Combined effects of intrinsic host gene (TRAPPC9) and extrinsic nutrient (folate) on resistance against S. aureus induced bovine mastitis

doi:10.21203/rs.3.rs-91975/v1

Download PDF

Research

Combined effects of intrinsic host gene (TRAPPC9) and extrinsic nutrient (folate) on resistance against S. aureus induced bovine mastitis

https://doi.org/10.21203/rs.3.rs-91975/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Drug-resistance and immunological escape of Staphylococcus aureus and its “superbug”, methicillin-resistant S. aureus (MRSA), have become one of main causes of bacterial infection in both human and animals. In dairy cattle, elimination of bovine mastitis induced by S. aureus is of importance because S. aureus-infected cows normally are culled passively.

Methods: Here, we investigated the beneficial effects of bovine trafficking protein particle complex 9 (TRAPPC9) gene and folic acid supplementation in the control of mastitis induced by S. aureus or MRSA by a series of in vivo and in vitro experiments.

Results: The data showed that the genetic mutations and DNA methylation of TRAPPC9 were highly linked with the mastitis resistance of dairy cows. Additionally, knockdown of bovine TRAPPC9 was significantly involved in the mRNA expression levels of interleukin’s genes (increased IL-1β and IL-6), and down-regulated the protein level of NF-κB-P65 in the mastitis cell model induced by MRSA. Meanwhile, dose-dependent folic acid addition can inhibit the invasion of MRSA into Mac-T cells and improve TRAPPC9 expression in dairy cows.

Conclusions: Altogether, our data suggest that an appropriate dose of folic acid can significantly reduce the inflammation caused by MRSA partially through TRAPPC9 mediated NF-κB pathway. These findings provide new insights to control the drug-resistant pathogens and to restrict the overuse of antibiotics through combined effects of the intrinsic host gene and extrinsic nutrient.

Laboratory Diagnostics

Animal Science

Methicillin-resistant Staphylococcus aureus

mastitis

TRAPPC9

folic acid

NF-κB pathway

Hosts possess innate and adaptive immune systems that are tailored to counter pathogen challenges effectively. Under general bacterial infections, the nuclear factor-κB (NF-κB) pathway can be activated in response to stimuli [1–3]. However, Staphylococcus aureus, one of the first well-characterized microbes, can modulate or avoid host immune systems and acquire strong resistance to most antibiotics and drugs [4]. Moreover, the “superbug” strain, methicillin-resistant S. aureus (MRSA) is still the common causes of infections and mortality in hospitals [5, 6]. Aside from hospital-associated MRSA and community-acquired MRSA, livestock-associated MRSA infection has been rising in frequency since the 1970s [7–10]. The earliest isolation of livestock-associated MRSA strain was reported in lactation cows with mastitis [7]. Since S. aureus- or MRSA-infected cows are associated with the increased use of antimicrobials and rising drug resistance, the cows infected by these bacteria are normally culled as soon as they were detected. Therefore, developing useful new methods to control and reduce the infection of S. aureus and MRSA in dairy farms is imperative.

Bovine milk is the most popular animal food by humans of all ages. Thus, improving bovine udder health is critical to protect public health. Our previous work observed that the bovine trafficking protein particle complex 9 (TRAPPC9) gene is significantly associated with milk somatic cell score (SCS, [11]), a usual indicator of the degree of bovine mastitis. The nuclear factor NF-kappaB (NF-κB) pathway has long been proved as a prototypical proinflammatory signaling pathway. Considering that TRAPPC9 plays an important role in the NF-κB signaling pathway and membrane traffic of Golgi [12, 13], our previous study proved that it can serve as a candidate biomarker for S. aureus and MRSA infections in dairy cows and bovine mammary epithelial cell lines (Mac-T) [14, 15]. Aside from providing hosts with genetic resistance to pathogens, folic acid (a synthetic form of folate), a methyl donor, also alleviates inflammation through reducing the expression of pro-inflammatory factors [16–18]. We thus hypothesized that host TRAPPC9 and supplementation of folic acid improve host defense against S. aureus or MRSA infection in dairy cattle and bovine mammary epithelial cells.

In the present study, we designed a series of experiments to investigate the effects of genetic mutations, DNA methylation, and expression of the bovine TRAPPC9 gene on mastitis progress in a new dairy population and to determine the roles of this gene in the defense against S. aureus and MRSA infections in bovine Mac-T cells. We also systematically assessed the influences of folic acid supplementation on the incidence of mastitis in vivo, the inflammation progress induced by S. aureus and MRSA and the invasion abilities of S. aureus and MRSA into Mac-T cells. These data provide new insights into the protection of food animals and public health from the inflammatory disease induced by zoonotic bacteria.

2.1. Samples

2.1.1. Cows

A total of 514 Chinese Holstein cows used for the association study were randomly collected from six farms in the North of China (Figure 1). The parities of the cows ranged from 1 to 4 and were milked three times a day, the lactation days were among 30-400 days, and SCS varied from 0 to 10. All the dairy cows were fed on the same lactation diet according to the recommendations of lactating Chinese Holsteins.

In addition, 123 healthy perinatal Holstein cows (from a single dairy farm in Hebei Province, China) were randomly selected for the folic acid supplementation experiment. The parities of the cows were 1 or 2, the estimated body weight of each cow was shown in S1 Table, and the expected date of calving of the cows were within 10 days. Accordingly, they were grouped into three experimental groups (groups A, B, and C) supplemented with different doses of folic acid (Group A: 0 mg/day; Group B: body weight (kg) × 0.24 mg/kg/day; Group C: body weight (kg) × 0.48 mg/kg/day). In this study, folic acid was coated by Oriental Kingherb Company (Beijing, China). The coated folic acid was fed to groups B and C for 14 days before calving and 7 days after calving.

Milk samples were aseptically collected and immediately sent to the official Dairy Center of China (Beijing, China) for the detection of somatic cell count (SCC). Peripheral blood samples were collected from the cows’ tail vein by caudal venipuncture and divided into two tubes. One tube containing coagulant and the other containing potassium ethylenediaminetetraacetic acid (EDTA K3E 15%, 0.12mL; Becton, Dickinson and Company) were used for DNA and RNA extraction respectively. Sera were isolated from the peripheral blood and sent to Beijing Huaying Biotechnology Research Institute for cytokine (NIBP, NF-κB, TNF-α, IL17, IL4, IFN- γ, IL6, and IL10) tests detected by radioimmune outfit, which was performed by R-911-automatic radioimmunoassay count instrument.

2.1.2. Bacterial strains

S. aureus (strain 90-1) was originally isolated from a subclinical case of bovine mastitis by our labs in Beijing, China. MRSA (strain W18), provided by Prof. Xin Wang (Northwest A&F University, Yangling, Shanxi, China), was isolated from a clinical case of bovine mastitis. S.aureus and MRSA (50 μL) were inoculated into 5 mL of tryptone soya broth (Beijing Land Bridged Technology Ltd.), and allowed to grow overnight for 24 h at 37 °C, 200 rpm/min. The concentrations of S. aureus and MRSA were determined by serial dilution and standard plate counting. In Brief, S. aureus and MRSA were diluted six gradients successively with DPBS. Then, 100 μL of the diluent was transferred into plate count agar (PCA, Beijing Land Bridged Technology Ltd) and spread with a glass spreader. Subsequently, the agar plates were incubated at 37 °C for 18–24 h. After the PCA plate culture of the S. aureus and MRSA diluents, the numbers of S. aureus and MRSA colonies were counted. Each diluent PCA was conducted in triplicate. Finally, the bacteria were diluted in DMEM to obtain 1×10⁸ CFU/mL.

2.1.3. Cell culture

The bovine mammary epithelial cell line (Mac-T) was provided by Zhejiang University. Mac-T cells were re-suspended in the warm growth medium of DMEM with Glutamax (Gibco) supplemented with 10% fetal bovine serum and 100 U/mL penicillin and streptomycin (100 mg/mL, Gibco). Mac-T cells were seeded in a 25 cm² tissue culture flask at 37 °C in a 5% CO₂ humidified incubator, and the medium was changed once every 24 h. After 48 h, cells at 85% confluence were split by adding 1 mL of 0.25% trypsin/EDTA (Gibco) after washing with 2 mL of DPBS (Gibco). Mac-T cells were cultured up to a maximum of three passages to reduce the risk of aberrant expression caused by extended culturing. These cells were centrifuged in 5 mL of DMEM growth medium for 5 min at 1000 rpm/min, seeded at 5×10⁵ cells in a 6-well cell culture plate (Corning), and then allowed to grow in a growth medium at 37 °C in 5% CO₂ humidified incubator.

2.2. Total RNA extraction, reverse transcription and quantitative Real-Time PCR

Buffy coat of fresh blood and collected Mac-T cells were placed directly in 1 mL of Trizol reagent (Invitrogen), and total RNA was extracted following the manufacturer’s instructions. The mRNA was converted to cDNA with the PrimeScript^TM RT reagent kit (Takara). RT-qPCR was performed using the SYBR Green I Master kit (Roche Diagnostics GmbH) on the LightCycler® 480 II (Roche Diagnostics Ltd) following the manufacturer’s instructions. RT-qPCR reaction was performed using the following program: 95 °C for 10 min, followed by 45 cycles at 95 °C for 10 s, 60 °C for 10 s and 72 °C for 10 s. At the end of each run, a dissociation melt curve was determined. All melt curves showed a single peak and were consistent with the presence of a single amplicon. Bovine GAPDH was used as the house-keeping gene to normalize the target genes’ expression levels. Each cDNA sample was analyzed in duplicate. The relative mRNA expression levels of the target genes were calculated using the 2^-^△△^Ctmethod. Primer sequences are as follows (obtained from Tsingke): TRAPPC9-forward: CTGCTCCGCTCGGTGAATGAC, TRAPPC9-Reverse: GCTTTACCGCCAGTTCCACCA; IL-1β-Forward: CTGTCGGACCCATATGAGC, IL-1β-Reverse: GCTCATGGAGAATATCACTTGTTG; IL-6-Forward: TCCTGAGAAACCTTGAGAAT, IL-6-Reverse: ATAAGTTGTGTGCCCAGTGG; IL-8-Forward: TGAAGCTGCAGTTCTGTCAAG, IL-8-Reverse: TTCTGCACCCACTTTTCCTTGG; GAPDH-Forward: GGTGCTGAGTATGTGGTGGA, GAPDH-Reverse: GGCATTGCTGACAATCTTGA.

2.3. DNA extraction and genotyping of the bovine samples

The genomic DNA was extracted from the whole blood of the dairy cows using the DP-318 Blood DNA kit (Tiangen Biotech Co) following the manufacturer’s instructions. DNA was assessed with the NanoDrop^TM ND-2000c Spectrophotometer (Thermo Scientific) and by 1% agarose gel electrophoresis.

The genotyping of the bovine samples consists of two steps. First, SNPs identification was conducted by DNA pooling and sequencing. Briefly, a total of 30 samples were randomly selected from 514 cows to construct a DNA pool with an equal DNA concentration of 50 ng/μL for each sample. PCRs were performed in a 25 μL volume containing 12.5 μL of PreMIX (Takara Biotechnology Co), 1 μL of genomic DNA (50 ng), 9.5 μL of ddH2O, and 1μL of each primer (10 pmol/μL). Cycling reaction conditions were as follows: initial denaturation at 95 °C for 5 min; followed by 34 cycles of 30 s at 95 °C, annealing from 52 °C to 62 °C for 35 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. The PCR products were sequenced using the ABI3730XL DNA analyzer (Applied Biosystems). In total, four SNPs were identified in the new population.

Second, the identified SNPs were genotyped for 514 cows through the multiplex Snapshot method (Applied Biosystems). The primer sequences of the four identified SNPs were as follows (obtained from Tsingke Inc.): TRAPPC9-SNP1-Forward: AGGAAAGTGAAGTCGCTCAGT, TRAPPC9-SNP1-Reverse: CCTTTTATTGGAGGTCTATGTG; TRAPPC9-SNP2-Forward: TTACATTAACCTTCGGCAGGT, TRAPPC9-SNP2-Reverse: GACTCCAGGGTCTTGACCACA; TRAPPC9-SNP3-Forward: GCTTCAGTCTTCTGGACCCTCT, TRAPPC9-SNP3-Reverse: GATACCCCTGGTCCCCTTTAG and TRAPPC9-SNP4-Forward: TTTATCCTGACGATGTCTGCC, TRAPPC9-SNP4-Reverse: CTGCTGTGAGCCCAAAACTAT.

For SNP1, SNP2, SNP3 and SNP4, 492, 511, 492 and 501 samples were detected successfully (S2 Table). And Haploview (Version 4.1) was used for linkage disequilibrium analysis of identified SNPs.

2.4. DNA bisulfite treatment and hot-start PCR

The EZ DNA Methylation Golden kit was used for the sodium bisulfite conversion of genomic DNA following the manufacturer’s instructions (ZYMO Research). The PCR and sequencing primers of the TRAPPC9 gene used for DNA methylation detection were designed with Oligo 6.0 software and PSQ Assay Design software (Qiagen). Hot start PCR was carried out in a 40 μL system including 20 μL of hot-start PCR premix (ZYMO Research), 1 μL of forward primer (10 pmol/μL), 0.1 μL of reverse primer with the universal tail (10 pmol/μL, [19]), 1 μL of biotin-labeled universal primer (10 pmol/μL), and 4 μL of bisulfite-treated DNA. The PCR conditions were 95 °C for 15 min, followed 94 °C for 30 s, 56 °C for 30 s and 72 °C for 30 s for 45 cycles, and 72 °C for 10 min. The PCR products were detected using 2% agarose gel with ethidium bromide [19].

2.5. Quantitative DNA methylation analyses by pyrosequencing

The pyrosequencing assays were used to analyze the promoter methylation level of the TRAPPC9 gene quantitatively. Six CpG sites located in the promoter region of the bovine TRAPPC9 gene were tested to analyze the DNA methylation level. The Pyro Q-CpG system (Qiagen) was used to analyze DNA methylation following the manufacturer protocol. In brief, bisulfite PCR products were bound with Streptavidin Sepharose High Performance (GE Healthy care). The Sepharose beads grasping the biotin-labeled PCR products were purified in 70% ethanol for 5 s, denatured in a denaturing buffer for 5 s, and then washed in washing buffer for 15 s using the Pyrosequencing Vacuum Prep Tool (Qiagen). Subsequently, a 0.5 μM pyrosequencing primer was annealed to the purified single-stranded PCR product with annealing buffer (Qiagen). The levels of CpG methylation were expressed as the percentage ^mC/ (^mC+C), and non-CpG cytosine residues were used as internal controls to verify bisulfite conversion. The primers measuring the methylation levels of bovine TRAPPC9 are as follows (obtained from Tsingke): R1 Region-Forward: GGGAAGAGTATAGATAATAGTTAGATAGT, R1 Region-Reverse: GGGACACCGCTGATCGTTTAAACAATCCACTCCAATTACTATTACC, and R1 Region-Sequencing: TTTTAAAGGAAAGGAAAGTG. R2 Region-Forward: GAGTTTGGAGTGGTTTTTTTAGG, R2 Region-Reverse: GGGACACCGCTGATCGTTTAAAATAAATTCCCCTTTTACTATC, and R2 Region-Sequencing: GTTTGGAGTGGTTTTTTTAGG.

2.6. Invasion assay of MRSA and S. aureus

The gentamicin protection assay was performed to analyze the invasion ability of MRSA and S. aureus into Mac-T cells as described previously [20]. In brief, Mac-T cells at 85% confluence in 6-well plates were cultured in modified growth medium at 37 °C in 5% CO₂. The monolayers were stimulated with MRSA and S. aureus (1×10⁸ CFU/mL) for 3, 6, 8 and 10 hr at a multiplicity of infections of 10 bacteria to 1 Mac-T cell (MOI = 10:1). Then, the Mac-T cells were washed three times with PBS and incubated in DMEM supplemented with 100 μg/mL gentamycin for 2 h in 5% CO₂ at 37 °C without serum. Each experimental treatment was conducted in triplicate. These cells were washed three times in PBS and collected at different time points post-inoculation using 0.25% trypsin/EDTA for RNA extraction. The number of CFU/mL was determined by the qPCR technique.

2.7. Challenging Mac-T cells with S. aureus and MRSA strains

Mac-T cells at 85% confluence in 6-well plates were cultured in modified growth medium at 37 °C in 5% CO₂. The monolayers were stimulated with S. aureus (90-1) or MRSA (W18) (1×10⁸ CFU/mL) for 3, 6, 12 and 24 h at a multiplicity of infections of 10 bacteria to 1 Mac-T cell (MOI = 10:1). The Mac-T cells infected with bacteria alone and cultured in the same volume of DMEM growth media without any treatment served as controls. Each experimental treatment was conducted in triplicate. These cells were washed three times in PBS and collected at different time points post-inoculation for RNA extraction.

2.8. Cell viability assay

Cell viability was measured using the One Solution Cell Proliferation assay (Promega Corporation) to investigate the effect of folic acid on cell growth. In brief, the Mac-T cells were seeded at 5×10⁴ cells/mL in 96-well plates at 37 °C in 5% CO₂ for 24 h, and the cell medium included different concentrations of folic acid (0, 5, 10, 20, and 40 μg/mL). After 24 h, the cells were treated with 20 μL of MTS solutions/well at 37 °C with 5% CO₂ for 4 hr. The Mac-T cells cultured in the medium alone and the medium without cells in sextuplicate served as zero adjustment controls. Optical density was measured at 490 nm on a microplate spectrophotometer (Tecan).

2.9. Mac-T cells treated with folic acid and followed bacterial infection

Mac-T cells at 85% confluence in 6-well plates were cultured in modified growth medium at 37 °C in 5% CO₂. The monolayers were treated with folic acid at different doses (5, 10, 20, and 40 μg/mL) for 2 hr, and then stimulated with S. aureus (90-1) or MRSA (W18) (1×10⁸ CFU/mL) for 6 hr at a multiplicity of infections of 10 bacteria to 1 Mac-T cell (MOI = 10:1). The Mac-T cells infected with S. aureus or MRSA alone and cultured in the same volume of DMEM growth media without any treatment served as controls. Each experimental treatment was conducted in triplicate. These cells were washed three times in PBS and collected at 6 hr post-inoculation for RNA extraction.

2.10. Cell transfection and RNA interference (RNAi)

For cell-based functional assays, cell transfections were conducted with Lipofectamine 2000 (Invitrogen) on the RNA interference method following the manufacturer’s manual. In brief, the Mac-T cells were seeded at 5×10⁵ cells/mL in 6-well plates for 24 hr, and then treated with DMEM containing extra folic acid (5 μg/mL) (treated group) or only DMEM (control group) for 2 h. For RNAi, cells were co-transfected with synthetic small interfering RNA (siRNA, 100 pmol), Lipofectamine 2000 (5 μL) supplemented with warm DMEM containing 10% FBS in a humidified atmosphere with 5% CO₂ at 37 °C at 2 h post-inoculation. The Mac-T cells were treated with folic acid and then RNAi (TRAPPC9), because the purpose of this study was to investigate the protective effect of folic acid on the expression of inflammatory cytokines (indicators of inflammation). The cells were stimulated with S. aureus or MRSA for 6 hr with MOI = 10:1 at 48 h post RNAi transfection. Each experimental treatment was performed in triplicate. The Mac-T cells were washed three times in PBS and collected at 6 hr post-inoculation for RNA extraction. The primers used for bovine RNAi are as follows (designed and synthesized by GenePharma): TRAPPC9 siRNA-Forward: GCAUGGAAGCGUCGGAAUUTT, and TRAPPC9 siRNA-Reverse: AAUUCCGACGCUUCCAUGCTT. Negative control siRNA-Forward: UUCUCCGAACGUGUCACGUTT, and Negative control siRNA-Reverse: ACGUGACACGUUCGGAGAATT.

2.11. Total protein extraction and Western Blot analysis

Mac-T cells were stimulated for 6 hr with S. aureus at 72 hr post-transfection and 2 hr pre-treated with folic acid (5 μg/mL). Finally, these cells were harvested with 500 μL of 0.25% trypsin/EDTA and washed twice in PBS for protein extraction. Total proteins from the cells were extracted by mammalian protein extraction reagent. The cellular proteins were separated by 10% sodium dodecyl sulfate -polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride membrane (Millipore, Bedford, USA). The membrane was blocked for 2 hr with 5% non-fat dry milk in Tris-buffered saline-Tween (TBST) at room temperature on a rotary shaker and then washed three times (10 min each) with TBST. The membrane was blotted with 1:500 specific primary anti-bovine antibodies followed by 1:5000 secondary antibody conjugated with horseradish peroxidase at room temperature for 1 hr. The membrane was again washed three times (10 min each), and blots were generated with the ECL Plus Western Blotting Detection System (Amersham Life Science). Rabbit anti-GAPDH polyclonal antibody (Good Here) was used as the loading control.

2.12. Statistical analysis

The number (n) of individual animals used per group is described in each figure panel or figure legend. The replicates of experiments are described in each figure legend. The data were analyzed using SAS 9.2. For a single comparison between two groups, t-test was used, and for multiple groups comparison, ANOVA followed by Tukey’s studentized range multiple tests (Tukey) was used. Graphs show mean ± SEM. The upper threshold for statistical significance for all experiments was set at P < 0.05. In summary, ANOVA followed by Tukey’s studentized range multiple tests (Tukey) were applied in the data of Figures 1A, 1B, 4E, 5B, 5C, 5E and S1C; and t-tests were applied in Figures 1C (left panel), 1F, 2C, 3B, 3D, 3E, 4A, 4C, 4D, S1A.

Association study of these four SNPs in TRAPPC9 with milk somatic cell score (SCS) and the concentration of NF-κB, IL-17, IL-6, IL-4, TNF-α and IFN-γ were analyzed using general linear model (SAS 9.0):

y = μ + hys + p + m + h + g + e

where y is the phenotype value, μ is the overall mean, hys is the effect of herd-year-season, p is the effect of parity, m is the effect of lactation stages, h is the effect of healthy status, g is the effect of SNP, and e is random residuals.

Healthy status was divided into three grades: Grade 1, health (SCC ≤ 20 × 10⁴/mL), Grade 2, subclinical mastitis (20 × 10⁴/mL < SCC < 50 × 10⁴/mL), and Grade 3, clinical mastitis (SCC > 50 × 10⁴/mL). Healthy status was not considered in the model when conducting association analyses between the SCS and SNPs of TRAPPC9.

3.1. Remarkable genetic and epigenetic effects of bovine TRAPPC9 on mastitis resistance

We had assessed that the genetic effect of mutations in the bovine TRAPPC9 gene was significantly associated with bovine mastitis resistance (three significant SNPs, SNP2, SNP3 and SNP4 within TRAPPC9 were identified, at P values 1.24E-10, 3.29E-08 and 3.64E-08, respectively, Fig. 1D) on the genome-wide level with Illumina Bovine SNP50 BeadChip (n = 2093, [11]). In the present study, a new Holstein population was hired to screen and validate the genetic effects of the gene on mastitis resistance.

First, to dissect the influence of TRAPPC9 on mastitis resistance, the 514 experimental cows were divided into three categories (health, subclinical mastitis, and clinical mastitis, Fig. 1A). We observed that the transcriptional levels of the gene in peripheral lymphocyte cells decreased along with the degree of mastitis (left panel, P = 0.003, Fig. 1A). Similar trends were observed for the concentration of TRAPPC9 coding protein (NIBP) (middle panel, Fig. 1A, P = 0.008) and NIBP-regulated protein NF-κB in serum (right panel, Fig. 1A, P = 0.012).

Next, four screened SNPs in bovine TRAPPC9 gene with pooled DNA samples (n = 30) were genotyped in the new dairy cattle population (n = 514, S2 Table), of which SNP2, SNP3 and SNP4 were detected in our initial work [11], and SNP1 was a novel mutation. We observed that SNP1 was associated with SCS (a widely used mastitis-related trait) at P-value of 0.06, SNP2 was significantly associated with the concentrations of TNF-α and IFN-γ in the serum (P < 0.05), while SNP3 and SNP4 were not significantly associated with any mastitis-related traits (S3 Table). In particular, the investigation of the influence of the four SNPs on the gene’s transcriptional levels also clarified that only SNP2 had a significant effect on the expression level of the gene (P = 0.016, n = 37, Fig. 1B). The results indicated the importance of the SNP2 at the TRAPPC9 gene on dairy mastitis resistance.

On the bovine genome, copy number variation (CNV) is another type of genetic variation. A previous study observed that human TRAPPC9 is a multi-copy gene and its CNVs are associated with intellectual disability [21]. We further measured the CNVs of bovine TRAPPC9 (2 ~ 8 copies) and assessed their association with the traits of mastitis resistance. The data revealed that the CNVs were remarkably associated with the incidence of mastitis, i.e. the subclinical/clinical mastitis cows (SCC > 20⊆10⁴/mL) had significantly higher CNVs than the healthy ones (SCC < 20⊆10⁴/mL) (left panel, P = 0.006, Fig. 1C). The population-specific median copy numbers of the gene (five-copies) can serve as a switch point (red arrow, Fig. 1C) for mastitis incidence, because the cows possessing less than or more than five-copies had significantly lower or higher risks of mastitis (right panel, Fig. 1C)

Aside from genetics, epigenetic modification is also critical for disease prevention. A previous study reported that the change of average DNA methylation in TRAPPC9 is related to the regrowth of the Michigan Cancer Foundation-7 (MCF-7) breast cancer cell line [22]. In the present study, we analyzed the connection between the promoter methylation level of bovine TRAPPC9 and four immune-related traits in the dairy cattle population (Fig. 1F and S1A Figure). On the promoter region of bovine TRAPPC9, two CpG regions (R1 and R2) were chosen to examine the methylation levels quantitatively by bisulfite sequencing and analyze their relationship with different immune-related traits separately (Figs. 1D-1F). Data showed that the methylation levels at the CpG 1–1 and CpG 1–2 sites in the R1 region were 100% in all the examined cattle (Fig. 1E). Using DNA sequencing, we found that the cytosine in the CpG 1–3 is on the site of SNP3 (C to T mutation). Therefore, the non-methylation of the CpG on this site could be attributed to the C→T SNP. Notably, the methylation status of the three CpG sites in the R2 region can be divided into two statuses. One is non-methylation (0%) and another is methylation (3.10% ~ 15.16%) for the tested cows (Fig. 1F). In addition, a significant association was found between the methylation status and the concentration of NF-κB in serum for the CpG 2–2 site (P = 0.006, Fig. 1F). Moreover, the three CpG sites in the R2 region were remarkably related to the concentrations of serum TNF-α, IL-17, and IFN-γ (S1A Figure).

The above results explained that bovine mastitis-related status traits were closely linked to the transcriptional levels, CNVs, and SNPs at the TRAPPC9 gene and that the promoter methylation levels of the gene could significantly influence the immune responses of the dairy cows.

3.2. Expression of TRAPPC9 and interleukin genes of bovine mammary epithelial cells were modulated by S. aureus and MRSA

Given the condition that genetic mutations and DNA methylations of bovine TRAPPC9 are related to the inflammatory progression of the bovine mammary gland, we asked this question “whether the gene contributes to the inflammation pathway of the mammary gland epithelial cells or not”. To answer this question, we established a bovine mammary epithelial cell model with the Mac-T cell line induced by S. aureus, a major cause of bovine mastitis. Similarly, the MRSA-induced mastitis cell model was also established. Both strains of S. aureus (90 − 1) and MRSA (W18) used in the current study were separated from fresh bovine milk (Fig. 2A and S2 Figure).

We measured the transcriptional expression patterns of TRAPPC9 and interleukin genes (IL-1β, IL-6, and IL-8) that are involved in the NF-κB signaling pathway in the S. aureus- and MRSA-induced mastitis cell models (Figs. 2B and 2C). We observed that the mRNA expression levels of TRAPPC9 gradually reduced from 3 h to 24 h after the infection of S. aureus or MRSA (Fig. 2C). The expression of the interleukin genes initially increased and then decreased after S. aureus/MRSA infection (Fig. 2C), which are similar to other results [23]. Similar expression trends in Mac-T cells were observed for the four genes after S. aureus or MRSA infection. Remarkably, compared with uninfected cells (control), TRAPPC9 significantly decreased at 6 h post-infection, whereas interleukin genes IL-1β, IL-6, and IL-8 significantly increased at this time point. On the other hand, a western blot revealed that the protein level of TRAPPC9 (NIBP) at 6 h post-S. aureus infection is consistent with the variation in mRNA expression levels; moreover, the level of NF-κB-p65 slightly decreased in the S. aureus infected cells compared with the control cells (Fig. 2D).

We further carried out the knockdown of TRAPPC9 in the cell model and followed by 6 h infection of S. aureus or MRSA. Figure 3A shows the procedures of the RNAi assay of TRAPPC9 and bacterial infection. The results of RT-qPCR and Western blot indicated that the RNAi targeting TRAPPC9 was effective (Figs. 3B and 3C). The data showed that knockdown of bovine TRAPPC9 without bacterial treatment (Control) correlated with the significant upregulation IL-6 expression (P < 0.001) (the left histograms, Fig. 3D). In the cell model, compared with the TRAPPC9-non-knockdown cells (NC), knockdown of the gene followed by S. aureus infection can only significantly elevate the expression of IL-1β (the middle histograms, Fig. 3D, P < 0.05), whereas knockdown of the gene followed by the infection of the MRSA strain (W18) can significantly up-regulate the expression of IL-1β (P < 0.05) (the right histograms, Fig. 3D). In addition, comparing with the control cells without bacterial treatment (the white histograms in Control, upper panel, Fig. 3D), we observed that the expression of IL-1β in the Lipofectamine 2000-treated Mac-T cells followed by S. aureus infection was significantly down-regulated (P < 0.05). It was contradictory with the results in Fig. 2C (upper right panel) and may be caused by the interaction between a possible toxic side effect of transfection reagent of RNAi (Lipofectamine 2000) [24, 25] and S. aureus infection.

Furthermore, we assessed the influence of TRAPPC9 knockdown on the invasion abilities of S. aureus and MRSA into Mac-T cells. The invasion capacities of the MRSA strain (W18), as well as the S. aureus strain (90 − 1) into the Mac-T cells were first measured. Results showed that S. aureus and MRSA had different invasion trends and peaked at 6 h and 8 h (upper panel, Fig. 3E), respectively. These two time points were individually chosen for the following functional validation of TRAPPC9 for the two types of bacteria. The knockdown of TRAPPC9 did not influence the invasion number of S. aureus strain (middle panel, Fig. 3E) but slightly decreased that of MRSA strain (lower panel, Fig. 3E).

Collectively, these data suggest that the expression of TRAPPC9, NIBP, interleukins genes and NF-κB-p65 can be modulated by both S. aureus and MRSA strains. Knockdown of TRAPPC9 can promote the progress of inflammation in vitro by upregulating the expression of pro-inflammatory genes IL-1β and IL-6.

3.3. The appropriate dose of folic acid increases TRAPPC9 expression and decreases the invasion of the MRSA strain in vitro

The extent of inflammation can be reduced by dose-dependent folic acid through regulating the expression of key genes [16–18, 26]. Thus, to determine whether folic acid can effectively influence the expression of TRAPPC9 and interleukin genes (IL-1β, IL-6 and IL-8), we investigated the effects of folic acid at five doses on the expression of the four genes. The invasion abilities of the two strains of S. aureus (90 − 1) and MRSA (W18) into Mac-T cells were also measured at the effective dose of folic acid.

We first evaluated the viability of the Mac-T cells under different doses of folic acid (0, 5, 10, 20, and 40 µg/mL FA) with MTS assay. Results showed that the viability of the folate-treated cells was not affected compared with the untreated cells (0 µg/mL, Fig. 4A). Thus, these five doses of folic acid were used for the next assays (Fig. 4B). We assessed the mRNA expression levels of TRAPPC9 and the three interleukin genes via RT-qPCR. Folic acid treatment at 5 µg/mL remarkably increased the mRNA expression level of TRAPPC9 and reduced the expression of the interleukin genes in the strains of S. aureus (90 − 1) or MRSA (W18) infected Mac-T cells (Fig. 4C, P < 0.05). Thus, 5 µg/mL folic acid was the suitable dose for restricting the infection of S. aureus and MRSA at least by increasing the expression of TRAPPC9 and reducing the expression of IL-1β, IL-6 and IL-8.

Folic acid treatment of Mac-T cells followed by TRAPPC9 knockdown was performed to determine whether folic acid can mediate the expression of the interleukins by regulating TRAPPC9. In the Mac-T cells added with 5 µg/mL folic acid, knockdown of TRAPPC9 can significantly reduce the mRNA expression of IL-6 and IL-1β after the MRSA strain (W18) infection (upper and middle panels in Fig. 4D), and moderately decreased that of IL-8 (lower panel in Fig. 4D). No apparent changes were observed in the S. aureus (strain 90 − 1)-infected cells for the three genes (Fig. 4D). This finding suggests that either TRAPPC9 or folic acid can down-regulate the inflammation factors of MRSA-induced cells.

Finally, the influence of folic acid in the invasion abilities of the two strains of S. aureus and MRSA was investigated. Results showed that 5 µg/mL folic acid can significantly decrease the invasion number of MRSA (W18) into Mac-T cells (right panel, Fig. 4E, P < 0.05) but did not affect the invasion of S. aureus (left panel, Fig. 4E). Hence, the above results imply that a suitable dose of folic acid has a positive impact on defense against MRSA-induced mastitis.

3.4. Folic acid dose-dependently prevents mastitis and increases TRAPPC9 expression in vivo

A dairy cattle experiment was designed to investigate the effective dose of folic acid to prevent mastitis. A total of 123 Holstein cows during the perinatal period were divided into three groups (Figs. 5A). After coated folic acid supplementation for 14 days before calving and 7 days after calving, the cows supplemented with body weight (kg) × 0.24 mg/day of folic acid (group B) showed apparently higher expression of TRAPPC9 than the controls (P > 0.05) (Fig. 5B, left panel). Especially, after folic acid supplementation, the expression levels of TRAPPC9 in the group B cows were significantly increased compared with before supplementation (P < 0.05) (Fig. 5B, right panel). Meanwhile, the cows fed with body weight (kg) × 0.24 mg/day (group B) of folic acid exhibited significantly higher expression of IL-6 than the controls (Fig. 5C, P < 0.01). After delivery, we recorded the incidence of subclinical mastitis of the dairy cattle. The body weight (kg) × 0.24 mg/day of folic acid supplementation can effectively decrease the incidence of bovine subclinical mastitis (Fig. 5D). Moreover, the cows in groups B and C added with folic acid showed moderately lower SCCs than the control cows (group A) at the second, third and fourth months after folic acid supplementation (Fig. 5E).

The above data indicate that folic acid can dose-dependently increase the expression of bovine TRAPPC9 and prevent bovine mastitis.

S. aureus and its “superbug” strain MRSA, have strong abilities of immunodepression and antibiotic-resistance [27]. In the present study, we designed a series of experiments to clarify the favorable roles of bovine TRAPPC9, a candidate gene of mastitis resistance, and folic acid in the prevention of mastitis and resistance to S. aureus and MRSA infections in dairy cows. The consequences of these examinations condensed three major findings.

The first is that the candidate gene TRAPPC9 can be considered as a biomarker for bovine mastitis because all the investigated factors, including mRNA levels, protein expressions, SNP, CNVs, and DNA methylation of the gene, were apparently related to mastitis progress in the dairy population. TRAPPC9 was disclosed as a bovine mastitis candidate gene in our previous GWAS study [11], which encodes the novel protein called NIK- and IKKβ-binding protein (NIBP) in the NF-κB pathway [12]. A new Holstein population was hired to investigate the effects of the gene on bovine mastitis-related traits. Not only the mRNA expression of the gene but also its protein (NIBP) level in serum were significantly correlated with mastitis progression. In specific, higher expression of the gene indicated stronger mastitis resistance of the cows. Notably, linkage disequilibrium analysis did not show close linkage disequilibrium among the identified four SNPs (S1B Figure). Among the previously significant SNPs (SNP2, SNP3 and SNP4, designed in the Illumina 50K SNP-chip), only SNP2 was associated with mastitis-related traits (serum TNF-α and IFN-γ) in the present study. The others (SNP3 and SNP4) and the novel detected SNP (SNP1) did not show a significant effect on the seven studied traits (S3 Table). This finding reminds us that for low-heritability traits ( such as bovine mastitis), SNPs effects among different population may vary, thus searching for the causal mutations is necessary. In addition, abnormal CNV of human TRAPPC9 is correlated with hereditary breast cancer [28]. Our results showed that the cows possessing five or more copies of TRAPPC9 had a higher incidence of mastitis (Fig. 1C). However, no significant differences were found between the CNVs and the mRNA expression of TRAPPC9 in the cows (S1C Figure), which are similar to the results of Kaufman’s studies in human [29]. The underlying reason could be that the samples chosen in the expression assay were peripheral blood tissue, while the expression level of the gene varied largely among different types of tissues [12]. Thus, choosing more types of tissues or specific blood cell types may guarantee clearer results in the future.

Genetic mutants and epigenetic modifications regulate immune gene expression [30]. Kuhmann et al. (2011) reported that the methylation changes of TRAPPC9 are related to the regrowth of MCF-7 (human breast adenocarcinoma cell line) cells [22]. In the present study, we provided evidence that the un-methylated TRAPPC9 promoter in region R2 is significantly correlated with higher concentration of NF-κB and cytokines in cow serum compared to the methylated cows. TRAPPC9 has been reported to be associated with some human diseases (liver disease and breast/colon cancer) [31]. Based on our results in vivo and in vitro, mRNA expression and methylation status of TRAPPC9 can be used to measure the healthy status of bovine udder, and CNVs and SNP2 in this gene can be regarded as the genetic basis of marker assistant selection for bovine mastitis resistance.

The second major finding is that in vitro and in vivo data indicated the preventive effect of folic acid on inflammation induced by S. aureus and MRSA. Decreasing the effectiveness of antibiotic drugs for zoonotic S. aureus and MRSA is a critical issue facing modern medical treatment. Increasing evidence indicates that the epidemiology of livestock-associated MRSA has raised concerns about its existence in food animals [32]. Up to date, the transmission of livestock-associated MRSA from farms to human is reported in several countries [9, 33, 34]. Folic acid is an essential water-soluble B vitamin with multiple biological functions, such as antibacterial, antibiotic, anti-apoptotic, anticancer, and anti-inflammatory [35–39]. However, the effect of folic acid on inflammation induced by S. aureus or MRSA was rarely reported. In the current study, S. aureus- and MRSA-induced mastitis cell models were formulated to investigate the effects of folic acid on mastitis resistance and prevention. In our results, the expression patterns of the interleukin genes (IL-1β, IL-6, and IL-8) in Mac-T cells are similar to other results [40, 41], i.e., the mRNA expression of IL-1β, IL-6, and IL-8 initially increased and then decreased (Fig. 2C), which may be related to immunosuppression mediated by S. aureus [28, 42]. These results indicated the success of the formulated S. aureus- and MRSA-induced mastitis cell models. Folic acid plays a positive role in preventing inflammation, oxidative stress, and some diseases possibly by mediating the expression of cytokines (IL-1β, IL-6, TNF-α and others) [17, 19, 43, 44]. During female pregnancy and lactation, appropriate folate intake reduced the expression of IL-6 and TNF-α of dams and their offspring [45]. Our in vitro experiments showed similar results that appropriately supplementary folic acid (5 µg/mL) reduced the inflammation of the mammary epithelial cells induced by either S. aureus or MRSA may through influencing the expression of interleukins genes (IL-1β, IL-6, and IL-8). Lower incidence of mastitis was also observed in the cows with folic acid supplementation compared with the control cows. It is worth noting that contradiction exists between the in vivo and in vitro studies regarding the effect of folic acid on IL-6. This may be due to the two different experimental materials in vivo (peripheral blood) and in vitro (Mac-T cells), and context-dependent pro- and anti-inflammatory properties of IL-6 [46]. In the future, effect of folic acid on the IL-6 expression level in vivo and in vitro will be further investigated.

The third major finding is that folic acid prevents the inflammation progresses induced by MRSA partially through a TRAPPC9 mediated NF-κB pathway. Folic acid can alleviate inflammation by regulating some inflammation-related genes (e.g., interleukin genes) in the NF-κB pathway [17, 47, 48]. NF-κB is a ubiquitous transcriptional factor and plays a pivotal role in many pathophysiological processes including inflammation, immune response, aberrant cell growth or apoptosis [49–51]. NF-κB activation is widely proved to be the central initiating cellular affair of host responses to invasion by bacteria. Under normal conditions, NF-κB remains inactive by the inhibitor of NF-κB (IκB), and it can be activated by IκB kinase (IKK) or NF-κB inducing kinase (NIK) [1]. In the current study, NF-κB-P65 and NIK- and IKKβ-binding protein NIBP (coded by TRAPPC9 gene) decreased at 6 h post-stimulation with S. aureus (Fig. 2C and 2D). Opposite expression trends between TRAPPC9 and interleukin genes (IL-1β and IL-6) in Mac-T cells infected with S. aureus or MRSA were verified in RNAi assay (Fig. 2C and 3D). These data are consistent with the previous report that high expression of IL-1β corresponds to the peak SCC in cows with mastitis [52]. Based on our results, IL-1β and IL-6 in these three cytokines are more likely to be regulated by TRAPPC9. The importance of NF-κB in the process of bovine mastitis has been widely reported [53, 54], thus as the upstream regulatory factor of NF-κB, TRAPPC9 coding NIBP may possess greater potential to promote bovine mastitis resistance and can be regarded as a more valuable biomarker for bovine mastitis. Thus, a deeper study of this potential effect is warranted to be conducted.

Furthermore, in dairy cattle, the expression levels of TRAPPC9 and NF-κB reduced with the increased inflammation of mammary glands (Fig. 1A). However, the expression level of TRAPPC9 was only moderately increased in the cows after feeding extra folic acid during the periparturient period, which may be due to the existence of the above-mentioned dosage effect of folic acid or insufficient feeding time at the individual level. The transcriptional expression levels of RELA and RELB in the NF-κB family and MAP3K14 and IKBKB in the NF-κB pathway were positively correlated with that of TRAPPC9 in a healthy dairy population post folic acid supplementation (Figure S3, P < 0.05). It is reported that infections caused by methicillin-resistant strains of S. aureus (MRSA) have a higher mortality rate than infections caused by methicillin-susceptible strains [55]. Some researchers verified that MRSA has a high capacity to destroy the function of innate immune cells and complement, evade neutrophil killing and survive after phagocytosis [56]. Consistently, our study showed that MRSA led to more severe mastitis inflammation responses than S. aureus in dairy mammary epithelial cells, which could adhere and invade quickly and strongly to Mac-T cells. Moreover, folic acid can markedly restrict the invasion of MRSA into bovine Mac-T cells, and reduce the inflammation induced by MRSA. However, the invasion of S. aureus cannot be decreased. More doses and time points of folic acid addition for the prevention of S. aureus infection should be explored later. Overall, combined above data with previous studies results, we propose that folic acid can prevent MRSA-induced mastitis partially through a TRAPPC9-mediated NF-κB pathway (Fig. 6).

In summary, we have revealed that folic acid has a benignant effect on bovine MRSA mastitis by up-regulating the expression of TRAPPC9 in a dose-dependent manner in Mac-T cells (5 µg/mL) and in dairy cows (body weight (kg) × 0.24 mg/day). Our study highlighted the importance of internal bovine TRAPPC9 mediated NF-κB pathway and external folic acid supplementation in treating and preventing zoonotic S. aureus and MRSA infections, which may reduce the overuse of antibiotics in livestock effectively and improve public health.

TRAPPC9 trafficking protein particle complex 9

S. aureus Staphylococcus aureus

MRSA methicillin-resistant S. aureus

IL-1β interleukine 1β

IL-6 interleukine 6

IL-8 interleukine 8

IL-17 interleukine 17

Mac-T bovine mammary epithelial cell lines/bovine mammary alveolar cells

NF-κB nuclear factor-kappa B

SCC somatic cell count

SCS somatic cell score

EDTA ethylenediaminetetraacetic acid

PCA plate count agar

CFU colony-forming units

qPCR quantitative real-time PCR

GAPDH glyceraldehyde-3-phosphate dehydrogenase gene

MOI multiplicity of infection

PBS phosphate buffer saline

DMEM Dulbecco's modification of Eagle's medium Dulbecco

RNAi RNA interference

SDS-PAGE sodium dodecyl sulfate -polyacrylamide gel electrophoresis

TBST Tris-buffered saline-Tween

ANOVA analysis of variance

TNF-α tumor necrosis factor alpha

IFN-γ Interferon-gamma

NIBP TRAPPC9 coding protein

CNV copy number variation

MCF Michigan Cancer Foundation-7 breast cancer cell line

W18 MRSA strain

90-1 S. aureus strain

IκB inhibitor of NF-κB

IKK IκB kinase

NIK NF-κB inducing kinase

Ethics approval and consent to participate:

All animal experiments were approved by the Animal Care Committee, China Agricultural University.

Consent for publication：

Not applicable.

Availability of data and material：

The raw data for the current study are available from the corresponding author on reasonable request.

Competing interests：

The authors declare that they have no conflict of interest.

Funding：

The study was supported by the NSFC-PSF joint project (31961143009), Beijing Natural Science Foundation (6182021) and Earmarked Fund for Modern Agro-industry Technology Research System (CARS-36), Beijing Dairy Industry Innovation Team (BAI06), and the Program for Changjiang Scholar and Innovation Research Team in University (IRT-15R62).

Authors' contributions：

Conceptualization: Y.Y.; Data curation: S.M. and L.S; Formal analysis: S.M; Funding acquisition: Y.Y.; Investigation: M.S., Y.D., Z.Z., L.F. and L.S.; Methodology: S.M.; Resources: L.F.; Supervision: Y.Y.; Validation: S.M, M.S. and Y.D.; Writing – original draft: S.M.; Writing – review & editing: S.M. and Y.Y.

Acknowledgements：

We thank the reviewers and academic editor for their constructive comments and suggestions on the manuscript, and all the members of the Animal Molecular and Quantitative Genetics Laboratory in China Agricultural University for samples collection. We also thank Prof. Xin Zhao from McGill University, Dr. Yali Hou from the Chinese Academy of Sciences, Di Wang, Ruiqiang Zhang, Serafino M. A. Augustino, Hanpeng Luo, Hailiang Zhang and Yixin Dong from China Agricultural University for their constructive discussion.

Rahman MM, McFadden G. Modulation of NF-κB signaling by microbial pathogens. Nat Rev Microbiol. 2011;9:291–306. doi:10.1038/nrmicro2539.
Zhang Q, Lenardo MJ, Baltimore D. 30 Years of NF-κB: A Blossoming of Relevance to Human Pathobiology. Cell. 2017;168:37–57. doi:10.1016/j.cell.2016.12.012.
Sun S. The non-canonical NF-κB pathway in immunity and inflammation. Nat Rev Immunol. 2017;17:545–58. doi:10.1038/nri.2017.52.
Tong SYC, Davis JS, Eichenberger E, Holland TL, Fowler VG. Staphylococcus aureus Infections: Epidemiology, Pathophysiology, Clinical Manifestations, and Management. Clin Microbiol Rev. 2015;28:603–61. doi:10.1128/CMR.00134-14.
Lakhundi S, Zhang K. Methicillin-Resistant Staphylococcus aureus: Molecular Characterization, Evolution, and Epidemiology. Clin Microbiol Rev 2018, 31, doi:10.1128/CMR.00020-18.
Klein EY, Sun L, Smith DL, Laxminarayan R. The Changing Epidemiology of Methicillin-Resistant Staphylococcus aureus in the United States: A National Observational Study. Am J Epidemiol. 2013;177:666–74. doi:10.1093/aje/kws273.
Devriese LA, Van Damme LR, Fameree L. Methicillin (cloxacillin)-resistant Staphylococcus aureus strains isolated from bovine mastitis cases. Zentralbl Veterinarmed B. 1972;19:598–605. doi:10.1111/j.1439-0450.1972.tb00439.x.
LEVINE DP. Community-Acquired Methicillin-Resistant Staphylococcus aureus Endocarditis in the Detroit Medical Center. Ann Intern Med. 1982;97:330. doi:10.7326/0003-4819-97-3-330.
Sieber RN, Skov RL, Nielsen J, Schulz J, Price LB, Aarestrup FM, Larsen AR, Stegger M, Larsen J. Drivers and Dynamics of Methicillin-Resistant Livestock-Associated Staphylococcus aureus CC398 in Pigs and Humans in Denmark. Mbio 2018, 9, doi:10.1128/mBio.02142-18.
Abd E, Hamid MI, Bendary MM, Merwad AMA, Elsohaby I, Mohammad Ghaith D, Alshareef WA. What is behind phylogenetic analysis of hospital-, community‐ and livestock‐associated methicillin‐resistant Staphylococcus aureus? Transbound Emerg Dis. 2019. doi:10.1111/tbed.13170.
Wang X, Ma P, Liu J, Zhang Q, Zhang Y, Ding X, Jiang L, Wang Y, Zhang Y, Sun D, et al. Genome-wide association study in Chinese Holstein cows reveal two candidate genes for somatic cell score as an indicator for mastitis susceptibility. Bmc Genet 2015, 16, doi:10.1186/s12863-015-0263-3.
Hu W, Pendergast JS, Mo X, Brambilla R, Bracchi-Ricard V, Li F, Walters WM, Blits B, He L, Schaal SM, et al. NIBP, a Novel NIK and IKKβ-binding Protein That Enhances NF-κB Activation. J Biol Chem. 2005;280:29233–41. doi:10.1074/jbc.M501670200.
Barrowman J, Bhandari D, Reinisch K, Ferro-Novick S. TRAPP complexes in membrane traffic: convergence through a common Rab. Nat Rev Mol Cell Bio. 2010;11:759–63. doi:10.1038/nrm2999.
Feng W, Dong YC, Wang X, Liu C, Wang X, Wang YC, Yu Y. The Genetic Effect of TRAPPC9 on Mastitis Resistance to S.aureus in Dairy Cows. ACTA VET ET ZOOTECH SIN. 2016;47:276–83. doi:10.11843/j.issn.0366-6964.2016.02.009.
Song MY, Wei YY, Muhammad ZK, Wang X, Yu Y. Molecular Marker Study of Inflammatory Reaction in Bovine Mammary Epithelium Cell Line Induced by methicillin-Resistant Staphylococcus aureus. ACTA VET ET ZOOTECH SIN 2016,47,1995–2002, doi:10.11843/j.issn.0366-6954.2016.10.007.
Gonda TA, Kim YI, Salas MC, Gamble MV, Shibata W, Muthupalani S, Sohn KJ, Abrams JA, Fox JG, Wang TC, et al. Folic Acid Increases Global DNA Methylation and Reduces Inflammation to Prevent Helicobacter-Associated Gastric Cancer in Mice. Gastroenterology. 2012;142:824–33. doi:10.1053/j.gastro.2011.12.058.
Feng D, Zhou Y, Xia M, Ma J. Folic acid inhibits lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages by suppressing MAPKs and NF-κB activation. Inflamm Res. 2011;60:817–22. doi:10.1007/s00011-011-0337-2.
Huang X, He Z, Jiang X, Hou M, Tang Z, Zhen X, Liang Y, Ma J. Folic Acid Represses Hypoxia-Induced Inflammation in THP-1 Cells through Inhibition of the PI3K/Akt/HIF-1α Pathway. Plos One. 2016;11:e151553. doi:10.1371/journal.pone.0151553.
Yu Y, Zhang H, Tian F, Bacon L, Zhang Y, Zhang W, Song J. Quantitative Evaluation of DNA Methylation Patterns for ALVE and TVB Genes in a Neoplastic Disease Susceptible and Resistant Chicken Model. Plos One. 2008;3:e1731. doi:10.1371/journal.pone.0001731.
Alva-Murillo N, Ochoa-Zarzosa A, López-Meza JE. Sodium Octanoate Modulates the Innate Immune Response of Bovine Mammary Epithelial Cells through the TLR2/P38/JNK/ERK1/2 Pathway: Implications during Staphylococcus aureus Internalization. Front Cell Infect Mi 2017, 7, doi:10.3389/fcimb.2017.00078.
Mortreux J, Busa T, Germain DP, Nadeau G, Puechberty J, Coubes C, Gatinois V, Cacciagli P, Duffourd Y, Pinard J, et al. The role of CNVs in the etiology of rare autosomal recessive disorders: the example of TRAPPC9-associated intellectual disability. Eur J Hum Genet. 2018;26:143–8. doi:10.1038/s41431-017-0018-x.
Kuhmann C, Weichenhan D, Rehli M, Plass C, Schmezer P, Popanda O. DNA methylation changes in cells regrowing after fractioned ionizing radiation. Radiother Oncol. 2011;101:116–21. doi:10.1016/j.radonc.2011.05.048.
Lee J, Bannerman DD, Paape MJ, Huang M, Zhao X. Characterization of cytokine expression in milk somatic cells during intramammary infections withEscherichia coli or Staphylococcus aureus by real-time PCR. Vet Res. 2006;37:219–29. doi:10.1051/vetres:2005051.
Li Z, Zhang C, Wang Z, Shen J, Xiang P, Chen X, Nan J, Lin Y. Lipofectamine 2000/siRNA complexes cause endoplasmic reticulum unfolded protein response in human endothelial cells. J Cell Physiol. 2019;234:21166–81. doi:10.1002/jcp.28719.
Mo RH, Zaro JL, Ou JJ, Shen W. Effects of Lipofectamine 2000/siRNA Complexes on Autophagy in Hepatoma Cells. Mol Biotechnol. 2012;51:1–8. doi:10.1007/s12033-011-9422-6.
Shi L, Feng L, Jiang W, Liu Y, Jiang J, Wu P, Kuang S, Tang L, Tang W, Zhang Y, et al. Immunity decreases, antioxidant system damages and tight junction changes in the intestine of grass carp (Ctenopharyngodon idella) during folic acid deficiency: Regulation of NF-κB, Nrf2 and MLCK mRNA levels. Fish Shellfish Immun. 2016;51:405–19. doi:10.1016/j.fsi.2016.02.029.
Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol. 2005;3:948–58. doi:10.1038/nrmicro1289.
Pylkas K, Vuorela M, Otsukka M, Kallioniemi A, Jukkola-Vuorinen A, Winqvist R. Rare copy number variants observed in hereditary breast cancer cases disrupt genes in estrogen signaling and TP53 tumor suppression network. Plos Genet. 2012;8:e1002734. doi:10.1371/journal.pgen.1002734.
Kaufman. Identification of Non-Syndromic Intellectual Disability Genes and Their Overlap with Autism. Master Type, University of Toronto, Toronto.
Husquin LT, Rotival M, Fagny M, Quach H, Zidane N, McEwen LM, MacIsaac JL, Kobor MS, Aschard H, Patin E, et al. Exploring the genetic basis of human population differences in DNA methylation and their causal impact on immune gene regulation. Genome Biol 2018, 19, doi:10.1186/s13059-018-1601-3.
Mbimba T, Hussein N, Najeed A, Safadi F. TRAPPC9: Novel insights into its trafficking and signaling pathways in health and disease (Review). Int J Mol Med. 2018. doi:10.3892/ijmm.2018.3889.
Price LB, Stegger M, Hasman H, Aziz M, Larsen J, Andersen PS, Pearson T, Waters AE, Foster JT, Schupp J, et al. Staphylococcus aureus CC398: host adaptation and emergence of methicillin resistance in livestock. Mbio 2012, 3, doi:10.1128/mBio.00305-11.
Goerge T, Lorenz MB, van Alen S, Hübner N, Becker K, Köck R. MRSA colonization and infection among persons with occupational livestock exposure in Europe: Prevalence, preventive options and evidence. Vet Microbiol. 2017;200:6–12. doi:10.1016/j.vetmic.2015.10.027.
Dodémont M, Argudín MA, Willekens J, Vanderhelst E, Pierard D, Miendje Deyi VY, Hanssens L, Franckx H, Schelstraete P, Leroux-Roels I, et al. Emergence of livestock-associated MRSA isolated from cystic fibrosis patients: Result of a Belgian national survey. J Cyst Fibros. 2019;18:86–93. doi:10.1016/j.jcf.2018.04.008.
Cantarella CD, Ragusa D, Giammanco M, Tosi S. Folate deficiency as predisposing factor for childhood leukaemia: a review of the literature. Genes Nutrition 2017, 12, doi:10.1186/s12263-017-0560-8.
Liu G, Bin P, Wang T, Ren W, Zhong J, Liang J, Hu CA, Zeng Z, Yin Y. DNA Methylation and the Potential Role of Methyl-Containing Nutrients in Cardiovascular Diseases. Oxid Med Cell Longev. 2017;2017:1–7. doi:10.1155/2017/1670815.
Smith AD, Refsum H, Homocysteine B. Vitamins, and Cognitive Impairment. Annu Rev Nutr. 2016;36:211–39. doi:10.1146/annurev-nutr-071715-050947.
Ducker GS, Rabinowitz JD. One-Carbon Metabolism in Health and Disease. Cell Metab. 2017;25:27–42. doi:10.1016/j.cmet.2016.08.009.
Bailey LB, Stover PJ, McNulty H, Fenech MF, Gregory JF, Mills JL, Pfeiffer CM, Fazili Z, Zhang M, Ueland PM, et al. Biomarkers of Nutrition for Development—Folate Review. The Journal of Nutrition 2015, 145, 1636S-1680S, doi:10.3945/jn.114.206599.
Gondaira S, Higuchi H, Iwano H, Nishi K, Nebu T, Nakajima K, Nagahata H. Innate immune response of bovine mammary epithelial cells to Mycoplasma bovis. J Vet Sci. 2018;19:79. doi:10.4142/jvs.2018.19.1.79.
Zbinden C, Stephan R, Johler S, Borel N, Bunter J, Bruckmaier RM, Wellnitz O. The inflammatory response of primary bovine mammary epithelial cells to Staphylococcus aureus strains is linked to the bacterial phenotype. Plos One. 2014;9:e87374. doi:10.1371/journal.pone.0087374.
Lahouassa H, Moussay E, Rainard P, Riollet C. Differential cytokine and chemokine responses of bovine mammary epithelial cells to Staphylococcus aureus and Escherichia coli. Cytokine. 2007;38:12–21. doi:10.1016/j.cyto.2007.04.006.
Zhang Q, Wu H, Zou M, Li L, Li Q, Sun C, Xia W, Cao Y, Wu L. Folic acid improves abnormal behavior via mitigation of oxidative stress, inflammation, and ferroptosis in the BTBR T + tf/J mouse model of autism. The Journal of Nutritional Biochemistry. 2019;71:98–109. doi:10.1016/j.jnutbio.2019.05.002.
Cianciulli A, Salvatore R, Porro C, Trotta T, Panaro MA Folic Acid Is Able to Polarize the Inflammatory Response in LPS Activated Microglia by Regulating Multiple Signaling Pathways. Mediat Inflamm 2016, 2016, 1–10, doi:10.1155/2016/5240127.
Canever L, Alves CSV, Mastella G, Damázio L, Polla JV, Citadin S, De Luca LA, Barcellos AS, Garcez ML, Quevedo J, et al. The Evaluation of Folic Acid-Deficient or Folic Acid-Supplemented Diet in the Gestational Phase of Female Rats and in Their Adult Offspring Subjected to an Animal Model of Schizophrenia. Mol Neurobiol. 2018;55:2301–19. doi:10.1007/s12035-017-0493-7.
Hunter CA, Jones SA. IL-6 as a keystone cytokine in health and disease. Nat Immunol. 2015;16:448–57. doi:10.1038/ni.3153.
Abd Allah ESH, Badary DM. Folic acid protects against lead acetate-induced hepatotoxicity by decreasing NF-κB, IL-1β production and lipid peroxidation mediataed cell injury. Pathophysiology. 2017;24:39–44. doi:10.1016/j.pathophys.2017.02.002.
Ma J, Zhen X, Huang X, Jiang X. Folic acid supplementation repressed hypoxia-induced inflammatory response via ROS and JAK2/STAT3 pathway in human promyelomonocytic cells. Nutr Res. 2018;53:40–50. doi:10.1016/j.nutres.2018.03.007.
Hayden MS, Ghosh S. NF-κB in immunobiology. Cell Res. 2011;21:223–44. doi:10.1038/cr.2011.13.
Mattson MP, Meffert MK. Roles for NF-κB in nerve cell survival, plasticity, and disease. Cell Death Differentiation. 2006;13:852–60. doi:10.1038/sj.cdd.4401837.
Taniguchi K, Karin M. NF-κB, inflammation, immunity and cancer: coming of age. Nat Rev Immunol. 2018;18:309–24. doi:10.1038/nri.2017.142.
Beecher C, Daly M, Berry DP, Klostermann K, Flynn J, Meaney W, Hill C, McCarthy TV, Ross RP, Giblin L. Administration of a live culture of Lactococcus lactis DPC 3147 into the bovine mammary gland stimulates the local host immune response, particularly IL-1β and IL-8gene expression. J Dairy Res. 2009;76:340–8. doi:10.1017/S0022029909004154.
Xu J, Jia Z, Chen A, Wang C. Curcumin ameliorates Staphylococcus aureus-induced mastitis injury through attenuating TLR2-mediated NF – κB activation. Microb Pathogenesis. 2020;142:104054. doi:10.1016/j.micpath.2020.104054.
Akhtar M, Shaukat A, Zahoor A, Chen Y, Wang Y, Yang M, Umar T, Guo M, Deng G. Hederacoside-C Inhibition of Staphylococcus aureus-Induced Mastitis via TLR2 & TLR4 and Their Downstream Signaling NF-κB and MAPKs Pathways In Vivo and In Vitro. Inflammation. 2020;43:579–94. doi:10.1007/s10753-019-01139-2.
Whitby M, McLaws ML, Berry G. Risk of death from methicillin-resistant Staphylococcus aureus bacteraemia: a meta‐analysis. Med J Australia. 2001;175:264–7. doi:10.5694/j.1326-5377.2001.tb143562.x.
Antonanzas F, Lozano C, Torres C. Economic Features of Antibiotic Resistance: The Case of Methicillin-Resistant Staphylococcus aureus. Pharmacoeconomics. 2015;33:285–325. doi:10.1007/s40273-014-0242-y.

Download PDF

Version 1

posted

You are reading this latest preprint version

Combined effects of intrinsic host gene (TRAPPC9) and extrinsic nutrient (folate) on resistance against S. aureus induced bovine mastitis

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

3. Results

3.1. Remarkable genetic and epigenetic effects of bovine TRAPPC9 on mastitis resistance

3.4. Folic acid dose-dependently prevents mastitis and increases TRAPPC9 expression in vivo

4. Discussion

5. Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1