for 20 min after loaded with JC-1 solution (10µg/mL), then washed twice with JC-1 buffer solution. The fluorescence microscope (Thermo Fisher Scientific, USA) was applied to detecting the monomeric JC-1 green emission and aggregative JC-1 red emission. The MMP assessed as the fluorescence scale of red emission normalizing to green emission was quantified with flow cytometry.
Mitochondria Isolation
The cells of each groups were obtained and respectively used to isolate mitochondria for later experiments. The cells were firstly homogenized, and then were centrifugated at 4 ºC at 2000 rpm for 10 min. The supernatant was obtained and was put into a new EP tube. The EP tube was centrifugated at 4 ºC at 12000 rpm for 10 min. The mitochondrial of EPC cells were isolated by using cell mitochondria isolation kit (product No.C3601, Shanghai Beyotime Biotechnology, Shanghai, China). The obtained sediment was the isolated mitochondria was used for subsequent experiments.
Detection of Intracellular and Mitochondrial ROS
To observe and determine the effects of CPF on the oxidative stress levels, we detected intracellular ROS level and mitochondrial ROS (mito-ROS) level by using ROS assay kit (product No.E004-1-1, Nanjing Jianchang Bioengineering Research Institute, Nanjing, China). The cells were staining with 2,7-dichlorofuresc in diacetate (DCFH-DA, 10 µM) for 45 min. Fluorescence microscope (Thermo Fisher Scientific, USA) were applied to observe the cells, and ROS levels were quantified by fluorospectrophotometer.
ATP Measurement
The cells were collected and incubated in 6-well plates. And intracellular and mitochondrial ATP levels were measured with ATP assay kit (product No.A095-1-1, Nanjing Jianchang Bioengineering Research Institute, Nanjing, China) base on the manufacturer’s instructions.
RNA Extraction and Quantitative Real-time PCR (qRT-PCR)
Total RNA from EPC cells were extracted respectively with TRlzol reagent (product No.15596-018, Life Technologies, California, USA) base on the manufacturer’s instructions, and were reverse transcript into mRNA respectively with the BioRT Master HiSensi cDNA First Strand Synthesis kit (product No.BSB40M1, Bioer Technology, Hangzhou, China). RT-PCR was used the BioRT Real Time RT-PCR kit (product No.BSB33S1, Bioer Technology, Hangzhou, China) and the QuantStudio 3 (Thermo Fisher Scientific, USA). The primers (Table 1) of mRNA used for qPCR were synthesized by Shanghai Sangon Biotechnology Co. Ltd, (Shanghai, China). β-actin was used as reference. Each PCR product performed only one peak in melting curve. The relative abundances of mRNA were calculated base on the 2−ΔΔCt method.
Table 1
The primer sequences used for qRT-PCR.
Genes | Sequence (5’ − 3’) |
CAPN1 | Forward:AAGGACCGCAGGAAGAAGAGGAG | Reverse:CCCGCTTCAGATGAACACCAGAC |
ATF4 | Forward:GCTCGTGGTCTCCCTCTTCCTC | Reverse:CATCGCCTGCTGTGCTCTGC |
elF2α | Forward:TCCAGGCGACGAATCCGATCC | Reverse:CTTATCCACCCGAATGACCACCAC |
BIP | Forward:GGCATTGAGACTGTTGGAGGAGTG | Reverse:GGTTGTCGGAAGCAGTGGAGAAG |
CHOP | Forward:GATCCGCCCGTTCACCAATCG | Reverse:CACCAACACCACCTTCGCTGAG |
PERK | Forward:AGACGGAGAAGGCTCACAGGTG | Reverse:CGTGGTGGCAGCGATACAGAAG |
DRP1 | Forward:TCCAGCTTCCTCAGATCGTAGTCG | Reverse:AGTCCCGTCCAACCAAACTCTCC |
MFN1 | Forward:TCACCTCTTCCTCTGCTCCCTTG | Reverse:CCACAGAACGCCACACCACTC |
BCL-2 | Forward:ATGCGTGAATAAGGAGATGA | Reverse:AGACCGAAGACCGTTACT |
BAX | Forward:TCCACTCTTCAACCAACTC | Reverse:GCCAATAGTCTGCCATGT |
Cyt-c | Forward:ACAGCCAAGACAGTCGTTACACAG | Reverse:AGACTTGTTGAGCGTGAAGCAGAC |
CASP3 | Forward:GCTGTGCTTCGTTAGTGT | Reverse:GAACCAAGAACCGCTCAT |
CASP9 | Forward:AGGCAACTGGTGACAGACTTAGAGA | Reverse:GACAGAAGGAGGCAGACGAACAC |
CASP8 | Forward:GCTGGTTACAGATGGTGCTGGTC | Reverse:GTCCTGGCCTTGTTCACTTCCTTC |
FADD | Forward:GACGGCATACAGGAGAAGCACAG | Reverse:CAGTCCCGCAGAGCTTTGATGAG |
RIPK1 | Forward:AAGATGCGGGAGGGTCTGATGG | Reverse:CAGGAGGGCGTTGGGTTTGATG |
RIPK3 | Forward:TACAGCGGTGTTCAGTCCAGTC | Reverse:AGCTCATCCAGTCCTTCGGTCTC |
MLKL | Forward:GGAACCGCTGTCACATGACTGTC | Reverse:GTCCACCAACACTCCAGCAGAAG |
β-actin | Froward:GGCTCTCTTCCAGCCTTCCT | Reverse:AGCACGGTGTTGGCATACAG |
Protein Extraction and Western Blot Analysis
The protein of cells was extracted by using PMSF. 100 µL of cell lysis buffer (product No.P0013, Shanghai Beyotime Biotechnology, Shanghai, China) and 1 µL of PMSF (product No.ST506, Beyotime Biotechnology, Shanghai, China) were added per 1 × 106 cells, and swing cell on ice for 30 min. And centrifugated at 4℃ (12000 rpm, 25 min) to obtain supernatants, then added one quarter of SDS, boiling mixture for 10 min and reposit at -20℃. SDS-polyacrylamide gel electrophoresis were applied to detect the total protein. And then the gels were transferred to PVDF membranes at 200 mA in Tris-glycine buffer containing 20 % methanol for 60–110 min. After being blocked with 5% skim milk for 120 min at 37 ℃, the diluted primary antibodies were added on membranes overnight at 4℃, the dilution factor and sources of primary antibody are summarized in Table 2. Then, the membranes were washed and continuously dip in secondary antibodies against rabbit IgG (1:8000, Immunoway Suzhou, China). The protein bands were detected with chemiluminescence system (Applygen Tchnologies, Beijing, China) and X-ray films (TransGern Biotech, Beijing, China). The relative protein abundances were normalized as β-actin, and the band intensity was quantified by using Image J software (National Institutes of Health).
Table 2
Antibodies used for Western blot.
Antibodies | Dilution ratio | KD | Resource |
Caspase 3 | 1: 500 | 30 | Wanleibio, China |
Caspase 9 | 1:500 | 35 | Wanleibio, China |
Caspase 8 | 1:500 | 55 | Wanleibio, China |
RIPK1 | 1:2000 | 76 | ABclonal Biotechnology |
RIPK3 | 1:2000 | 57 | Laboratory made |
MLKL | 1:2000 | 55 | Laboratory made |
FADD | 1:2000 | 26 | ABclonal Biotechnology |
Cyt-c | 1:500 | 19 | Wanleibio, China |
β-actin | 1:1500 | 42 | ABclonal Biotechnology |
Statistical Analysis
The data were analyzed by using GraphPad Prism (version 8.2, Graph Pad Software Inc., San Diego, CA, USA), t Student’s t-test, and one-way or two-way ANOVA with Turkey’s multiple comparison test. The data are present into the mean ± standard deviation, and statistically significant differences at P < 0.05.