Deletion of the transcriptional regulator GntR affects apoptosis and autophagy in Brucella abortus-infected RAW 264.7 cells

doi:10.21203/rs.3.rs-91178/v1

Download PDF

Research

Deletion of the transcriptional regulator GntR affects apoptosis and autophagy in Brucella abortus-infected RAW 264.7 cells

https://doi.org/10.21203/rs.3.rs-91178/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Brucellosis is an important zoonotic disease caused by the pathogen Brucella. Regulating apoptosis and autophagy is the prerequisite for the intracellular survival of Brucella. GntR is an important transcriptional regulator of Brucella that can regulate the expression of many target genes, and then play a regulatory role in many cell processes, including regulation apoptosis and autophagy. Therefore, understanding the relationship between GntR and apoptosis and autophagy is crucial to comprehending the pathogenic mechanism of Brucella.

Methods: In the present study, we described the influence of GntR on apoptosis and autophagy after the infection of RAW 264.7 cells with Brucella. We constructed the GntR mutant strain (2308ΔGntR) of Brucella abortus 2308 (S2308). Following the infection of the RAW 264.7 cells with S2308 and 2308ΔGntR, apoptosis and autophagy were detected.

Results: Western blot analysis and flow cytometry analysis indicated that the apoptosis rate of the 2308ΔGntR-infected group was remarkably higher than that of the S2308-infected group. Confocal laser microscopy experiments indicated the presence of the P62 protein as punctate aggregates in the 2308ΔGntR group.

Conclusion: These results showed that 2308ΔGntR promoted apoptosis and inhibited autophagy in the RAW 264.7 cells during Brucella infection.

General Microbiology

B. abortus

Transcriptional regulator

2308ΔGntR

Apoptosis

Autophagy

Brucella spp. are intracellular parasites that cause the a worldwide zoonotic disease called brucellosis in animals and humans [1]. Brucellosis brings enormous economic burdens for developing countries [2]. Macrophages, dendritic cells, and embryonic trophoblasts are the target cells of Brucella [3, 4]. Furthermore, several other cells are susceptible to Brucella infection, and they include epithelial cells, human leukemic monocyte cells, osteoclasts, brain microvascular endothelial cells, and hepatic stellate cells [5–8]. Brucella can inhibit the maturation of phagosomes and prevent macrophages from forming phagolysosomes [9].

Apoptosis is a programmed cell death process, which is an essential physiological process that regulates tissue mass and architecture during normal tissue development [10]. Apoptosis is an active form of cell death characterized by various morphological and biochemical features [11]. Francisella tularensis could induce apoptosis in murine macrophages [12]. Brucella could also regulate apoptosis in macrophages [13]. Autophagy is a major protein degradation system. Autophagy is ubiquitous in eukaryotic cells, and it can preserve the homeostasis of the intracellular environment [8]. Autophagy is also a vital intracellular mechanism that prevents microbial infection [8, 14]. Autophagy participates in cellular functions as well [15]. Therefore, apoptosis and autophagy play a crucial role in regulating a series of important cell life activities.

Bcl-2 is an inhibitor of apoptosis. Increased levels of Bcl-2 expression in cells could prevent apoptosis [16]. Stimulating factors could inhibit Bcl-2 expression and induce apoptosis [17]. Bax can join to Bak at the outer membrane of the mitochondria, collapse the mitochondrial membrane potential, and consequently trigger the cell apoptosis [18]. The outbalance ratio of Bcl-2 and proapoptotic Bax plays a pivotal role in apoptosis [19]. The imbalance of Bcl-2 and proapoptotic Bax leads to apoptosis [19]. Caspase-3 and − 8 are the key regulators of the apoptotic response, and they interact with the calpain family, a group of cysteine proteases, in the course of diseases [20]. Caspase-3 and − 8 are activated in the death receptor pathway of apoptosis. Caspase-3 and − 8 overexpression could enhance apoptotic activity [21]. Autophagy is an intracellular bulk degradation system. P62 is an autophagic substrate [22]. When autophagy is enhanced, the P62 substrate is cleared [23]. However, when the inhibitor 3-methyladenineis used to inhibit autophagy, the P62 substrate accumulates [24]. P62 can be used as a marker of autophagy [25]. Microtubule-associated protein light chain 3 (LC3) is a mammalian homolog of yeast Atg8. Upon induction of autophagy, LC3 is conjugated to phosphatidylethanolamine [26]. Therefore, LC3 has been used as a specific marker to monitor autophagy.

GntR is a transcriptional regulator. It is involved in the regulation of biological functions in many pathogens, including stress response and nutrient uptake [27, 28]. GntR is an important virulence factor in Brucella [29]. In addition, GntR affects the expression of the virulence genes of Brucella and the secretion of inflammatory cytokines during infection [29, 30]. However, the intracellular functions of GntR, apoptosis, and autophagy remain unknown.

In the present study, the roles of GntR in apoptosis and autophagy were detected. This study aimed to determine the function of GntR in apoptosis and autophagy during Brucella infection and to provide new ideas and clues for further elucidating the mechanisms of the intracellular survival and pathogenesis of Brucella.

Bacterial strains and cell line

B. abortus 2308 strain (S2308) was obtained from the Center of Chinese Disease Prevention and Control (Beijing, China). The 2308ΔgntR mutant and 2308ΔgntR-C complementary strain were constructed and kept in our research laboratory [30]. All Brucella strains were cultured in tryptic soy agar (TSA) or broth (TSB) (Difco, MI, USA) at 37°C in 5% CO₂(v/v). The murine macrophage RAW 264.7 line was obtained from the Cell Resource Center (Beijing, China). RAW 264.7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco Life Technologies, Rockville, MD, USA) supplemented with 10% fetal bovine serum (FBS, Gibco Life Technologies, Rockville, MD, USA) at 37°C with 5% CO₂ (v/v). All experimental procedures were performed in Biosafety Level 3 Laboratory (BSL-3).

Flow cytometry

The apoptosis was detected by flow cytometry, as previously described but with several modifications [31]. Briefly, monolayers of RAW 264.7 macrophages of 1×10⁶ cells/well were cultured in six-well plates for 24 h at 37°C under 5% CO₂ and then infected with Brucella strains at a multiplicity of infection (MOI) of 100. Culture plates were centrifuged at 350 × g for 5 min at room temperature, and incubated at 37°C for 45 min. After washing twice with the medium without antibiotics, the infected cells were incubated for 60 min in the presence of 50 μg/mL gentamicin to kill the extracellular bacteria. Then, the cultures were placed in fresh DMEM containing 25 μg/mL gentamicin (defined as time zero) and incubated at 37°C. The control group comprised uninfected cells. At 24 h post-infection, the cells were washed with PBS, centrifuged at 900 × g for 5 min, and then resuspended with 500 μL of binding buffer mixed with 5 μL of fluorescein isothiocyanate (FITC)-labeled Annexin V (Annexin V-FITC) and 5 μL of propidium iodide (PI). After incubation in the dark at room temperature for 15 min, the cell samples were detected by flow cytometry (Life Technology, USA). All assays were performed thrice.

Confocal microscopy

The expression of P62 protein in the cell was observed by confocal microscopy, as previously described with several modifications [13]. Briefly, RAW 264.7 cells were infected with S2308 or 2308ΔGntR as described above. The control group comprised uninfected cells. At 24 h post-infection, the cells were fixed in 4% paraformaldehyde (PFA) for 10 min. Then, the cells were washed for 5 min with 1 mL of PBS containing 2 mg glycine. The cells were blocked with 1 mL of PBS containing 1% (v/v) bovine serum albumin (BSA) and 0.1% (v/v) Triton X-100 for 1 h. The cells were washed thrice with PBS and added with primary (rabbit anti-mouse P62 polyclonal antibody) antibody (Bioworld, Minneapolis, USA). Then, the cells were placed overnight at 4°C. Thereafter, the cells were washed thrice with PBS and added with secondary (green fluorescently tagged goat anti-rabbit IgG antibody) antibody (Bioworld, Minneapolis, USA) for 1 h at 37°C. Subsequently, the cells were washed thrice with PBS, and fluorescence was observed by confocal microscopy (ZEISS, Germany).

Macrophage infection and RNA extraction

Murine macrophage RAW 264.7 cells were used to detect the apoptosis and autophagy of S2308, 2308ΔgntR and 2308ΔgntR-C. The RAW 264.7 cells were infected with Brucella as described above. At 4, 8, 12 and 24 h post-infection, 1 mL TRIzol (Invitrogen, Carlsbad, CA, USA) was added to the cells for each well. RNA was also isolated from the uninfected cells as a negative control. Residual DNA in the samples was removed using DNase I (Promega, Madison, WI, USA). RNA concentration and purity were determined spectrophotometrically using an ND 1000 spectrophotometer (Thermo Scientific, Wilmington, USA). The total RNA from the Brucella-infected cells was extracted as previously described [32, 33]. All assays were performed in triplicate and repeated at least thrice.

Quantitative real time-PCR (qRT-PCR)

QRT-PCR was used to detect the expression levels of apoptosis-associated genes (caspase-3, caspase-8, Bax, and Bcl-2) and autophagy-associated genes (LC3-I, LC3-II, and p62), as previously published procedures with several modifications [34]. The cDNA was generated from the total RNA by using a random hexamer primer and the SuperScript II reverse transcriptase kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The apoptosis- and autophagy-associated genes were selected. The primers used to amplify these genes are listed in Table 1. Samples were run in triplicate and amplified in a 20 μL reaction containing 2 × SYBR Premix Ex Taq II (Takara, Japan), 100 nM forward and reverse primers, and 1 μL of cDNA target. The mix was incubated for 5 min at 95°C, and then 40 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 30 s were performed on a Roche LightCycler 480 II system (Roche, Basel, Switzerland). The relative transcriptional levels were determined by the methods of 2^-^ΔΔCt, as described previously [35]. The expression of β-actin was used as a reference gene. All assays were performed in triplicate and repeated at least thrice.

Western blot (WB) analysis

To determine the expression levels of caspase-3 and P62 in the RAW 264.7 cells, we analyzed caspase-3 and P62 protein lysates by WB as previously described with several modifications [13, 36]. Briefly, the RAW 264.7 cells were infected with S2308 and 2308ΔGntR following the steps as described above. The control group comprised uninfected cells. At 24 h post-infection, the cells were lysed in ice-cold RIPA lysis buffer (Solarbio Science and Technology, Beijing, China) for 20 min and centrifuged at 13,400 × g for 20 min at 4°C. Protein lysates (50 μg total protein/lane) were separated by 12% SDS-PAGE and electrotransferred to a nitrocellulose (NC) membrane by using a semi-dry trans-blot cell (Bio-Rad, Hercules, CA, USA) at 200 Ma for 1 h in transfer buffer (100 Mm Tris-HCl, 150 Mm NaCl, 0.05 % Tween 20, Ph 7.2). Membranes were incubated in blocking solution (5% nonfat milk in Tris-buffered saline Tween-20 [TBST]) for 1 h at room temperature. Membranes were washed thrice with the TBST buffer. Subsequently, the membranes were incubated with primary (rabbit anti-mouse caspase-3 and P62 polyclonal antibody) antibodies (Bioworld, Minneapolis, USA) at 37°C for 1 h. The membrane was washed with TBST thrice and incubated with secondary (goat anti-rabbit horseradish peroxidase-labeled IgG antibody) antibodies (SBA, Birmingham, Al, USA) for 1 h in 5% milk/TBST at 37°C. After three washes, bound conjugate was visualized using an enhanced HRP-DAB substrate color kit (Tiangen Biotech Co. Ltd., Beijing, China). Western blott analysis was repeated thrice.

To determine the expression levels of LC3-II/I in the RAW 264.7 cells, we analyzed the LC3 protein lysates by WB, as previously described with several modifications [8, 37]. The RAW 264.7 cells were infected with S2308, 2308ΔGntR of 2308ΔGntR-C as described previously. At 24h post-infection, the samples (50 μg total protein/lane) were loaded onto SDS-PAGE gels in this experiment. The primary (rabbit anti-mouse LC3 antibody) antibody (Bioworld, Minneapolis, USA) and secondary (goat anti-rabbit horseradish peroxidase-labeled IgG antibody) antibody (SBA, Birmingham, Al, USA) were purchased from Cell Signaling Technology and used at dilutions of 1:1,000 and 1:2,000, respectively. The bound conjugate was visualized using an enhanced HRP-DAB substrate color kit (Tiangen Biotech Co. Ltd., Beijing, China). Western blot analysis was repeated thrice.

Statistical analysis

QRT-PCR data were analyzed using the Roche LightCycler480 1.5 software (Roche, Basel, Switzerland), and the relative quantification was obtained using the 2^-^ΔΔCt method. The expression levels of the apoptosis- and autophagy-related genes were expressed as mean ± standard deviation (SD). Statistical analysis was performed with Student’s unpaired t-test. The differences between groups were analyzed by analysis of variance (ANOVA) followed by Tukey’s honestly significant difference post-test by comparing all the groups. The results were analyzed by the Fisher test and expressed in percentages. SPSS 19.0 software (SPSS, Inc., Chicago, IL, USA) was used to analyze the differences between groups. P values of < 0.05 were considered statistically significant.

Apoptosis in Brucella-infected cells

At 24 h after the S2308 and 2308ΔGntR infection of the RAW 264.7 cells, the percentages of apoptotic cells were detected by flow cytometry. The percentages of apoptotic cells of the S2308-infected group and 2308ΔGntR-infected group were 3.30% ± 0.50% and 16.80% ± 1.30%, respectively (Fig. 1). The results indicated that the percentages of apoptotic cells of the S2308-infected group were significantly lower than those of the 2308ΔGntR-infected group (P < 0.05). Hence, S2308 can inhibit apoptosis in RAW 264.7 cells.

GntR affects the expression levels of apoptosis-associated genes in Brucella-infected cells

To test the effect of GntR on apoptosis-associated genes, we analyzed the expression levels of caspase-3, caspase-8, Bax, and Bcl-2 in Brucella-infected cells. Following 2308ΔGntR infection, the relative expression levels of caspase-3, caspase-8, and Bax in the RAW 264.7 cells were significantly higher than those in the S2308-infected cells (P < 0.01, Fig. 2A, 2B, and 2C). The relative expression level of Bcl-2 in the 2308ΔGntR-infected cells was significantly lower than that in the S2308-infected cells (P < 0.05, Fig. 2D). The ratio of Bax/Bcl-2 in the 2308ΔGntR-infected cells was significantly higher than that in the S2308-infected cells (Fig. 2E). These results indicated that the 2308ΔGntR mutant affected the expression levels of the apoptosis-associated genes in the RAW 264.7 cells.

GntR affects the expression level of caspase-3 protein in Brucella-infected cells

We used WB to analyze the expression levels of caspase-3 protein. The results showed that the expression levels of caspase-3 protein in the 2308ΔGntR-infected cells were significantly higher than those in the S2308-infected cells (P < 0.01, Fig. 2F). Hence, the 2308ΔGntR mutant affected the expression levels of caspase-3 protein in the RAW 264.7 cells.

Localization expression levels of P62 protein in Brucella-infected cells

To further observe the expression of P62 protein in the cell, we conducted an experiment using a confocal laser scanning microscope. The focal points of P62 protein at 24 h post infection were observed by confocal microscopy. P62 showed punctate aggregates (Fig. 3A). P62 protein was dispersed in the control cells while the experimental groups showed punctate aggregates (Fig 3A). After S2308 and 2308ΔGntR infection, the P62 punctate aggregates became increasingly significant (Fig 3A), indicating that cell autophagy was inhibited after the infection of Brucella. Especially under 2308ΔGntR infection, the intracellular P62 punctate aggregates (Fig 3A) increased, indicating that autophagy was inhibited. Hence, 2308ΔGntR inhibited autophagy in the RAW 264.7 cells.

2308ΔGntR affects the expression levels of autophagy-associated genes

The relative expression levels of p62, LC3-II, and LC3-I were computed using the 2^-ΔΔCt method. Following the infection of the RAW 264.7 cells with S2308 and 2308ΔGntR, the relative expression levels of p62 and LC3-I in the 2308ΔGntR-infected cells were slightly higher than those in the S2308-infected cells (Fig. 4A and 4B). No significant difference was observed between the 2308ΔGntR- and S2308-infected groups (P > 0.05). The relative expression levels of LC3-II in the 2308ΔGntR-infected cells were significantly lower than those in S2308-infected cells (P < 0.01, Fig. 4C). The ratio of LC3-II/LC3-I in the 2308ΔGntR-infected cells was significantly lower than that in the S2308-infected cells (P < 0.01, Fig. 4D). Hence, the 2308ΔGntR mutant affected the expression levels of the autophagy-associated genes in the RAW 264.7 cells.

In the present study, we evaluated whether 2308ΔGntR could inhibit the expression of LC3-II. The ratio of LC3-II/I was decreased in the 2308ΔGntR-infected cells (Fig. 4E and 4F). Furthermore, the complemented strain 2308ΔGntR-C promoted autophagy (Fig. 4E and 4F). Collectively, these results indicated that 2308ΔGntR affected autophagy in the RAW 264.7 cells.

GntR affects expression levels of P62 protein in Brucella-infected cells

We used WB to analyze the expression levels of P62 protein. The results showed that the P62 protein expression levels in the 2308ΔGntR-infected cells were significantly higher than those in the S2308-infected cells (P < 0.05, Fig. 3B and 3C). Hence, 2308ΔGntR affected the expression levels of P62 protein in the RAW 264.7 cells.

Brucellosis is a worldwide zoonosis, which remains prominent in many countries. The transcriptional regulatory system is one of the main virulence systems of Brucella. The transcriptional regulator GntR of Brucella plays a key role in the pathogenic process of Brucella [29]. GntR modulates various biological processes, including cytotoxicity [30], secretion of inflammatory cytokines [30], antibiotic production [38], antibiotic resistance [39], and plasmid transfer [40]. Transcriptional regulator GntR regulates the expression levels of many genes in Brucella [41]. However, the cellular functions of GntR are still unknown. In the present study, we demonstrated that the transcriptional regulator GntR participated in apoptosis and autophagy during Brucella infection.

Apoptosis plays an important role in the pathogenicity of pathogens. Brucella may inhibit the apoptosis of host cells to reproduce in cells. However, the specific mechanism remains unclear. In this study, we used 2308ΔGntR mutant and parental strain S2308 to infect RAW 264.7 cells. Our results were the same as those of previous studies [13, 34]. The percentages of apoptotic cells of the 2308ΔGntR-infected cells were significantly higher than those of the S2308-infected ones. Wild-type B. abortus 2308 is a smooth Brucella, which inhibits apoptosis for its long-term survival in host cells. We confirmed that the virulence of 2308ΔGntR was lower than that of the parental strain [29]. The survival time of the 2308ΔGntR mutant strain in the host cells was short [29]. These results may be related to apoptosis.

In this study, the ratio of Bax/Bcl-2 in the 2308ΔGntR-infected group was significantly higher than that in the S2308-infected group. In addition, the mRNA expression levels of the apoptosis-related genes caspase-3 and caspase-8 were up-regulated in 2308ΔGntR. Hence, 2308ΔGntR promoted apoptosis in the RAW 264.7 cells. The activation of caspase-3 indicated apoptosis [42]. Our results suggested that 2308ΔGntR enhanced caspase-3 protein expression. Moreover, the results indicated that Brucella transcriptional regulator GntR was involved in apoptosis and that the 2308ΔGntR mutant promoted apoptosis in the RAW 264.7 cells.

Autophagy is a cellular pathway that plays an important in development and survival. Autophagy has an important significance in Brucella intracellular trafficking. In epithelial cells, B. abortus is transited through autophagosomes [43]. Thus, the regulation of autophagy may be a crucial target of B. abortus. We detected the localization expression levels of P62 protein by confocal laser scanning microscopy. We found that the P62 punctate aggregates in the 2308ΔGntR-infected cells became more significant than those in the S2308-infected cells. The lack of P62 degradation indicates that 2308ΔGntR inhibits autophagy in RAW 264.7 cells.

Autophagy is related to microbial infection [44]. LC3 is a major marker of autophagy and a Brucella-induced autophagic response is related to LC3 [45]. After 2308ΔGntR infected the cells in this work, the ratio of LC3-II/LC3-I was decreased. These results indicated that 2308ΔGntR inhibited autophagy in the RAW 264.7 cells. Furthermore, P62 protein expression levels increased after 2308ΔGntR infected the cells. In sum, these results indicated that the Brucella transcriptional regulator GntR was involved in autophagy. They also confirmed that the 2308ΔGntR mutant inhibited autophagy in the RAW 264.7 cells.

In sum, we found that the mRNA relative expression levels of caspase-3, caspase-8, Bax, p62, and LC3-I and the ratio of Bax/Bcl-2 increased more significantly in 2308ΔGntR than in S2308. Moreover, the mRNA relative expression levels of Bcl-2 and LC3-II and the ratio of LC3-II/LC3-I decreased more significantly in 2308ΔGntR than in S2308. WB, flow cytometry, and confocal laser microscopy indicated that 2308ΔGntR promoted apoptosis and inhibited autophagy in the RAW 264.7 cells during Brucella infection. These results indicated that GntR was involved in the apoptosis and autophagy in the Brucella-infected cells. These results provide new ideas and clues for further elucidating the molecular mechanism of Brucella pathogenicity.

Acknowledgements

This work was supported by grants from the National key Research and Development Program of China (2017YFD0500304), the National Natural Science Foundation of China (31602080), the Key Scientific Research Project of Colleges and Universities in Henan Province (21A230015), and the National Innovation Training Program for College Students of China (202010483007).

Author’s contributions

ZL and HZ designed the experiments. ZL, SW, LX, JZ, JH and HZ performed the experiments and analyzed the data. ZL and HZ contributed reagents/materials/analysis tools. ZL, SW, HZ and JZ wrote and revised the paper.

Availability of data and materials

All the data generated or analyzed during this study are included in the manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors have agreed to submit this manuscript.

Competing interests

The authors declare that no competing interest exists in this study.

Author details

¹ College of Biology and Food, Shangqiu Normal University, Shangqiu 476000, Henan, China

² College of Life Sciences, Henan Normal University, Xinxiang 453007, Henan, China

³ College of Animal Science and Technology, Shihezi University, Shihezi 832003, Xinjiang, China

Cama BAV, Ceccarelli M, Venanzi Rullo E, Ferraiolo F, Paolucci IA, Maranto D, Mondello P, Lo Presti Costantino MR, Marano F, D'Andrea G, et al. Outbreak of Brucella melitensis infection in Eastern Sicily: risk factors, clinical characteristics and complication rate. New Microbiol. 2019;42(1):43–8.
Lacerda TLS, Cardoso PG, Augusto de Almeida L, Camargo ILBdC, Afonso DAF, Trant CC, Macedo GC, Campos E, Cravero SL, Salcedo SP. Inactivation of formyltransferase (wbkC) gene generates a Brucella abortus rough strain that is attenuated in macrophages and in mice. Vaccine. 2010;28(34):5627–34.
Salcedo S, Marchesini M, Lelouard H, Fugier E, Jolly G, Balor S, Muller A, Lapaque N, Demaria O, Alexopoulou L, et al. Brucella control of dendritic cell maturation is dependent on the TIR-containing protein Btp1. PLoS Pathog. 2008;4(2):e21.
Meador VP, Deyoe BL. Intracellular localization of Brucella abortus in bovine placenta. Vet Pathol. 1989;26(6):513–5.
Im YB, Shim S, Soh SH, Kim S, Yoo HS. Cytokines production and toll-like receptors expression in human leukemic monocyte cells, THP-1, stimulated with Brucella abortus cellular antigens. Microb Pathog. 2018;122:7–12.
Gutierrez-Jimenez C, Hysenaj L, Alfaro-Alarcon A, Mora-Cartin R, Arce-Gorvel V, Moreno E, Gorvel JP, Barquero-Calvo E. Persistence of Brucella abortus in the bone marrow of infected mice. J Immunol Res. 2018;2018:5370414.
Miraglia MC, Rodriguez AM, Barrionuevo P, Rodriguez J, Kim KS, Dennis VA, Delpino MV, Giambartolomei GH. Brucella abortus traverses brain microvascular endothelial cells using infected monocytes as a trojan horse. Front Cell Infect Microbiol. 2018;8:200.
Arriola Benitez PC, Pesce Viglietti AI, Herrmann CK, Dennis VA, Comerci DJ, Giambartolomei GH, Delpino MV. Brucella abortus promotes a fbrotic phenotype in hepatic stellate cells, with concomitant activation of the autophagy pathway. Infect Immun. 2018;86(1):1–12.
Eze MO, Yuan L, Crawford RM, Paranavitana CM, Hadfield TL, Bhattacharjee AK, Warren RL, Hoover DL. Effects of opsonization and gamma interferon on growth of Brucella melitensis 16M in mouse peritoneal macrophages in vitro. Infect Immun. 2000;68(1):257–63.
Ellis RE, Yuan JY, Horvitz HR. Mechanisms and functions of cell death. Annu Rev Cell Biol. 1991;7:663–98.
Arends MJ, Wyllie AH. Apoptosis: mechanisms and roles in pathology. Int Rev Exp Pathol. 1991;32:223–54.
Hrstka R, Stulik J, Vojtesek B. The role of MAPK signal pathways during Francisella tularensis LVS infection-induced apoptosis in murine macrophages. Microbes Infect. 2005;7(4):619–25.
Li T, Xu Y, Liu L, Huang M, Wang Z, Tong Z, Zhang H, Guo F, Chen C. Brucella melitensis 16M regulates the effect of AIR domain on inflammatory factors, autophagy, and apoptosis in mouse macrophage through the ROS signaling pathway. PLoS One. 2016;11(12):e0167486.
Yin XM, Ding WX, Gao W. Autophagy in the liver. Hepatology. 2008;47(5):1773–85.
Wang Y, Qin ZH. Coordination of autophagy with other cellular activities. Acta Pharmacol Sin. 2013;34(5):585–94.
Florou D, Patsis C, Ardavanis A, Scorilas A. Effect of doxorubicin, oxaliplatin, and methotrexate administration on the transcriptional activity of BCL-2 family gene members in stomach cancer cells. Cancer Biol Ther. 2013;14(7):587–96.
Micheau O, Tschopp J. Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell. 2003;114(2):181–90.
Korbakis D, Scorilas A. Quantitative expression analysis of the apoptosis-related genes BCL2, BAX and BCL2L12 in gastric adenocarcinoma cells following treatment with the anticancer drugs cisplatin, etoposide and taxol. Tumour Biol. 2012;33(3):865–75.
Knofler M, Pollheimer J. IFPA Award in Placentology lecture: molecular regulation of human trophoblast invasion. Placenta. 2012;33:55–62.
Pu X, Storr SJ, Zhang Y, Rakha EA, Green AR, Ellis IO, Martin SG. Caspase-3 and caspase-8 expression in breast cancer: caspase-3 is associated with survival. Apoptosis. 2017;22(3):357–68.
Vakkala M, Pääkkö P, Soini Y. Expression of caspases 3, 6 and 8 is increased in parallel with apoptosis and histological aggressiveness of the breast lesion. Br J Cancer. 1999;81(4):592–9.
Ma Y, Galluzzi L, Zitvogel L, Kroemer G. Autophagy and cellular immune responses. Immunity. 2013;39(2):211–27.
Ponpuak M, Davis AS, Roberts EA, Delgado MA, Dinkins C, Zhao Z, Virgin HWt, Kyei GB, Johansen T, Vergne I, Deretic V. Delivery of cytosolic components by autophagic adaptor protein p62 endows autophagosomes with unique antimicrobial properties. Immunity. 2010;32(3):329–41.
Song ZH, Yu HY, Wang P, Mao GK, Liu WX, Li MN, Wang HN, Shang YL, Liu C, Xu ZL, et al. Germ cell-specific Atg7 knockout results in primary ovarian insufficiency in female mice. Cell Death Dis. 2015;6:e1589.
Zhao Y, Li Y, Gao Y, Yuan M, Manthari R, Wang J, Wang J. TGF-β1 acts as mediator in fluoride-induced autophagy in the mouse osteoblast cells. Food Chem Toxicol. 2018;115:26–33.
Mehrpour M, Esclatine A, Beau I, Codogno P. Autophagy in health and disease. 1. Regulation and significance of autophagy: an overview. Am J Physiol Cell Physiol. 2010;298(4):C776–85.
Shafeeq S, Kuipers OP, Kloosterman TG. Cellobiose-mediated gene expression in Streptococcus pneumoniae: a repressor function of the novel GntR-type regulator BguR. PLoS One. 2013;8(2):e57586.
SQ A, GT L, HZ S, RF L, YQ H, BL J, DJ T, JL T. Systematic mutagenesis of all predicted gntR genes in Xanthomonas campestris pv. campestris reveals a GntR family transcriptional regulator controlling hypersensitive response and virulence. Mol Plant Microbe In. 2011;24(9):1027–39.
Li Z, Zhang J, Xi L, Yang G, Wang S, Zhang X, Zhang J, Zhang H. Deletion of the transcriptional regulator GntR down regulated the expression of genes related to virulence and conferred protection against wild-type Brucella challenge in BALB/c mice. Mol Immunol. 2017;92:99–105.
Li Z, Wang S, Zhang H, Zhang J, Xi L, Zhang J, Chen C. Transcriptional regulator GntR of Brucella abortus regulates cytotoxicity, induces the secretion of inflammatory cytokines and affects expression of the type IV secretion system and quorum sensing system in macrophages. World J Microbiol Biotechnol. 2017;33(3):60.
Ma Q, Liu A, Ma X, Wang Y, Hou Y, Wang Z. Brucella outer membrane protein Omp25 induces microglial cells in vitro to secrete inflammatory cytokines and inhibit apoptosis. Int J Clin Exp Med. 2015;8(10):17530–5.
Lei S, Zhong Z, Ke Y, Yang M, Xu X, Ren H, An C, Yuan J, Yu J, Xu J, et al. Deletion of the small RNA chaperone protein Hfq down regulates genes related to virulence and confers protection against wild-type Brucella challenge in mice. Front Microbiol. 2016;6:1570.
Cui M, Wang T, Xu J, Ke Y, Du X, Yuan X, Wang Z, Gong C, Zhuang Y, Lei S, et al. Impact of Hfq on global gene expression and intracellular survival in Brucella melitensis. PLoS One. 2013;8(8):e71933.
Zhang J, Li M, Li Z, Shi J, Zhang Y, Deng X, Liu L, Wang Z, Qi Y, Zhang H. Deletion of the type IV secretion system effector VceA promotes autophagy and inhibits apoptosis in Brucella-infected human trophoblast cells. Curr Microbiol. 2019;76(4):510–9.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(– ∆∆CT) method. Methods. 2001;25(4):402–8.
Zhang J, Zhang Y, Li Z, Liu J, Shao X, Wu C, Wang Y, Wang K, Li T, Liu L, et al. Outer membrane protein 25 of Brucella activates mitogen-activated protein kinase signal pathway in human trophoblast cells. Front Vet Sci. 2017;4:197.
Wang Y, Li Y, Li H, Song H, Zhai N, Lou L, Wang F, Zhang K, Bao W, Jin X, et al. Brucella dysregulates monocytes and inhibits macrophage polarization through LC3-dependent autophagy. Front Immunol. 2017;8:691.
Hoskisson P, Rigali S, Fowler K, Findlay K, Buttner M. DevA, a GntR-like transcriptional regulator required for development in Streptomyces coelicolor. J Bacteriol. 2006;188(14):5014–23.
Truong-Bolduc QC, Hooper DC. The transcriptional regulators NorG and MgrA modulate resistance to both quinolones and beta-lactams in Staphylococcus aureus. J Bacteriol. 2007;189(8):2996–3005.
Reuther J, Wohlleben W, Muth G. Modular architecture of the conjugative plasmid pSVH1 from Streptomyces venezuelae. Plasmid. 2006;55(3):201–9.
Li Z, Li M, Zhang H, Wang S, Xi L, Zhang X, Yi J, Zhang H. ChIP-seq analysis of Brucella reveals transcriptional regulation of GntR. J Basic Microbiol. 2020;60(2):149–57.
Shi Y. Mechanisms of caspase activation and inhibition during apoptosis. Mol Cell. 2002;9(3):459–70.
Pizarro-Cerda J, Meresse S, Parton RG, van der Goot G, Sola-Landa A, Lopez-Goni I, Moreno E, Gorvel JP. Brucella abortus transits through the autophagic pathway and replicates in the endoplasmic reticulum of nonprofessional phagocytes. Infect Immun. 1998;66(12):5711–24.
Yuan K, Huang C, Fox J, Laturnus D, Carlson E, Zhang B, Yin Q, Gao H, Wu M. Autophagy plays an essential role in the clearance of Pseudomonas aeruginosa by alveolar macrophages. J Cell Sci. 2012;125(2):507–15.
Brumell J. Brucella "hitches a ride" with autophagy. Cell Host Microbe. 2012;11(1):2–4.

Table 1 Primers used in this study.

Primer		5’-3’ sequence
Caspase-3-RT-F	Forward	TTCCACGCAAAGAAACAGAT
Caspase-3-RT-R	Reverse	GGAGGACCGTCAGATTAGAT
Caspase-8-RT-F	Forward	TGCCGTGGAGAGAAACAA
Caspase-8-RT-R	Reverse	ATGAAAAGTGAGCCCCTG
Bcl-2-RT-F	Forward	GACTTCTCTCGTCGCTACCG
Bcl-2-RT-R	Reverse	ACAATCCTCCCCCAGTTCAC
Bax-RT-F	Forward	GCCTTTTTGCTACAGGGTTT
Bax-RT-R	Reverse	TGCTGTCCAGTTCATCTCCA
P62-RT-F	Forward	TCTTTGGACCCCCGTGTGA
P62-RT-R	Reverse	TCTCACAGATACCCCACGACCA
LC3-I-RT-F	Forward	CCGACCGCTGTAAGGAGG
LC3-I-RT-R	Reverse	GCCGGATGATCTTGACCAAC
LC3-II-RT-F	Forward	GAACAAAGAGTGGAAGATG
LC3-II-RT-R	Reverse	GCCGTCTGATTATCTTGA
β-actin-RT-F	Forward	AGCCTTCCTTCTTGGGTATGG
β-actin-RT-R	Reverse	CCTGTCAGCAATGCCTGGGTA

Download PDF

Version 1

posted

You are reading this latest preprint version

Deletion of the transcriptional regulator GntR affects apoptosis and autophagy in Brucella abortus-infected RAW 264.7 cells

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Status:

Version 1