Materials
Resomer RG 502 H PLGA and PVA (MW 30,000–70,000) were purchased from Sigma Aldrich (St. Louis, MO, USA). Dimethyl sulfoxide, 99.0% (methyl sulfoxide, DMSO) was purchased from Samchun (Seoul, Gangnam-gu, Korea).
Preparation and characterization of MTX loaded nanoparticles
PLGA (50 mg) and methotrexate (5 mg) were dissolved in DMSO at 60℃. The solution was added dropwise to an aqueous solution of 1% PVA (w/v). The solution was homogenized at 7000 RPM for 2 min using a homogenizer (Ultra Turrax® T-25 homogenizer; IKA®-Werke, Staufen, Germany). After homogenization, non-encapsulated substances were removed by dialysis in distilled water for 1 h through a 14,000 molecular weight cut-off membrane. The size distribution of MTX-NP was measured in PBS using a Zetasizer Nano ZS90 (Malvern Instruments, Malvern, UK) at 25℃. Encapsulated MTX was quantified by assaying the absorbance of MTX at 370 nm and encapsulation efficiency was calculated by the formula: ((amount of encapsulated drug/amount of added drug) × 100%). MTX-NP was placed in a dialysis bag and immersed in a container containing 50 mL of PBS to analyze the drug release profile. At predetermined time points, 200 μL of external PBS were removed and the absorbance at 370 nm of MTX was measured using Microplate Reader Synergy H1 (Bio-Tek, USA).
CIA induction and treatment with nanoparticles
Six-week-old male DBA/1J mice were purchased from Orient Bio Inc. (Seongnam, Korea). To induce CIA in mice, CII was dissolved overnight in 0.1 N acetic acid (4 mg/mL) with gentle rotation at 4°C. DBA/1J mice were injected intradermally at the base of the tail with 100 mg of CII emulsified in Freund’s adjuvant (Chondrex). Two weeks later, 100 µg of type II collagen dissolved and emulsified 1:1 with incomplete Freund’s adjuvant (Difco) was administered to the hind leg of mice as a booster injection. On day 24 after the first immunization, mice were injected subcutaneously with 2.5 mg/kg MTX or MTX-NPs twice weekly. Animals were maintained under specific pathogen-free conditions at the Institute of Medical Science of the Catholic University of Korea and were fed standard mouse chow and water. All experimental procedures were examined and approved by the Animal Research Ethics Committee of the Catholic University of Korea; the procedure conformed to all National Institutes of Health of the United States guidelines (Permit number: 2020-0067-01).
Histology
Mouse joint tissues were fixed in 10% neutral-buffered formalin, decalcified in a decalcifying agent (National Diagnostics, Atlanta, GA, USA), embedded in paraffin, and sectioned. The sections (5 µm thick) were stained with hematoxylin and eosin (H&E) and scored as described previously [22]. Immunohistochemical analysis of IL-1β, TNF-α, and vascular endothelial growth factor (VEGF) (Santa Cruz Biotechnology, Dallas, TX, USA) was performed using the Vectastain ABC kit (Vector Laboratories, Burlingame, CA, USA). The sections were examined by light microscopy (Olympus, Tokyo, Japan). Positive cells were enumerated visually by four individuals, and the mean values were calculated.
Isolation of splenocytes
Mouse spleens were ground using sterilized glass slides with frosted ends and red blood cells were lysed in hypotonic ACK buffer (0.15 mM NH4Cl, 1 mM KCO3, and 0.1 mM EDTA, pH 7.4). The remaining splenocytes were filtered through a 40 µm cell strainer (Falcon, Durham, NC) and maintained in RPMI 1640 medium containing 5% fetal bovine serum (ThermoFisher Scientific, MA, USA).
Flow cytometry
To determine the frequency of germinal center (GC) B cells, splenocytes were immunostained with Alexa Fluor® 488-conjugated anti-GL7 (BioLegend, San Diego, CA, USA), PE-conjugated anti-Fas, and APC-conjugated anti-B220 (both ThermoFisher Scientific) antibodies. For regulatory B cells, splenocytes were immunostained with Percp-Cy 5.5 conjugated anti-CD19 (ThermoFisher Scientific), APC-conjugated anti-CD25 (BioLegend), and PE-conjugated anti-Foxp3 (ThermoFisher Scientific) antibodies. Cells were fixed and permeabilized using the Foxp3/Transcription Factor Staining Buffer set (ThermoFisher Scientific) according to the manufacturer’s instructions. Events were collected using the FACS Calibur (BD Biosciences) or CytoFLEX (Beckman Coulter), and the data were analyzed using Flow Jo software, v. 7.6 (Treestar, Ashland, OR, USA).
Confocal microscopy
Spleen tissues were snap-frozen in liquid nitrogen and stored at −70°C. Tissue sections (5 μm thick) were fixed in acetone. To stain IL-17+ or phosphorylated (p)-STAT3+ in CD4+ cells, Alexa Fluor® 488-labeled anti-CD4 (BioLegend), PE-labeled anti-IL-17 (eBioscience, San Diego, CA), and PE-labeled anti-p-STAT3 (pTyr705) (BD Biosciences) antibodies were used. To stain regulatory T (Treg) cells, Alexa Fluor® 488-labeled anti-CD4, PE-labeled anti-Foxp3, and APC-labeled anti-CD25 (BioLegend) antibodies were used. Sections were analyzed using the LSM 510 Meta Confocal Microscopy System (Carl Zeiss, Oberkochen, Germany). Positive cells were counted visually at high magnification by four investigators.
Real-time polymerase chain reaction
Total RNA was extracted using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA), and cDNA was synthesized with the Dyne First-Strand cDNA Synthesis Kit (Dyne Bio, Seongnam, Korea) according to the manufacturer’s protocol. Gene expression was measured using the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, USA) with SYBR premix (Bioline USA Inc. Taunton, MA). The following primers were used: IL-1β, 5′GGATGAGGACATGAGCACATTC3′ (sense) and 5′GGAAGACAGGCTTGTGCTCTGA3′ (antisense); IL-6, 5′AACGATGATGCACTTGCAGAAA3′ (sense) and 5′TCTGAAGGACTCTGGCTTTGTC3′ (antisense); IL-17A, 5′-TTTAACTCCCTTGGCGCAAAA-3′ (sense) and 5′CTTTCCCTCCGCATTGACAC-3′ (antisense); and β-actin, 5′GTACGACCAGAGGCATACAGG3′ (sense) and 5′GATGACGATATCGCTGCGCTG3′ (antisense). mRNA levels were normalized to that of β-actin mRNA.
Statistical analysis
All statistical analyses were performed using Prism (v. 8 for Windows; GraphPad Software). P‑values were calculated by two-tailed paired t-test and two-way analysis of variance (grouped). P < 0.05 was considered indicative of statistical significance.