Fibroblast culture and strain
Primary human dermal fibroblasts (#PCS-201-012) were purchased from American Type Culture Collection (ATCC, Manassas, Virginia, USA) and cultured as directed by the vendor. Cells were free of mycoplasma contamination as confirmed by the MycoProbe Mycoplasma Detection Kit (R&D Systems, Minneapolis, Minnesota, USA) used as directed by the manufacturer. Cells were seeded at 120,000 cells per well on 6-well flexible collagen I-coated membranes (Flexcell International, Burlington, North Carolina, USA) and, the next day, mechanical stimulation was performed on a Flexcell FX-6000 according to two previously reported strain profiles [6]. Briefly, for the first cyclic short-duration strain (CSDS) profile, fibroblasts were subjected to an 8-hour cycle with 1.6 second bouts of deformation increasing at 33.3%/second starting from rest to a maximum of 10% beyond resting length, followed by decreasing strain to baseline at 33.3%/second (Fig. 1A). For the second CSDS profile, fibroblasts were subjected to an 8-hour cycle with 1.6 second bouts of deformation increasing at 22%/second starting at a baseline strain of 10% and a maximum of 16.6%, followed by decreasing strain to baseline at 22%/second (Fig. 2A). For acyclic long-duration strain (ALDS), after a 3-hour rest period, cells were subjected to a single 60 second bout of stretch at 6% beyond resting length at a loading rate of 3%/second followed by release at 1.5%/second until return to resting length. Conditioned media was collected 96 hours after the strain protocols and stored at -80 °C.
Cytometric Bead Array
Conditioned media was analyzed with the Human Pro-Inflammatory Cytokine Cytometric Bead Array kit (BD Biosciences, Franklin Lakes, New Jersey, USA) as directed by the manufacturer using a BD Accuri Flow Cytometer. Since concentrations for IL-6 and IL-8 varied between runs, data were normalized to CSDS strain profile.
RT-PCR
For expression analyses, primary human dermal fibroblasts were cultured on flexible collagen I-coated membranes as described above and, the next day, cells were scraped using a cell lifter and RNA was collected using the RNEasy Plus kit (QIAGEN). cDNA was synthesized using the SuperScript III First Strand Synthesis kit (ThermoFisher) and PCR was performed using KeenGreen Taq Polymase (IBI Scientific) with primer pairs (IDT DNA) detailed in Table 1 on a miniPCR Thermal Cycler (miniPCR). All primer pairs were designed to cross exon:exon junctions and sample containing no template DNA served as negative control. Amplicons were analyzed by agarose gel electrophoresis and imaged using a blueBox transilluminator (miniPCR).
Table 1
Primer pairs utilized for RT-PCR analyses
| Target | Forward Primer | Reverse Primer |
| IL-1β | CATTGCTCAAGTGTCTGAAGC | CATGGCCACAACAACTGACG |
| IL-6 | TCTCCACAAGCGCCTTCG | CTGAGATGCCGTCGAGGATG |
| IL-8 | GCGCCAACACAGAAATTATTGTAAA | TGCTTGAAGTTTCACTGGCATC |
| IL-10 | GGCGCTGTCATCGATTTCTTC | TAGAGTCGCCACCCTGATGT |
| IL-12A | CAGAAGGCCAGACAAACTCT | GCCAGGCAACTCCCATTAGTTA |
| Hprt | CCTGCTGGATTACATTAAAGCACTG | GTCAAGGGCATATCCAACAACAAAC |
| TNF-α | TGTTGTAGCAAACCCTCAAGC | GAGGTACAGGCCCTCTGATG |
Statistical analyses
Statistical analyses were performed using GraphPad Prism 5 as described in each respective figure legend or in the text. A p-value of < 0.05 was considered significant.