Abundance of colistin-resistant Escherichia coli harbouring mcr-1 and extended-spectrum β-lactamase-producing E. coli co-harbouring blaCTX-M-55 or -65 with blaTEM isolates from chicken meat in Vietnam

doi:10.21203/rs.3.rs-904323/v1

Although the spread of plasmid-mediated antibiotic-resistant bacteria is a public health concern, food contamination with plasmid-mediated antibiotic-resistant Escherichia coli has not been well investigated in Vietnam. The aim of this study was to describe the prevalence of colistin-resistant, carbapenem-resistant and endemic bla_CTX−M in extended-spectrum β-lactamase (ESBL)-producing E. coli isolates. Colistin- and carbapenem-resistant ESBL-producing E. coli were isolated from chickens in Vietnam and Japan. The results showed that 52% and 93% of Vietnamese chicken was isolated with colistin-resistant and AmpC/ESBL-producing E. coli, respectively, while 52.7% of Japanese chickens were isolated with AmpC/ESBL-producing E. coli. Carbapenem-resistant E. coli has not been isolated in Vietnam or Japan. Genotyping revealed that colistin-resistant E. coli harboured mcr-1, and most of the AmpC/ESBL-related genes were bla_CTX−M−55 and bla_CTX−M−65 together with bla_TEM in Vietnamese chickens, and bla_CMY−2 in Japanese chickens. Multidrug resistance analysis showed that ESBL-producing E. coli isolates were more resistant to quinolones, streptomycin, and chloramphenicol compared with colistin-resistant E. coli isolates from Vietnam, suggesting selection in ESBL-producing E. coli for multiple antibiotic resistance genes. In conclusion, colistin-resistant E. coli was detected in about half of the chicken meat samples, the majority of which were found to harbour mcr-1. The high prevalence of ESBL-producing E. coli has remained constant across the last five years, and the predominant bla_CTX−M for ESBL-producing E. coli was found to be bla_CTX−M−55 or bla_CTX−M−65, with the coexistence of bla_TEM in Vietnam. Our results can be implemented in monitoring systems to combat the development of antimicrobial resistance.

Architecture, Design and Planning

General Microbiology

Applied & Industrial Microbiology

mcr-1

blaCTX-M-55

blaCTX-M-65

blaCMY-2

blaTEM

plasmid-mediated antibiotic-resistant E. coli

The spread of antibiotic-resistant bacteria is a worldwide public health concern (Giurazza et al. 2021). Plasmid-mediated antibiotic resistance, a critical issue in the study of antibiotic resistance, requires urgent attention due to the development of resistance by horizontal gene transmission (Bevan et al. 2017).

In 2015, there was a report on the acquisition of colistin resistance by a new plasmid-encoded mcr gene (Liu et al. 2016). Colistin is expected to be a therapeutic agent for carbapenem-resistant bacteria. Therefore, the spread of colistin-resistant bacteria in society is of great concern. In our study, we found that colistin is frequently used on agricultural and livestock farms in Vietnam (Nakayama et al. 2017). In addition, Yamamoto et al. (2019) found that approximately 70% of Vietnamese local residents carried colistin-resistant bacteria. Although it is assumed that Vietnamese food can lead to human colonisation with colistin-resistant bacteria, pathways of contamination are not clear. This is especially true in chickens, where plasmid-mediated drug-resistant bacteria are frequently isolated.

ESBL and carbapenem-resistant bacteria are often associated with plasmid-mediated antibiotic resistance. Recent studies have focused on ESBL-producing Escherichia coli, a bacterium demonstrating plasmid-mediated antibiotic resistance (Bevan et al. 2017). Current knowledge suggests that ESBL-producing bacteria in food and humans is detected more frequently in Vietnam than in Japan (Nakayama et al. 2015; Le et al. 2015). In an earlier study in Vietnam, we found that ESBL-producing E. coli were frequently detected in chicken meat between 2013–2016. Most of the ESBL-producing E. coli isolates carried ESBL-related genes in the bla_CTX−M−1 and _M−9 groups (Nakayama et al. 2015).

Monitoring of antibiotic-resistant bacteria is currently underway in many countries around the world. Therefore, it is very important to identify not only the presence of ESBL-producing E. coli but also the bla_CTX−M genotype, which is currently widespread. Carbapenem-resistant E. coli are also well known as plasmid-mediated antibiotic-resistant E. coli, but research is lacking with regards to its importance and the degree of contamination in chicken. Hence, as with ESBL-producing E. coli, caution is required for the spread of carbapenem-resistant E. coli. In Japan, food contamination with AmpC/ESBL-producing E. coli was found in multiple studies (Kameyama et al. 2013; Hiroi et al. 2012). Reports indicate that bla_CMY−2 and bla_CTX−M−2 are the most abundant ESBL-producing E. coli in chickens. There are no reports of carbapenem-resistant and colistin-resistant E. coli isolated from chickens in Vietnam or Japan. Therefore, the aim of this study was to determine and compare the prevalence of colistin, carbapenem-resistant, and ESBL-producing E. coli in chickens of Vietnam and Japan.

Sampling locations and bacterial isolation

A total of 134 chicken samples (including 60 meat samples were purchased in retails or supermarkets, Ho Chi Minh City, Vietnam, and 33 meat samples were purchased in supermarkets and 41 faecal samples from laying hens in Japan) were investigated. Chicken meat (25 g) was mixed with 225 mL of buffered peptone water (BPW) or 1 g of faeces was mixed with 9 mL of BPW. After gentle shaking, 100 µL of the solution was spread on MacConkey agar (Eiken Chemical, Tochigi, Japan) containing 2 µg mL^-1 of cefotaxime (CTX) for AmpC/ESBL-producing E. coli isolation, 2 µg mL^-1 colistin for colistin-resistant E. coli isolation, or 0.25 µg mL^-1 of meropenem (MEM) for carbapenem-resistant E. coli isolation, and finally incubated at 37^oC for 21 ± 3 h. After incubation, one to three colonies were picked for further analysis.

Bacterial identification and DNA extraction

Isolated bacteria were confirmed as E. coli by biochemical tests, such as triple sugar iron (Eiken Chemical, Tokyo, Japan) and lysin indole motility (Eiken Chemical, Tochigi, Japan). Bacterial DNA was extracted by boiling suspensions of the isolates in Tris (hydroxymethyl) aminomethane-EDTA buffer (Nakayama et al. 2015). Isolated bacteria were also identified as E. coli using ECN amplification (Hoa et al 2020).

Multiplex PCR for phylogenetic group

The phylogenetic groups of isolated bacteria were determined by multiplex PCR amplification of a combination of two genes, chuA and yjaA, and a DNA fragment, TspE4C2 (Le et al. 2015). The extracted DNA was amplified using a multiplex PCR kit (Qiagen, Hilden, Germany). Primer sets for multiplex PCR are specified in Table S1. PCR was conducted under the following conditions: 35 cycles of denaturation at 98 ^oC for 10 s, annealing at 57^oC for 30 s, and extension at 72 ^oC for 30 s. The PCR amplified products were visualized using 1.5% agarose gel and stained by midori-green (Nippon genetics, Tokyo, Japan).

Antibiotic susceptibility testing

After subculturing, the isolated bacteria were suspended in Mueller Hinton (MH) broth (BD, Franklin Lakes, USA). The bacterial suspension was adjusted at MacFarland 0.5, and then the bacterial solution was spread on MH agar (BD, Franklin Lakes, USA) using a sterile cotton swab. E. coli isolates were tested for susceptibility to 14 antimicrobial agents: tetracycline (TET), ampicillin (AMP), nalidixic acid (NAL), kanamycin (KAN), chloramphenicol (CHL), streptomycin (STR), trimethoprim/sulfamethoxazole (SXT), gentamicin (GEN), ciprofloxacin (CIP), CTX, ceftazidime (CAZ), meropenem (MEM), and cefoxitin (CFX) (BD Japan, Tokyo, Japan). The disc diffusion method was subsequently used to measure the inhibition zone after bacterial incubation at 37 °C for 21 h, following the standard procedure of the Clinical Laboratory Standards Institute (CLSI 2017). The ESBL phenotype was determined by the double-disk synergy test, using ceftazidime and CTX with and without clavulanic acid (BD, Franklin Lakes, USA), following the guidelines of the CLSI (2017). The AmpC phenotype was also determined using the cefoxitin disc, and MEM resistance was evaluated as carbapenem resistance.

Multiplex PCR for mcr and AmpC/ESBL-related genes

The genotype of AmpC/ESBL-producing E. coli was determined using multiplex PCR, as described previously (Le et al. 2015; Perez-Perez et al. 2002). Extracted DNA was amplified using a multiplex PCR kit (Qiagen, Hilden, Germany). Multiplex PCRs were conducted under the following conditions: for ESBL, 25 cycles of denaturation at 95 ^oC for 30 s, annealing at 60 ^oC for 90 s, and extension at 72 ^oC for 90 s; for AmpC, 25 cycles of denaturation at 95 ^oC for 30 s, annealing at 64 ^oC for 90 s, and extension at 72 ^oC for 60 s. Primers for multiplex PCR of both AmpC and ESBL-related genes are described in Table S1. The PCR amplified products were visualized using 3% agarose gel and stained by midori-green (Nippon genetics, Tokyo, Japan).

Identification bla_CTX-M and bla_CMY-2

After determining the ESBL genotypes, the results from both the bla_CTX-M-1, bla_CTX-M-2, and bla_CTX-M-9 groups were sequenced. We followed the protocol as described in previous studies (Chanawong et al. 2002; Imoto et al. 2014; Harada et al. 2017; Hoang et al. 2017). In the bla_CTX-M-1 group, the bla_CTX-M-1 sequence was amplified using the primer sets ctx-m15-168F and ctx-m3-1059R. The amplified gene was sequenced using the primer sets ctxm1-185F and ctxm3-492R. For the bla_CTX-M-2 and bla_CTX-M-9 groups, the gene was amplified using the primer sets ctx-m2s-1f and ctx-m2-869f, and toho2-48F and ctxm14-903R, respectively. The amplified gene was sequenced using the primer sets toho1-1R, ctx-m2-316f, toho2-411F and ctxm9-490R, respectively. To identify bla_CMY-2, the bla_CMY-2 gene was amplified using cmy-F and cmy-R primers, and the amplified gene was sequenced using CMY2-outF and CMY2-outR. Primer information is described in Table S1. Each assembled gene sequence was identified using a BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Prevalence of chicken contamination with E. coli harbouring mcr, AmpC/ESBL, and carbapenemase-related genes

In a study of 60 samples of chicken meat from Vietnam, AmpC/ESBL-producing E. coli was isolated from 90% (54/60) of the samples, and 52% (26/50) of the chicken meat samples were found to have colistin-resistant E. coli, whereas carbapenem-resistant E. coli was not detected (Table 1). In comparison, AmpC/ESBL-producing E. coli was isolated from 36.4% (12/33) of Japanese chicken meat. Neither colistin- or carbapenem-resistant E. coli were detected (Table 1).

Table 1

Prevalence of *E. coli* harbouring *mcr*, AmpC/ESBL, and carbapenemase-related genes in chikens.
Location	Number of chicken samples		Number of chicken samples contamination with E. coli harbouring antibiotic resistance genes			Number of colistin-resistant E.coli isolates and tested	Number of E. coli harbouring antibiotic resistance genes	Number of CTX-resistant E.coli isolates	Number of CTX-resistant E. coli tested	Number of E. coli harbouring antibiotic resistance genes
Location	Number of chicken samples		mcr gene	AmpC/ESBL-related gene	carbapenemase-related gene	Number of colistin-resistant E.coli isolates and tested	mcr genes	Number of CTX-resistant E.coli isolates	Number of CTX-resistant E. coli tested	AmpC/ESBL-related genes
Vietnam	60 (chicken meat)		43.3% (26/60)	90% (54/60)	0	36	35	166	152	135
Japan	33 (chicken meat)		0	36.4% (12/33)	0	0	0	23	14	14
	41 (faeces in laying hens)		0	65.9% (27/41)	0	0	0	70	43	43
	Total	74	0	52.7% (39/74)	0	0	0	93	57	57
^{* Significant difference between chicken meat from Vietnam and Japan (p < 0.01)}

Phylogenetic group of E. coli

Among AmpC/ESBL-producing E. coli isolated from Vietnamese chicken, type B2 was the least common (7.7%), while other types showed similar results (21.1–26.3%). Type B2 was not detected in colistin-resistant E. coli. Other types showed similar results to ESBL-producing E. coli (22.9–25.9%) (Table 2). In Japanese chickens, high rates of B1 (43.9%) and D (31.6%) types of ESBL-producing E. coli were isolated. Type B2 (3.5%) had a low detection rate, similar to the E. coli strains in Vietnamese chicken (Table 2).

Table 2

Phylogenetic grouping of *E. coli* isolates.
	Vietnam		Japan
	Number of E. coli harboring mcr gene	Number of AmpC/ESBL-producing E. coli
A	25.9% (9/35)	21.1% (32/152)	10.5% (6/57)
B1	25.9% (9/35)	25.7% (39/152)	43.9% (25/57)*
B2	0	7.7% (4/152)	3.5% (2/57)
D	22.9% (8/35)	26.3% (40/152)	31.6% (18/57)
NT	25.9% (9/35)	24.3% (37/152)	10.5% (6/57)*

E. coli harbouring mcr gene

Isolated E. coli was used to detect mcr using multiplex primers. The results showed that one strain was undetectable and mcr-1 was detected in all of the remaining E. coli isolates (Table 3).

Table 3

Colistin-resistant *E. coli* harbouring *mcr-1*.
	Number of E. coli
Isolated colistin-resistant E. coli	36
mcr-1	35
mcr-2	0
mcr-3	0
mcr-4	0
mcr-5	0
non-detection	1

ESBL-producing E. coli co-harbouring bla_CTX−M and bla_TEM

In 115 ESBL-producing E. coli isolates from Vietnamese chickens, bla_CTX−M−1 (67%) tended to be more prevalent than the bla_CTX−M−9 (28.7%) group, which was also the case in the 39 Japanese isolates (bla_CTX−M−1 = 53.8%, bla_CTX−M−9 = 23.1%). The results of bla_CTX−M identification showed that bla_CTX−M−55 (58.3% [67/115]) of the bla_CTX−M−1 group was the most common bla_CTX−M in Vietnamese samples, followed by bla_CTX−M−65 (18.2% [21/115]) of the bla_CTX−M−9 group (Fig. 1a). bla_CTX−M−1 (23.1% [9/39]), of the bla_CTX−M−1 group, and bla_CMY−2 (23.1% [9/39]) were found to be the most common in Japanese samples, followed by bla_CTX−M−2 of the bla_CTX−M−2 group (12.8% [5/39]) (Fig. 1b). Multiple ESBL-related genes were detected in Vietnamese samples. In particular, the combination of bla_CTX−M and bla_TEM was found to be present in more than 70% of the strains (Table 4).

Table 4

*E. coli* co-harbouring *bla*_CTX−M and *bla*_TEM genes in Vietnam.
	CTX-M Sub-group	CTX-M or CMY-2	Number of AmpC/ESBL-producing E. coli
	CTX-M Sub-group	CTX-M or CMY-2	Vietnam	Japan
ESBL-related genes	CTX-M-1 group	M-1		9
		M-15	2	1
		M-55	22
		M-1/TEM	2	7
		M-15/TEM	3	3
		M-15/TEM/SHV		1
		M-55/TEM	45
		M-244/TEM	1
		M-79/TEM	1
		M-114/TEM	1
		CTX-M 1 group	67% (77/115)	53.8% (21/39)
	CTX-M-9 group	M-14	2	4
		M-27		2
		M-65	4
		M-125	1
		M-14/TEM	4	1
		M-24/TEM	1
		M-27/TEM	2	2
		M-65/TEM	17
		M-125/TEM	1
		M-129/TEM	1
		CTX-M-9 group	28.7% (33/115)	23.1% (9/39)
	CTX-M-1 and 9 group	M-1, 65	1
		M-1,129/TEM	1
		M-55, 65/TEM	3
	CTX-M-2 group	M-2		5
	CTX-M-2 group	CTX-M-2/TEM		2
	SHV group	SHV		2
	CTX-M group with TEM		72.2% (83/115)*	41% (16/39)*
AmpC type beta-lactamse related genes	CIT group	CMY-2	13	16
		CMY-2/TEM	2
		Other CITg	1
		Other CITg/TEM	2
		CIT group	15.7% (18/115)	13.9% (16/115)
	CIT group with TEM		22.2% (4/18)	0
^{*Significance difference between ESBL−producing E. coli harbouring CTX−M group with TEM isolates in Vietnam and Japan (p < 0.01)}
a ESBL-producing E. coli strains in Vietnam.

Antibiotic susceptibility and multidrug-resistant E. coli

The susceptibility test results showed that colistin-resistant E. coli harbouring mcr differed significantly from the Vietnamese chicken-derived ESBL strains in third-generation cephalosporins and quinolones (Fig. 2a, 2b), and the result of multidrug resistance showed that the highest numbers of drug resistance were 4 and 6, with an average of 6.7 (Fig. 3).

Compared to strains in Japanese chickens, ESBL-producing E. coli isolates from Vietnamese chickens had a significantly higher percentage of resistance to all treatments except beta-lactams (Fig. 2b, 2c). The percentage of resistance to quinolones, SXT, and chloramphenicol was particularly high in ESBL-producing E. coli isolates from Vietnam. In multidrug resistance, ESBL-producing E. coli showed the highest number of drug-resistant strains (8) (average number of drug resistant strains was 9.1), followed by 11 drug-resistant strains. In comparison, in ESBL-producing E. coli isolates from Japanese chickens, 4 and 3 kinds of drug resistance were the most common, with an average drug resistance of 4.7 (Fig. 3).

The contamination of Vietnamese food with colistin-resistant bacteria has not been sufficiently studied. Nguyen et al (2021) investigated colistin-resistant E. coli isolated from 15 chickens and found that colistin resistance was found in 66.7% of the sample group. In their analysis of chicken faeces from backyard chickens in Vietnam, Kawahara et al. (2019) found that 97.2% of the chickens carried E. coli harbouring the mcr gene. Le et al. (2021) investigated colistin resistance in ESBL-producing E. coli isolated from chickens. They found that 53.2% of ESBL-producing E. coli isolates were colistin-resistant, and all of these colistin-resistant isolates harboured mcr-1 (Le et al. 2021). In this study, 43.3% of the food products contained colistin-resistant E. coli and almost all of which harboured mcr-1, suggesting that mcr-1 may be spreading between chickens in Vietnam.

To easily isolate colistin-resistant E. coli, we analysed chicken faeces from Japan but no trace of the bacteria was found. Therefore, colistin-resistant E. coli did not expand in the Japanese chickens. In this study, carbapenem-resistant E. coli was not isolated from either Vietnamese or Japanese chickens. Although it can be isolated in hospitals and the environment (Mathys et al. 2019; Zhong et al. 2021), carbapenem-resistant E. coli is not generally transmitted to foods in Vietnam or Japan.

In this study, the phylogenetic group was determined for colistin-resistant and ESBL-producing E. coli isolates. Colistin-resistant E. coli showed a similar pattern to that of ESBL-producing Vietnamese strains. Prevalence of B2 type E. coli was much lower compared to the other types. Although no study has investigated the pattern of phylogenetic grouping, normal E. coli isolates from chickens, it is possible that the absolute number of E. coli type B2 bacteria contamination is low. The phylogenetic group of ESBL-producing E. coli in Japanese strains showed that the B1 and D types were very high. This result may be due to regional differences.

As monitoring data to combat antibiotic resistance, it is necessary to clarify the actual condition of antibiotic resistance genes in chicken meat that are frequently contaminated. In Vietnam, the bla_CTX−M gene of ESBL-producing E. coli is the most prevalent plasmid antibiotic resistance gene. In this study, ESBL-producing E. coli was detected in 90% (54/60) of the chicken meat samples from Vietnam. Similar to our study, Le et al. (2015, 2016) found ESBL-producing E. coli isolates in 88.3% (Le et al. 2015), 58.7% (Le et al. 2015), and 92.7% (Nguyen et al. 2016) of Vietnamese chicken samples. The Vietnamese government is motivated towards researching antibiotic resistance and will be limiting the use of antibiotics in chicken farms. However, the prevalence of ESBL-producing E. coli has not changed, even after 5 years, and is considered to have become chronic due to its prevalence.

Previous studies by Le et al. (2015) and Nguyen et al. (2016) examined the CTX-M subgroup and found that bla_CTX−M−1 group was the most common, followed by bla_CTX−M−9 group. No actual identification was performed. In this study, the bla_CTX−M−1 group was the most common, followed by bla_CTX−M−9. Among the bla_CTX−M−1 group, bla_CTX−M−55 was the most common, and among the bla_CTX−M−9 group, bla_CTX−M−65 was the most common. The results of a previous study of ESBL-producing E. coli from pork in Vietnam showed that bla_CTX−M−55 was abundant, and the plasmid carrying bla_CTX−M−55 was also found in workers and UTI patients (Hoang et al. 2017), suggesting plasmid transmission within the community. Based on these findings, bla_CTX−M−55 is abundant in pork and chicken.

Multiple studies have reported on the genotyping of AmpC/ESBL-producing E. coli isolated from Japanese chickens. Kameyama et al. (2013) reported that the AmpC β-lactamase gene bla_CMY−2 (66%) was the most prevalent, followed by bla_CTX−M−1 (26%) and bla_CTX−M−55 (26%). Hiroi et al. (2012) reported that ESBL-producing E. coli harbouring bla_CTX−M−2 were most prevalent in chickens. Nahar et al. (2018) also reported that the bla_CTX−M−2 group and the bla_CTX−M−1 group respectively represented 45% and 34% of ESBL-producing E. coli. Our study found clear differences in prevalence of bla_CTX−M groups in Vietnamese and Japanese chicken samples. Hence, the pattern of bla_CTX−M varies between regions. In Vietnam, the co-harbouring genes bla_CTX−M−55 or bla_CTX−M−65 with bla_TEM were most prevalent in ESBL-producing E. coli. These bla_CTX−M genes could be used to monitor antibiotic resistance genes towards improving healthcare in Vietnam.

The prevalence of antibiotic resistance genes is known to change annually (Bevan et al. 2017). The bla_CTX−M type of ESBL-producing E. coli isolated from humans is said to be bla_CTX−M−15 (bla_CTX−M−1 group) and bla_CTX−M−14 (bla_CTX−M−9 group), prevalent in many parts of the world. Accounting for prominent global trends in bla_CTX−M epidemiology, there is increasing evidence to suggest that bla_CTX−M−27 has begun to outcompete other bla_CTX−M genotypes (Bevan et al. 2017). In Vietnam, a study of ESBL-producing E. coli isolates from healthy Vietnamese people from 2013–2015 reported that bla_CTX−M−27 was the most common, followed by bla_CTX−M−55, bla_CTX−M−15, and bla_CTX−M−65 (Hoang et al. 2017). Our results show that in 2019, the overwhelming majority of bla_CTX−M isolates from chickens had ESBL-producing E. coli harbouring bla_CTX−M−55 and bla_CTX−M−65. It has not been verified whether the bla_CTX−M gene is transferred from chickens to humans, but if it is, it is likely that bla_CTX−M−55 or bla_CTX−M−65 will be predominant in human carriers in the future. It is necessary to carefully monitor whether the detection of bla_CTX−M−27 from ESBL-producing E. coli will increase in the future.

Funding

This study was financially supported by the MEXT/JSPS KAKENHI Grant 18KK0168.

Conflict of Interest

None of the authors declares a conflict of interest.

Ethics approval and consent to participate

Ethics approval was not required for this research.

Bevan ER, Jones AM, Hawkey PM (2017) Global epidemiology of CTX-M β-lactamases: temporal and geographical shifts in genotype. J Antimicrob Chemother 72:2145-2155. http://doi: 10.1093/jac/dkx146.

Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ (2005) Identification of plasmids by PCR-based replicon typing. J Microbiol Methods 63:219-28.

Chanawong A, M’Zail FH, Heritage J, Xiong JH, Hawkey PM (2002) Three cefotaximases, CTX-M-9, CTX-M-13, and CTX-M-14 among Enterobacteriaceae in the people’s republic of China. Antimicrob. Agents Chemother 46:630-7. http://doi: 10.1128/AAC.46.3.630-637.2002.

Giurazza R, Mazza MC, Andini R, Sansone P, Pace MC, Durante-Mangoni E (2021) Emerging Treatment Options for Multi-Drug-Resistant Bacterial Infections. Life (Basel) 11:519. http://doi: 10.3390/life11060519.

Harada T, Yamane R, Dang VC, Nguyen DP, Nguyen TAD, Jinnai M, Yonogi S, Kawahara R, Kanki M, Kawai T, Kawatsu K, Kumeda Y, Isegawa Y, Yamamoto Y (2017) Prevalence and antimicrobial susceptibility of Enterobacteriaceae isolated from retail pepper in Vietnam. J Food Prot28:716-24. http:// doi: 10.4315/0362-028X.JFP-16-501.

Hiroi M, Yamazaki F, Harada T, Takahashi N, Iida N, Noda Y, Yagi M, Nishio T, Kanda T, Kawamori F, Sugiyama K, Masuda T, Hara-Kudo Y, Ohashi N (2012) Prevalence of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in food-producing animals. J Vet Med Sci 74:189-95. http://doi: 10.1292/jvms.11-0372.

Hoa TTT, Nakayama T, Huyen HM, Harada K, Hinenoya A, Phuong NT, Yamamoto Y (2020) Extended-spectrum beta-lactamase-producing Escherichia coli harbouring sul and mcr-1 genes isolates from fish gut contents in the Mekong Delta, Vietnam. Lett Appl Microbiol 71:78-85. http://doi: 10.1111/lam.13222.

Hoang TAV, Nguyen TNH, Ueda S, Le QP, Tran TTN, Nguyen TND, Dao TVK, Tran MT, Le TTT, Le TL, Nakayama T, Hirai I, Do TH, Vien QM, Yamamoto Y (2017) Common findings of bla_CTX-M-55-encoding 104-139 kbp plasmids harbored by extended-spectrum beta-lactamase-producing Escherichia coli in pork meat, wholesale market workers, and patients with urinary tract infection in Vietnam. Curr Microbiol 74:203-11. http://doi: 10.1007/s00284-016-1174-x.

Imoto A, Ooi Y, Edogawa S, Ogura T, Masuda D, Mohamed M, Takii M, Umegaki E, Kawahara R, Ukimura A, Higuchi K (2014) Liver abscess caused by CTX-M-55type extended-spectrum beta-lactamase(ESBL)-producing Salmonella enteritidis. Intern Med 53:1699-703. http://doi: 10.2169/internalmedicine.53.2407.

Kameyama M, Chuma T, Yabata J, Tominaga K, Iwata H, Okamoto K (2013) Prevalence and epidemiological relationship of CMY-2 AmpC beta-lactamase and CTX-M extended-spectrum beta-lactamase-producing Escherichia coli isolates from broiler farms in Japan. J Vet Med Sci 75:1009-15. http://doi: 10.1292/jvms.12-0453.

Kawahara R, Fujiya Y, Yamaguchi T, Khong DT, Nguyen TN, Tran HT, Yamamoto Y (2019) Most domestic livestock possess colistin-resistant commensal Escherichia coli harboring mcr in a rural community in Vietnam. Antimicrob Agents Chemother 63:e00594-19. http:// doi: 10.1128/AAC.00594-19.

Le PQ, Awasthi SP, Hatanaka N, Hinenoya A, Hassan J, Ombarak RA, Iguchi A, Tran NTT, Dao KVT, Vien MQ, Le HX, Do HT, Yamamoto Y, Yamasaki S (2021) Prevalence of mobile colistin resistance (mcr) genes in extended-spectrum β-lactamase-producing Escherichia coli isolated from retail raw foods in Nha Trang, Vietnam. Int J Food Microbiol 346:109164. doi: 10.1016/j.ijfoodmicro.2021.109164.

Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu LF, Gu D, Ren H, Chen X, Lv L, He D, Zhou H, Liang Z, Liu JH, Shen J (2016) Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis 16:161-8. http://doi: 10.1016/S1473-3099(15)00424-7.

Le QP, Ueda S, Nguyen TN, Dao TV, Van Hoang TA, Tran TT, Hirai I, Nakayama T, Kawahara R, Do TH, Vien QM, Yamamoto Y (2015) Characteristics of extended-spectrum beta-lactamase-producing Escherichia coli in retail meats and shrimp at a local market in Vietnam. 12:719-25. http://doi: 10.1089/fpd.2015.1954.

Le HV, Kawahara R, Khong DT, Tran HT, Nguyen TN, Pham KN, Jinnai M, Kumeda Y, Nakayama T, Ueda S, Yamamoto Y (2015) Widespread dissemination of extended-spectrum beta-lactamase-producing, multidrug-resistant Escherichia coli in livestock and fishery products in Vietnam. J Food Contamin 2:17. http://DOI10.1186/s40550-015-0023-1.

Nahar A, Awasthi SP, Hatanaka N, Okuno K, Hoang PH, Hassan J, Hinenoya A, Yamasaki S. (2018) Prevalence and characteristics of extended-spectrum beta-lactamase-producing Escherichia coli in domestic and imported chicken meats in Japan. J Vet Med Sci 2018 80:510-517. http://doi: 10.1292/jvms.17-0708.

Nakayama T, Jinnai M, Kawahara R, Diep KT, Thang NN, Hoa TT, Hanh LK, Khai PN, Sumimura Y, Yamamoto Y (2017) Frequent use of colistin-based drug treatment to eliminate extended-spectrum beta-lactamase-producing Escherichia coli in backyard chicken farms in Thai Binh Province, Vietnam. Trop Anim Health Prod 49:31-37. http://doi: 10.1007/s11250-016-1154-y.

Nakayama T, Ueda S, Huong BTM, Tuyen LD, Komalamisra C, Kusolsuk T, Hirai I, Yamamoto Y (2015) Wide dissemination of extended-spectrum beta-lactamase-producing Escherichia coli in community residents in the Indochinese peninsula. Infect and Drug Resist 8:1-5. http://doi: 10.2147/IDR.S74934.

Nguyen DP, Nguyen TAD, Le TH, Tran NMD, Ngo TP, Dang VC, Kawai T, Kanki M, Kawahara R, Jinnai M, Yonogi S, Hirai Y, Yamamoto Y, Kumeda Y (2016) Dissemination of extended-spectrum beta-lactamase-and AmpC beta-lactamase-producing Escherichia coli within the food distribution system of Ho Chi Minh City, Vietnam. BioMed Research International 2016:8182096. http://doi: 10.1155/2016/8182096.

Nguyen TN, Khong DT, Le HV, Tran HT, Phan QN, Le HTT, Kawahara R, Yamamoto Y (2021) Quantitative Analysis of Colistin-Resistant Escherichia coli in Retail Meat from Local Vietnamese Markets. Biomed Res Int 19:2021:6678901. http://doi: 10.1155/2021/6678901.

Noda T, Murakami K, Etoh Y, Okamoto F, Yatsuyanagi J, Sera N, Furuta M, Onozuka D, Oda T, Asai T, Fujimoto S (2015) Increase in resistance to extended-spectrum cephalosporins in Salmonella isolated from retail chicken products in Japan. PLoS One 10:e0116927. http://doi: 10.1371/journal.pone.0116927.

Mathys DA, Mollenkopf DF, Feicht SM, Adams RJ, Albers AL, Stuever DM, Grooters SV, Ballash GA, Daniels JB, Wittum TE (2019) Carbapenemase-producing Enterobacteriaceae and Aeromonas spp. present in wastewater treatment plant effluent and nearby surface waters in the US. PLoS One. 14:e0218650. http://doi: 10.1371/journal.pone.0218650.

Perez-Perez FJ. Hanson ND. (2002) Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol 40:2153-62. http://doi: 10.1128/JCM.40.6.2153-2162.2002.

Pitout JDD, Hossain A, Hanson ND (2004) Phenotypic and Molecular detection of CTX-M-beta-lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol 42:5715-21. http://doi: 10.1128/JCM.42.12.5715-5721.2004.

Yamamoto Y, Kawahara R, Fujiya Y, Sasaki T, Hirai I, Khong DT, Nguyen TN, Nguyen BX (2019) Wide dissemination of colistin-resistant Escherichia coli with the mobile resistance gene mcr in healthy residents in Vietnam. J Antimicrob Chemother 74:523-524. doi: 10.1093/jac/dky435.

Zhao S, Qaiyumi S, Friedman S, Singh R, Foley SI, White DG, McDermott PF, Donkar T, Bolin C, Munro S, Baron EJ, Walker RD (2003) Characterization of Salmonella enterica serotype newport isolated from humans and food animals. J Clin Microbiol 41:5366-71.

Zhong H, Chen F, Li YJ, Zhao XY, Zhang ZL, Gu ZC, Yu YT (2021) Global trends and hotspots in research of carbapenem-resistant Enterobacteriaceae (CRE): a bibliometric analysis from 2010 to 2020. Ann Palliat Med 10:6079-6091. http:// doi: 10.21037/apm-21-87.

Supplemental table1

		Primer	Sequence (5' to 3')	Reference
Phylogenetic group		ChuA. 1	GAC GAA CCA ACG GTC AGG AT	(Le HV. et al., 2015)
		ChuA. 2	TGC CGC CAG TAC CAA AGA CA
		YjaA.1	TGA AGT GTC AGG AGA CGC TG
		YjaA.2	ATG GAG AAT GCG TTC CTC AAC
		TspE4C2.1	GAG TAA TGT CGG GGC ATT CA
		TspE4C2.2	CGC GCC AAC AAA GTA TTA CG
ESBL multiplex		TEM-410F	GGT CGC CGC ATA CAC TAT TCT C	(Le QP. et al., 2015)
		TEM-781R	TTT ATC CGC CTC CAT CCA GTC
		SHV-287F	CCA GCA GGA TCT GGT GGA CTA C
		SHV-517R	CCG GGA AGC GCC TCA T
		ctxm1-115F	GAA TTA GAG CGG CAG TCG GG
		ctxm1-702R	CAC AAC CCA GGA AGC AGG C
		ctxm2-39F	GAT GGC GAC GCT ACC CC
		ctxm2-145R	CAA GCC GAC CTC CCG AAC
		ctxm9-16F	GTG CAA CGG ATG ATG TTC GC
		ctxm9-490R	GAA ACG TCT CAT CGC CGA TC
		ctxm8g25g-533F	GCG ACC CGC GCG ATA C
		ctxm8g25g-718R	TGC CGG TTT TAT CCC CG
bla_CTX-M-1	Detection	ctxm15-168F	TTC CAG AAT AAG GAA TCC CAT GG	(Imoto et al., 2014)
	Detection	ctx-m3-1059r	CCG TTT CCG CTA TTA CAA ACC G
	Sequence	ctxm1-185F	TTT ATC GTG CTG ATG AGC GC
	Sequence	ctx-m3-492r	ACG GAA CGT TTC GTC TCC C
bla_CTX-M-2	Detection	ctx-m2s-1f	ATG ATG ACT CAG AGC ATT	(In this study)
	Detection	ctx-m2-869f	CCG TGG GTT ACG ATT TTC GC	(In this study)
	Sequence	toho1-1R	CGG TAG TAT TGC CCT TAA GCC	(Pitout et al., 2004)
	Sequence	ctx-m2-316f	GTT AAC TAC AAT CCC ATT GCG GAG	(In this study)
bla_CTX-M-9	Detection	toho2-48F	CCGTATTGGGAGTTTGAGATGG	(Hoang et al., 2017)
	Detection	cxtm14-903R	AAAGTTCGATTTATTCAACAAAACCAG
	Sequence	toho2-411F	GTCAACGGCACAATGACGC
	Sequence	ctxm9-490R	GAAACGTCTCATCGCCGATC
AmpC multiplex		MOXMF	GCT GCT CAA GGA GCA CAG GAT	(Perez-Perez et al., 2002)
		MOXMR	CAC ATT GAC ATA GGT GTG GTG C
		CITMF	TGG CCA GAA CTG ACA GGC AAA
		CITMR	TTT CTC CTG AAC GTG GCT GGC
		DHAMF	AAC TTT CAC AGG TGT GCT GGG T
		DHAMR	CCG TAC GCA TAC TGG CTT TGC
		ACCMF	AAC AGC CTC AGC AGC CGG TTA
		ACCMR	TTC GCC GCA ATC ATC CCT AGC
		EBCMF	TCG GTA AAG CCG ATG TTG CGG
		EBCMR	CTT CCA CTG CGG CTG CCA GTT
		FOXMF	AAC ATG GGG TAT CAG GGA GAT G
		FOXMR	CAA AGC GCG TAA CCG GAT TGG
bla_CMY-2	Detection	cmy-F	GAC AGC CTC TTT CTC CAC A	(Zhao et al., 2003)
	Detection	cmy-R	TGG AAC GAA GGC TAC GTA	(Zhao et al., 2003)
	Sequence	CMY2-outF	GTT ACA ATG TGT GAG AAG CAG TC	(Noda et al., 2015)
	Sequence	CMY2-outR	ATG GGA TTT TCC TTG CTG TA	(Noda et al., 2015)

Abundance of colistin-resistant Escherichia coli harbouring mcr-1 and extended-spectrum β-lactamase-producing E. coli co-harbouring bla_CTX-M-55 or_-65 with bla_TEM isolates from chicken meat in Vietnam

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Supplemental Table

Status:

Journal Publication

Version 1