Laboratory animals:
Healthy SD rats (Sprague Dawley rat), weighing 250-300g, were provided by the animal experiment center of Medical College of Shanghai Jiaotong University. Factory license No.: scxk (Shanghai) 2011-0001, use license No.: syxk (Shanghai) 2011-0121. This study was supported by the ethics committee of Shanghai Jiaotong University.
Reagents and instruments:
L-dmem medium (hyclone); Super grade fetal bovine serum (FBS, GIBCO); 0.25% trypsin and EDTA (GIBCO); Ficoll (GE) with density of 1.077; Xylene (GIBCO); Antigen repair solution (trisodium citrate buffer) (GIBCO company); 4% paraformaldehyde (GIBCO); 0.01% Triton-X (GIBCO); first antibody α Some antibodies such as TnI (sigma company) are the same as the first part of the experiment; Enzyme labeling detector (thermo MK3 type); Annexin V-FITC / PI Kit (Bebo biology 401006), 75% ethanol (Wuxi prospect 64.17-5), BCA protein quantitative Kit (Kaiji); PH = 6.8 electrophoretic buffer (EBS); 10% SDS (EBS); 10% ammonium persulfate (IBOs); TEMED (ABOS Biology); 4 * protein loading buffer (IBS); Protein pre staining marker (thermo); Pgmlv-ma2 expression vector kit, emgfp and other related reagents were purchased from Qiagen; Triton (Amresco); Primer (R & F) for PCR (Shanghai aibosi Biotechnology Co., Ltd.); Taq polymerase(NEB); Qiagen plasma pumping Kit (Qiagen); LB or SOB or SOC(Alpha aeser); CaCL2(Sigma); T4 DNA ligase(Fermentas); T4 DNA ligase buffer(Fermentas); MgSO4(Sigma); Agarose (bio RAD); DNA ladder; Positive clone sequencing (Invitrogen); BamH I and Xho I (fermentas); PCR instrument (Eppendorf); Pipette (Gilson). Trizol (Invitrogen company of the United States), reverse transcription Kit (promisga company of the United States), Taq enzyme (Takara company of Japan), primer sequence synthesis (Shanghai Shenggong biology company), BCA Kit (biyuntian company), Estherichia coli DH5 (strain (Invitrogen company), Lipofectamine 2000 (Invitrogen company), opti MEM (Invitrogen company), Trizol (Invitrogen company) , prenti6.3/v5-dest (Invitrogen company), restriction endonuclease, T4 DNA ligase, large plasmid DNA Extraction Kit (Qiagen company), vertical electrophoresis apparatus (GE company of the United States), semi dry membrane apparatus (bio rad company of the United States), nitrocellulose membrane (bio rad company of the United States), (GE company of the United States), Kodak in vivo imager, cymentre2000. Relevant surgical instruments (scalpel, hemostatic forceps, etc.) 。
Isolation, induction and culture of bone marrow mesenchymal stem cells (MSCs),Identification of characteristic antigens of bone marrow mesenchymal stem cells (MSCs),DAPI labeled bone marrow mesenchymal stem cells,were seed in the article by wengang yang et al(Mesenchymal stem cells were affected by up-regulation of miRNA-21 in vitro.Int J Clin Exp Pathol 2018;11(1):27-37).
Bioinformatics predicts miR-21 target genes:
Prediction of miR-21 target genes we used mirwalk software to analyze the intersection of all candidate target genes predicted by miR-21 through targetscan, mirdb and Miranda. Then, according to the negative regulatory relationship between miRNA and target genes, the genes negatively related to the expression of miR-21 were screened and expressed in MSCs cells. At the same time, the pathways related to the differentiation of MSCs into cardiac myoid cells were concerned. Finally, the corresponding molecular phenotypes were screened.
Construction of miRNA-21 expression virus vector (mir-21-OE):
MiRNA-21 sponge (mir-21-KD) was obtained:
MiRNA "sponges", also known as miRNA sponges, are one of the very effective tools for miRNA function research. It can continuously induce functional inhibition against cell line miRNA. MiR-21 sponge contains the target miR-21 complementary binding site. According to the miRNA-21 sequence, miRBase access No: mi0000850. The primer sequence of miR-21 sponge is as follows: miR-21 sponge f (xhoi): ccgctcgagctcgtcaacatcagtctg and miR-21 sponge R (BamHI): ccggatccttggtgagcttatcagac. The corresponding restriction enzymes digest xhoi and BamHI. Using vector cloning kit for recombination, oligonucleotides were inserted into LV overexpression vector pcdh-egfp vector (lv-mirna-21 sponge), and E.coli DH5 cells were transformed with plasmid. Subsequently, lv-mirna-21 sponge was transfected into 293T cells, packaged with virus and its titer was determined.
Construction and virus packaging of ajuba overexpression virus vector (ajuba OE):
Ajuba sequence: nm according to access No_ 053503.1. The plasmid template was purchased from Beijing Yiqiao Shenzhou Biotechnology Co., Ltd. through subcloning, the relevant primer sequences are as follows: ajub-f (xhoi): ccgctcgagatggtggttaggggagaaag; And ajub-r (BamHI): CCG ggatcctcagatatagttggtagggggctg. The corresponding restriction enzymes digest xhoi and BamHI. The PCR product was inserted into the overexpression vector pgmlv-ma2 vector (Invitrogen) and transformed with E.coli DH5. The plasmid was extracted by Plasmid Extraction Kit, and the plasmid was named LV ajuba OE. Subsequently, LV ajuba OE was transfected into 293T cells, packaged with virus and its titer was determined.
Construction of ajuba interference virus vector (ajuba KD):
Construction of shRNA lentivirus interference vector we used plko.1-gpf-puro vector through block it ™ RNAi designer tool (https://rnaidesigner.thermofisher.com/rnaiexpress/) Design and synthesize double stranded hairpin DNA primer sequences as follows:
name
|
sequence
|
Ajuba –shRNA-1 S
Ajuba –shRNA-1 AS
|
5’- CCGGGCCAGAGGCCAGAGAAGATTA. CTCGAGTAATCTTCTCTGGCCTCTGGCTTTTTG -3’
5’- AATTCAAAAA GCCAGAGGCCAGAGAAGATTA CTCGAGTAATCTTCTCTGGCCTCTGGC -3’
|
Ajuba –shRNA-2 S
Ajuba –shRNA-2 AS
|
5’-CCGGGCACCTGTATCAAGTGCAACACTCGAGTGTTGCACTTGATACAGGTGCTTTTTG -3’
5’- AATTCAAAAA GCACCTGTATCAAGTGCAACA CTCGAG TGTTGCACTTGATACAGGTGC-3’
|
Ajuba –shRNA-3 S
Ajuba –shRNA-3 AS
|
5’-CCGGGTGATGAAAGAATTACCGAATCTCGAGATTCGGTAATTCTTTCATCACTTTTT -3’
5’-AATTCAAAAAGTGATGAAAGAATTACCGAATCTCGAGTTCGGTAATTCTTTCATCAC-3’
|
NC-sense
|
5’- CCGGGCCACTTGATTCTAGAGAAGA -3’ -3’CTCGAGTCTTCTCTAGAATCAAGTGGC TTTTTG -3’
|
NC-antisense
|
5’-AATTCAAAAAGCCACTTGATTCTAGAGAAGACTCGAGTCTTCTCTAGAATCAAGTGGC -3’
|
The designed shRNA was synthesized by Shanghai Shenggong Bioengineering Co., Ltd. and connected according to the following system:
reagent
|
volume
|
5×T4 Ligase
Restriction endonuclease carrier DNA
objective DNA
ddH2O
|
2
1
1
1
3
|
Take an appropriate amount of ligation product, add it to the competent cells, transform it with E. coli DH5, extract the plasmid through the Plasmid Extraction Kit, and name the plasmid LV ajuba shRNA. Subsequently, LV ajuba shRNA was transfected into 293T cells, packaged with virus and its titer was determined.
The expression of related proteins was detected by Western blotting:
The experiment was carried out in groups. 300ul tissue cell lysate was added to each tissue cell sample, mixed with a gun to completely lyse it, and the lysate was moved to a new centrifuge tube. Take 10 directly μ L sample adding 10ul 2 × SDS-PAGE loading buffer, mix well, heat at 100 º C for 5 minutes, cool on ice, 12000 g centrifugation for 5 minutes to remove insoluble precipitation. The samples were separated by 10% SDS-PAGE, and the sample amount per well was 20 UL. After electrophoresis, the PVDF membrane was soaked in methanol for 1 minutes, then soaked in Transfer Buffer gel, filter paper and PVDF film soaked in methanol for 4 minutes for 10 minutes, then the transfer sandwich was prepared. Use blocking buffer to seal the transfer film at 4 º C overnight, and 1 the next day × Tbst was washed 3 times for 15 minutes each time. Add diluted primary antibody and incubate for 2 hours at 37 º C. Use 1 × Tbst was washed 4 times for 10 minutes each time. Add diluted secondary antibody and incubate for 2 hours at 37 º C. Use 1 × Tbst was washed 4 times for 10 minutes each time. Chemiluminescence detection was carried out with super GL ECL hypersensitive luminous solution, and the X-ray film was exposed. After developing and fixing, the air dried film was photographed with gel imaging analysis system. The experiment was carried out by Gel-Pro Analyzer software.
Real time PCR was used to detect the expression of related mRNA:
(1) Total RNA extracted by Trizol:
1) Bone marrow mesenchymal stem cells (MSCs) in each group were collected, 500 ml Trizol reagent was added, and immediately blown with 2 ml syringe for 5 times;
2) Then add 100ml chloroform, mix well, stand at 0 ~ 4 ° C for 5 minutes, and then centrifuge at 12000g high speed at 4 ° C for 5 minutes;
3) Carefully move the upper aqueous phase to a new 1.5ml centrifuge tube, add equal volume of isopropanol, shake and mix well. RNA was precipitated at room temperature for 5 minutes and centrifuged at 12000g at 4 ° C for 5 minutes;
4) Carefully discard the supernatant, add 1ml 70% ethanol into the centrifuge tube, shake for a moment, and centrifuge 10000g for 5 minutes;
5) Carefully discard the supernatant and let it stand at room temperature for 5-10 minutes. The RNA precipitation is just dry. Dissolve in water and store at - 70 ° C.
(2) DNaseI processes DNA in RNA:
1) Suck 1mg mRNA, add 1ml DNase I buffer and 1ml DNase I, make up to 10ml with water and mix well. Act at 37 ° C for 30min in in PCR reactor, add 1ml EDTA, act at 65 ° C for 10min, and then continue to act at 95 ° C for 5min.
2) Synthesis of the first strand of cDNA: prepare the following mixture in a centrifuge tube on ice: Total RNA 5 μ l. Oligo (DT) 18 primer (0.5mg / ml) 1ml, gently mixed and centrifuged for 3-5 seconds. Incubate at 70 ° C for 5 minutes, remove, ice bath, and centrifuge briefly. Place the centrifuge tube on ice. Add the following ingredients in order: 5 × Reaction buffer 5ml, 10mm dNTP mixture 5ml, reverse transcriptase (200 μ/ Ml) 1ml, RNase inhibitor (20 μ/ Ml) 0.5ml, mix gently and centrifuge briefly. Incubate for 5 minutes at 37 ° C, incubate for 1 hour at 42 ° C, terminate the reaction after 10 minutes at 70 ° C, and cool on ice. CDNA synthesis is complete.
(3)Take 4 ml of reverse transcription product and add it to 10 containing 5 ml × PCR reaction buffer, 1.5 ml MgCl2 (50 mm), 1 ml dNTP mixture (10 mm), 1 ml upstream primer (10 PM), 1 ml downstream primer (10 PM) and 0.3 ml Taq enzyme (5 U / ml) were added with water to make up the volume to 50 ml. Amplification was carried out according to the following procedures: pre denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 45 seconds, renaturation at 56 ° C (mainly based on the annealing temperature after primer sequence) for 45 seconds, extension at 72 ° C for 1 minute, repeated 35 times and extension at 72 ° C for 10 minutes. Take 10ml amplification product and 2ml 6 × After the loading buffer was mixed, electrophoresis was performed on 1.5% agarose gel, and Kodak UV-2000 UV analyzer was used for observation and scanning analysis. The primers used are as follows:
name
|
sequence Product size
|
Ajuba –S
Ajuba –AS
|
5’-GGGAACCCTTGGGGATTGAG -3’ 222bp
5’- AAGTTCGTCCACAGGAGCAG-3’
|
Isl1 –S
Isl1 –AS
|
5’- TGCGGTAATCAAATTCACGA-3’ 180bp
5’- GCATTTGATCCCGTACAACC-3’
|
Actin–S
|
5’-CGTAAAGACCTCTATGCCAACA-3’ 131bp
|
Actin–AS
|
5’-GGAGGAGCAATGATCTTGATCT-3’
|
Luciferase reporter gene detection after BMSC was infected with mir-21-oe and mir-21-kd, miR-21 directly regulated ajuba:
(1) According to the analysis and prediction of bioinformatics methods, miR-21 was bound to the site of ajuba 3'UTR untranslated region (2). The wild-type pmirglo-ajuba-3'utr (wt-pmirglo-ajuba-3'utr) and mutant pmirglo - ajuba-3'utr mut (MUT - pmirglo-ajuba - 3'UTR) expression vectors were constructed by gene synthesis method, and the synthesized DNA fragments were inserted into luciferase reporter gene plasmid (pmirglo) NheI (gctagc) and Sali (gtcgac) digestion sites in E.coli dha5a.
(3) Positive clones were screened and sequenced.
(4) Amplify the transcription factor plasmid and purify it for standby. Meanwhile, prepare the corresponding empty plasmid control and purify it for standby.
(5) MSCs were cultured and inoculated in 24 well plates for 10-24 hours (80% confluence).
(6) BMSC cells were infected with the virus with mir-21-oe overexpression and mir-21-kd interference, and then the reporter gene plasmid was co transfected into the cells.
(7) Cells were lysed and used for luciferase detection.
(8) The substrate was added to determine the activity of luciferase.
(9) The relative fluorescence intensity was calculated and compared with the control group.
Statistical method:
The images were analyzed by image programmer software, and the related statistical analysis was carried out by graphpad prism 5 demo and SAS v6.12 software. The data were analyzed according to the mean ± standard deviation. T-test was used between the groups, and the experiment was carried out three times.