Chemicals
Icariin (ICA) >98% was purchased from Xi'an Nate Biological Technology, China. Chemicals were of highest grade (>98%).
Animals and grouping
Forty male Wistar rats weighing (190–240 g) were bought from the animal house at the Faculty of Pharmacy, King AbdulAziz University, Saudi Arabia. They were maintained at 23 ± 2 °C under a 12 h dark/light cycle. Ethical issues were revised and approved by the Research Ethics Committee, the Faculty of Pharmacy, King Abdulaziz University (Ref. PH-114-40).
Animal treatment
After recoding the initial body weights, animals in Group 1 (control A) and Group 2 (control + ICA 50 mg/kg) were kept on water and standard food. 12 week feeding of pellets containing 3% sodium chloride and 10% fructose water incited MetS in Groups 3, 4, and 5 (Abdallah et al. 2016; Azhar et al. 2020). At week 8, animals in Groups 3, 4 & 5 were orally dosed 1% carboxymethyl cellulose (CMC) in normal saline, ICA (25 mg/kg in 1% CMC suspension), and ICA (50 mg/kg in 1% CMC suspension), respectively, daily until the end of week 12. All oral doses were administered at 10 ml/kg and were given for five days per week. Doses were chosen after a pilot study as well as based on previous experiments (Ding et al. 2018; Liu et al. 2018). At the conclusion of the study, each animal was weighed, anesthetized using 50 mg/kg ketamine and retro-orbital plexus was used for collecting blood. Then, animals were decapitated. Ventral prostates were rapidly dissected out and weighted. The remaining prostate tissues underwent fixation in 10% neutral formalin for histology studies and maintained for future analysis at -80 °C.
Assessment of MetS-related parameters
Blood sera were used to determine Homeostatic Model Assessment of Insulin Resistance (HOMA-IR), triglycerides (TG) and low-density lipoproteins (LDL-C) as elucidated previously in our laboratory (Aljehani et al. 2020).
Weight and Prostate Index
Following prostate dissection, prostate weights were taken and calculation of the prostate index was performed per rat as a ratio of prostate weight to body weight times 1,000.
Histopathological Examination
Wax blocks of the fixed prostatic tissues were sectioned 5 μm thick. This was followed by hematoxylin and eosin (H&E) of the deparaffinized and rehydrated sections. The software Image J (1.46a, NIH, United States) was used to determine prostate glandular epithelial heights.
Assessment of oxidative status markers
After homogenization of prostate tissues in cold phosphate-buffered saline (50 mM, pH 7.5). Homogenates were employed to measure the levels of SOD, total protein, MDA, GSH using ELISA kits (cataloged under numbers 10009055, 703002 and 707002 respectively, Cayman Chemical, Ann Arbor, MI, USA).
Immunohistochemical investigation
Ethyl alcohol was utilized for deparaffinization and re-hydration of prostate sections. This was followed by a 10 min boiling of the sections in citrate buffer (pH 6.0). Then, sections were kept in 5% bovine serum albumin in tris buffered saline (BSA/TBS) for 2 hours. Primary antibodies, anti-cyclin D1 (ab16663), anti-IL-6 (ab271269) and anti-TNF-α (ab205587) (ABCAM, Cambridge, UK) were used for incubation at 4oC for 12 h. The slides were washed using TBS and further incubated with a biotinylated secondary antibody (Ant-rabbit HPRD-DAB, Catalog # CTS005, R&D systems, MN, USA). Images were analyzed and quantified from at least three rats using Image J software (Image J, 1.46a, NIH, USA).
Bax and Bcl-2 analysis by real-time polymerase chain reaction (RT-qPCR)
An ultrasonic probe was used to homogenize prostate tissue. RNA extraction was performed with an extraction kit for nucleic acid (NucleoSpin 740955, Macherey-Nagel GmbH & Co. KG, Duerin, Germany). RNA concentration was measured using a spectrophotometer (dual-wavelength Beckman, Spectrophotometer, USA). cDNA was then synthesized using Reverse Transcription Kit (4368814, Applied Biosystems, Foster City, CA, USA). Amplification was done using Taq PCR Master Mix Kit (catalog # 201443, Qiagen, Valencia, CA, USA). The primers used had the following sequences: Bax sense primer, CCTGAGCTGACCTTGGAGCA and the corresponding antisense primer GGTGGTTGCCCTTTTCTACT, Bcl2 sense primer TGATAACCGGGAGATCGTGA and the corresponding antisense primer AAAGCACATCCAATAAAAAGC, as well as the reference gene β-actin sense primer TCCGTCGCCGGTCCACACCC and the corresponding antisense primer TCACCAACTGGGACGATATG. Results were shown in the cycle threshold (Ct). PCR product specificity was undertaken with PCR melt curve analysis and relative quantitation (RQ) of various genes to β-actin was using the equation 2-ΔΔCt.
Assessment of phosphorylated AMP-activated protein kinase (pAMPK)
Prostate content of phosphorylated AMP-activated protein kinase (pAMPK) was determined by ELISA kit (MyBioSource, San Diego, USA).
Statistical analysis
All data are shown as mean ± SD. Comparisons were done with one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. Analyses were completed with IBM SPSS® ver 25 (SPSS Inc., Chicago, IL, USA). A value of p <0.05 indicated significance in differences.