The Loss of DLG2 Isoform 7/8, But Not Isoform 2, is Critical in Advanced Staged Neuroblastoma

doi:10.21203/rs.3.rs-92632/v1

Download PDF

Primary research

The Loss of DLG2 Isoform 7/8, But Not Isoform 2, is Critical in Advanced Staged Neuroblastoma

https://doi.org/10.21203/rs.3.rs-92632/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 16 Mar, 2021

Read the published version in Cancer Cell International →

You are reading this older preprint version

Read the latest preprint version →

BACKGROUND: Neuroblastoma is a childhood neural crest tumor showing large clinical and genetic heterogeneity, one form displaying 11q-deletion is very aggressive. It has been shown that 11q-deletion results in decreased expression of DLG2, a gene residing in the deleted region. DLG2 has a number of different isoforms with the main difference is the presence or absence of a L27 domain. The L27 domain containing DLG proteins can form complexes with CASK/MPP and LIN7 protein family members, which will control cell polarity and signaling.

METHODS: We evaluated the DLG gene family and the LIN7 gene family for their expression in differently INSS staged neuroblastoma from publically available neuroblastoma data and primary tumors, we included two distinct DLG1 and DLG2 N-terminal transcript isoforms encoding L27 domains for their expression. Functionality of DLG2 isoforms and of LIN7A were evaluated in the 11q-deleted neuroblastoma cell line SKNAS.

RESULTS: In neuroblastoma only two DLG2 isoforms were expressed: isoform 2 and isoform 7/8. Using the array data we could determine that higher expression of DLG members that contain L27 domains correlated to better survival and prognosis. Whilst DLG1 showed a decrease in both isoforms with increased INSS stage, only the full length L27 containing DLG2 transcripts DLG2-isoform 7/8 showed a decrease in expression in high stage neuroblastoma. We could show that the protein encoded by DLG2-isoform 7 could bind to LIN7A, and increased DLG2-isoform 7 gene expression increased the expression of LIN7A, this reduced neuroblastoma cell proliferation and viability.

CONCLUSION: We have provided evidence that gene expression of the L27 domain containing DLG2-isoform 7/8 but not L27 domain lacking DLG2-isoform 2 is disrupted in neuroblastoma, in particular in the aggressive subsets of tumors. The presence of the complete L27 domain allows for the binding to LIN7A, which will control cell polarity and signaling, thus affecting cancer cell viability.

Cancer Biology

Neuroblastoma

DLG2

LIN7A

L27

Isoform

Neuroblastoma is a transient embryonic neural crest pediatric tumor with tumor formation in the autonomous nervous system, in young children it is one of the common forms of extra cranial solid tumors (1). Clinical diagnosis of neuroblastoma is difficult due to the age of the patient and the vague and indirect appearance of initial symptoms (2). Neuroblastoma is staged according to the International Neuroblastoma Staging System (INSS) and is a post-surgical method. INSS staged 1 and 2 tumors are complete or partially resected localized tumors that do not cross the midline whereas stage 3 tumors are larger and cross the midline. Stage 4 tumors have lymph node infiltration with spread to bone marrow and result in poor survival. Stage 4S tumors are special cases, where the patient fulfills a specific criteria. They are younger than one year old with a tumor that does not cross the midline and less than 10% bone marrow infiltration (3). The survival of stage 4S patients is between INSS stage 2 and INSS stage 3 tumor groups. Often these tumors are clustered with the stage 1 and 2 tumors (4). Within the higher staged tumors there are also varying genetic alterations that can be used to subtype the tumors.

One of the common alterations that occur in neuroblastoma is deletion of a segment of chromosome 11 often 11q14-ter (5, 6). Within this deleted region resides the candidate tumor suppressor gene Discs Large Homologue 2 (DLG2), and lowered expression of DLG2 is seen in advanced neuroblastomas with 11q-deletion or with MYCN-amplification (7), also ALK activity seems to affect the DLG2 expression (8). Low DLG2 level forces cell cycle progression (7) and result in an undifferentiated state in neuroblastoma cells (8). In addition to neuroblastoma, abnormally low DLG2 expression has also been detected in the human cancers osteosarcoma (9) and ovarian cancers (10). The DLG family has previously been shown to have functions governing cellular structure, polarity and growth behavior (11–13). These functions are achieved by interacting with signaling complexes, protein trafficking to the cellular surface of epithelial cells as well as supramolecular adhesion (14). Currently, five human homologs of the DLG family have been identified; DLG1 (chromosomal location: 3q29) (encodes protein: SAP97), DLG2 (11q14.1) (PSD93), DLG3 (Xq13.1) (SAP102), DLG4 (17p13.1) (PSD95) and DLG5 (10q22.3) (disks large homologue 5). The DLG family are required to have; 3 PDZ domains, a SH3 domain and a guanylate kinase (GUK) domain.

DLG1, DLG2 and DLG4 have various transcription isoforms that either contain or lack a L27 domain. For the DLG family, the proteins that lack the L27 domain are designated as the α-protein and contain N-terminal palmitoylated cysteines, derived from two codons that are mutually exclusive to the β-protein (15). The variants that contain the L27 domain are designated as the β-protein with the exception of DLG2 (Fig. 1a). DLG1 and DLG4 have 2 exons encoding the L27 domain whereas DLG2 (PSD93) has 5 exons encoding the L27 region and SH3 linker region. The currently accepted PSD93β protein is DLG2 isoform 1 which does not include exon 1 or the start of exon 2 and thus follows the standard exon structure of DLG1 and DLG4. This discrepancy was highlighted by Parker et. al. in 2004 (16), where they showed that isoforms 7 and 8 (PSD-93ζ) is the full length protein containing the first three exons resulting in a complete L27 domain and the 2 associated with the linker domain. It has even been suggested that it should be renamed as PSD93β (17). The difference between isoforms 7 and 8 is a single codon with isoform 7 the longer of the two. DLG2 Isoform 2 (PSD93α), has no L27 domain and has a separate initiation site at exon 6 encoding the palmitoylated cysteines (Fig. 1b). DLG4 has been shown to have transcripts either with or without a L27 domain (15). The DLG family transcripts with the complete L27 domain have been shown to be able to form L27 mediated tripartite complexes (18). Alternatively, the isoforms lacking the L27 domains have shown to have palmitoylated cysteines that target to the synapses (15) and increase synaptic strength (15, 19, 20). The remaining two members of the DLG family, DLG3 and DLG5 completely lack the L27 domain and N-terminal cysteines in all isoforms (Fig. 1a). DLG3 (SAP102) is regulated by the SH3 and GUK domain and is often found in immature neurons, suggesting a specific role in neuron growth and development (21). Overexpression of DLG3 has been previously shown to both result in a loss of adhesion properties in esophageal cells (22) and decreased survival in breast cancer (23). DLG5 has been shown to be lost in breast cancer (24) with restoration of DLG5 expression inhibiting cell migration and proliferation (25).

The L27 domain is a supramolecular assembly domain that is found in receptor targeting proteins such as CASK and LIN7 which results in the formation of a tripartite complex (26, 27). The Lin7 family consists of three members, Lin7a (26 kD), Lin7b (23 kD), and Lin7c (22 kD), each of which has an L27 domain and a PDZ domain. The L27 domain is most closely associated with the assembly of signaling complexes and cell polarity complexes (28) by localizing to tight junctions (27), important for cell architecture and growth signaling in all cells, including cancer cells. The interaction, which is also found in Drosophila melanogaster, is often a tripartite interaction with three proteins forming complex of four L27 domains (27, 29). For the tripartite protein complex to form, a protein with two L27 domains like the MPP or CASK families are first required (30). Subsequently the second L27 domain is provided by the Lin7 family with the final L27 domain been provided by the DLG family (31). The L27 domain has been shown to direct protein binding so that the resulting complex is diverse and does not contain homodimerization (31), which is otherwise common within the broader MAGUK superfamily of which the DLG family are members.

In this study we have considered the expression of all DLGs, especially considering the L27-domain containing DLG-isoforms, and the important L27-containing interaction partner LIN7A in neuroblastoma. We have evaluated the different isoforms of DLG2, affected by the common 11q-deletion and MYCN-amplification in advanced staged neuroblastoma, and how they relate to the tripartite complex.

Gene expression analysis

Data for analyses and comparison of DLG2 expression between the different patient subgroups for was imported from the R2 platform (http://r2.amc.nl). The independent neuroblastoma primary datasets; 1): SEQC GSE49710 (microarray), 2): Neuroblastoma NCI TARGET data (RNA-seq) for gene expression and transcript expression. The results generated from the NCI TARGET data was generated by the Therapeutically Applicable Research to Generate Effective Treatments (https://ocg.cancer.gov/programs/target) initiative, phs000218. The data used for this analysis are available at https://portal.gdc.cancer.gov/projects. RNA from SKNAS cells and from 22 fresh frozen primary neuroblastoma samples; 5 stage 1-2, 9 stage 3 and 8 stage 4 tumors; were extracted using RNeasy Kit^® (Qiagen) according to manufacturer’s protocol. RNA was quantified by NanoDrop (NanoDrop Technologies) and 2µg of RNA was reverse-transcribed into double stranded cDNA on a T-professional Basic Gradient thermal cycler (Biometra) using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). cDNA corresponding to 20 ng of RNA was used for each qPCR reaction. Transcript sequences of the isoforms of DLG2 were obtained by FASTA search with the human cDNA sequence for each gene. Reactions were prepared for each cDNA using the SYBR^® Green Master Mix protocol (Applied Biosystems), primers used according to table 1.

Ethics statement

Primary neuroblastoma samples were collected for which written or verbal consent was obtained according to the ethical permits approved by the Karolinska University Hospital Research Ethics Committee (approval no 2009/1369‐31/1 and 03‐763).

Cell Lines and Cell culture

Human neuroblastoma cell line SKNAS and HEK293 were obtained from ATCC Cell Line Collection. The cell lines were maintained in RPMI 1640 supplemented with 10% FBS, 1% L-Glutamine, 1% HEPES solution and 1% sodium pyruvate. Cells were maintained at 37°C with 5% CO₂.

Plasmids, siRNAs and transfections

DLG2 (NM_001364) and DLG2 (NM_001351274.2) overexpression plasmids on a backbone of pcDNA3.1/C-(K)-DYK (OHu25658D and OHuq102626D respectively) vector were purchased from GenScript. LIN7A (NM_004664) over expression plasmid on a backbone of pCMV6-AC-GFP (PS100010) was purchased from Origene (RG221902). siRNA targeting DLG2 (s4122), LIN7A (s16836) or Silencer™ Select Negative control No. 1 siRNA (4390843) was purchased from Ambion (ThermoFischer Scientific). SKNAS and HEK293 cells were grown to 80% confluence and subsequently transfected with; DYK-tagged DLG2 isoform 7, DYK-tagged DLG2 isoform 2, combined with GFP-tagged LIN7A, empty vector “mock” (pCMV6-AC-GFP), si-LIN7A or scrambled negative control “mock”. 100ng of DNA or 10pmol siRNA was complexed with 0.3µl of Lipofectamine 2000 according to the Lipofectamine 2000 reagent forward transfection protocol (Invitrogen; Thermo Fisher Scientific, Inc.).

Cell growth, proliferation and signaling

100 µl cell suspension of SKNAS (1×10⁴ cells/well) was seeded in 96-well culture plates (Corning Incorporated). After culturing to 80% confluence the supernatant was removed and transfection media was added to the cells. 48 hours post transfection, cells were counted using a 60 µm sensor for the Scepter handheld cell counter (Millipore) as per the manufactures instructions (32). Cell proliferation was measured using the MTS/MPS Cell Titer 96® One solution Reagent (Promega) and detecting the color variation (FLUOstar Omega, BMG Labtech) as per the manufacturer’s recommendations. The absorbance values were normalized to the mock transfection and expressed as a percentage. All experiments were repeated three times.

Protein Co-immunoprecipitation and Western blot

Protein was extracted from the transfected cells in 6 well plates (1×10⁵ cells/well), by aspirating the media and incubating on ice for 5 minutes then adding ice cold mPER buffer (Thermo-fisher Scientific, 78505). The lysate was then co-immunoprecipitated using µMACS isolation kits for DYKDDDDK (Miltenyi Biotech, 130-101-591) and for GFP (Miltenyi Biotech, 130-091-288). Western blot analysis was performed using a Mini-PROTEAN® TGX™ 8-20% gradient gel (Bio-Rad), protein was blotted onto LF-PVDF membrane (8 minutes, 25V and 2.5A) using a Trans-Blot® Turbo™ Transfer System (Bio-Rad). Blots were subsequently blocked for 1 hour in 5% milk in TBST buffer (0.1% Tween-20 and 150 mM NaCl in 10 mM Tris–HCL, pH 7.4) as per the manufacturer’s recommendations. Blots were probed overnight at 4 degrees with antibodies diluted in PBST (0.1% Tween-20 in PBS). Primary antibodies; FLAG tag (FG4R, 1:1000, Invitrogen) and LIN7A (PA5-30871, 1:1000, Invitrogen). All primary antibodies were diluted to 1:1000 in PBST 0.1%. The secondary antibodies used for detection were; Starbright goat anti-Rabbit 1:2500 (12004161, Biorad) and Alexa 488 goat anti mouse 1:5000 (A28175). All wash stages were 3x10 minutes in TBST 0.1%. Secondary antibodies were incubated for 1 hour at room temperature. Image detection was performed on ChemiDoc MP (Biorad).

Statistical analysis

All data presented are plotted as Tukeys box and whisker plots showing IQR, line at the median, + at the mean with whiskers ± 1.5-fold of interquartile range from at least 3 independent experiments. For all multi-group analyses, differences were determined by one way ANOVA test followed by Holm-Sidak’s multiple comparison test. For comparisons between two groups a Mann-WhitneyUtest was used: ^*p < 0.05, ^**p < 0.01, ^***p < 0.001. All analyses were conducted using GraphPad Prism version 8.4.3 for Windows, (GraphPad Software, www.graphpad.com).

Expression of DLG members with L27 domains were inversely correlated to survival and risk

The main difference between different proteins encoded by DLG gene members and their isoforms is the presence or absence of an N-terminal L27 domain (Figure 1a). The exon structure of DLG2 showing the initiation sites of the ζ, β, α, ε, δ and γ isoforms (Figure 1b) (16, 17). We evaluated the association of DLG family expression with survival and risk, using online microarray data using the neuroblastoma patient dataset (GSE49710) obtained from the R2 Genomics Analysis and Visualization Platform (http://r2.amc.nl). The data was divided into survival outcome; alive or deceased (Figure 1c). The L27-containing DLG members DLG1 (log2 fc =0.30, p< 0.001), DLG2 (log2 fc =0.72, p< 0.001) and DLG4 (log2 fc =0.49, p< 0.001) all showed higher expression in surviving cases, whereas the non-L27-containing DLG3 (log2 fc =-0.23, p< 0.001) showed lower expression, DLG5 showed no difference in expression (Figure 1c). The same trend was seen for risk stratification with DLG1 (log2 fc =0.40, p< 0.001), DLG2 (log2 fc =0.68, p< 0.001) and DLG4 (log2 fc =0.72, p< 0.001), all showed higher expression in low risk neuroblastoma whereas DLG3 (log2 fc =-0.47, p< 0.001) showed lower expression in low risk neuroblastoma (Figure 1d).

We evaluated the expression levels in neuroblastoma of the L27-domain containing DLG family members, DLG1, DLG2 and DLG4, by comparing the total gene expression and transcript encoding the alpha or beta protein using the using online data using the neuroblastoma patient dataset (TARGET) obtained from the R2 Genomics Analysis and Visualization Platform (http://r2.amc.nl). The data was divided into INSS stage for DLG1, DLG2 and DLG4. DLG1 showed a decrease in DLG1 isoform 1 (DLG1-iso1) (ENST00000452595) expression corresponding to SAP-97α between stage 4 and the favorable stage 4s (log2 FC= 0.44, p< 0.001) with no difference between stage 3 and 4 (Figure 2a). DLG1 showed a decrease in DLG1 isoform 2 (DLG1-iso2) (ENST00000357674) transcript expression corresponding to L27-containing SAP-97β, between stage 4 and stage 4s (log2 FC= 0.44, p< 0.001) and between stage 3 and stage 4s (log2 FC= 0.76, p< 0.05) (Figure 2a). At the total gene expression level a similar decrease in expression as the DLG1-iso2 transcript was observed between stage 4 and stage 4s (log2 FC= 0.80, p< 0.001) and between stage 3 and stage 4s (log2 FC= 0.76, p< 0.05) (Figure 2a). DLG2 showed no decrease in transcript DLG2 isoform 1 (DLG2-iso1) (ENST00000376104) transcript expression corresponding to the truncated L27-containing SAP-93β or DLG2 isoform 2 (DLG2-iso2) (ENST00000398309) expression, corresponding to non-L27-containing PSD-93α, between the stages. At the total gene expression level (including all DLG2 isoforms) a decrease in expression is observed between stage 4 and stage 4s (log2 FC= 0.72, p< 0.001) (Figure 2b). Indicting that isoforms accounting for this difference have not been included in this analysis. DLG4 showed no decrease in isoform 1 expression between the stages. Furthermore, there was no change in total DLG4 expression level between stages (Figure 2c).

DLG2 isoform 7/8 was downregulated in high stage neuroblastoma

We evaluated the expression of the main DLG2 isoforms, using the transcript data from the TARGET dataset based off GRCh37. We determined that the DLG2 isoforms with the highest expression were DLG2-iso2 (ENST00000398309) and DLG2 L27 only (ENST00000472545), with no or very low expression of isoforms 1 (ENST00000376104), 3 (ENST00000418306) or 4 (ENST00000280241) detected (Figure 2d). In this chromosome build DLG2-iso7 or 8 are not included and therefore cannot be included in the analysis. The presence of DLG2 L27 only (ENST00000472545) indicates that isoforms 7/8 are likely expressed, but not captured in this expression data using this chromosome build. Using 22 primary neuroblastoma samples, we could confirm by qPCR the unaltered DLG2-iso2 expression observed in the TARGET dataset (Figure 2e). We could also confirm that there was no expression of isoforms 3 or 4 in our samples. Isoform 1 as a truncated variant of isoforms 7 and 8 (Figure 1b), cannot be uniquely identified by qPCR when compared to isoforms 7/8, and since the isoform 1/7/8 qPCR result showed the same result as the specific isoform 7/8 qPCR, we concluded that isoform 1 was not expressed in our samples (data not shown). No variation in the expression of DLG2-iso2 (ENST00000398309) was observed between the stages (Figure 2e), consistent with Figure 2b. The DLG2-iso7/8 (ENST00000650630) transcript had decreased expression in the stage 4 tumors when compared to the stage 1 and 2 tumors (log2 FC= 3.1, p< 0.05). DLG2-iso7/8 was also decreased compared to DLG2-iso2 in stage 4 (log2 FC= 4.9, p< 0.001) but not between stage 1+2 and stage 3 tumors (Figure 2e). To evaluate the total DLG expression in neuroblastoma we determined the relative expression in Fragments Per Kilobase Million (FPKM) of all DLG family members. DLG1, DLG2 and DLG3 all showed similar expression levels with DLG4 and DLG5 having significantly higher expression (Figure 2f).

DLG2 expression correlated to LIN7 family gene expression and neuroblastoma samples formed clusters.

The L27-domain enables binding to other L27-domain containing proteins. An important L27-containing scaffolding protein in signaling complex formation is the LIN7 protein family. The relationship between DLG2 and DLG1 and the various LIN7 binding partners was examined using primary tumor data taken from the Z score of 159 tumor data sets on the R2 Genomics Analysis and Visualization Platform (http://r2.amc.nl). A positive relationship (Y = 0.82x - 0.05, P<0.001) between DLG2 and LIN7A across tumor datasets could be confirmed (Figure 3a). Clusters were formed based on the spatial coordinates of DLG2 and LIN7A expression. Medulloblastoma (6/7), Ewings sarcoma (2/2), Glioma (6/7), Pheochromocytomas/Paragangliomas (2/2) and Neuroblastoma (5/5) all showed high DLG2 expression as well as high LIN7A expression. The remaining tumors with similar expression included other tumors of the CNS such as Glioblastoma, Primitive neuroectodermal tumor (PNET) and other brain tumors. Squamous cell carcinoma (2/2) showed high DLG2 expression with low LIN7A expression. The remainder of the tumor dataset consisting of Lung, Colon, Ovarian, Breast and various lymphomas tended to show low expression of both DLG2 and LIN7A (Figure 3a). A weak linear relationship could be established between DLG1 and LIN7A (Figure 3b), however no distinct tumor clusters could be formed. A positive relationship (Y = 0.70x + 0.07, P<0.0001) could be established between DLG2 and LIN7B across tumor datasets (Figure 3c). Ewing’s sarcoma (2/2) and Neuroblastoma (5/5) clustered with high DLG2 expression as well as high LIN7B expression. No linear relationship (Y = 0.66x + 0.08, P=0.23) between DLG1 and LIN7B across tumor datasets could be confirmed (Figure 3d). A positive relationship (Y = 0.97x + 0.04, P<0.0001) between DLG2 and LIN7C between tumor datasets could be confirmed (Figure 3e). Ewings sarcoma (2/2) and Neuroblastoma (5/5) clustered with high DLG2 expression as well as high LIN7C expression. Squamous cell carcinoma (2/2) clustered with high DLG2 expression and low LIN7C expression (Figure 3e). A positive relationship (Y = 1.6x + 0.00, P<0.05) between DLG1 and LIN7C across tumor datasets could be confirmed (Figure 3d), however distinct tumor clusters were not formed.

DLG2-isoform 7 expression controlled LIN7A expression and the DLG2-isoform 7 encoded protein can bind LIN7A

To further evaluate the relationship that was established in Figure 3a between DLG2 and LIN7A gene expression, we determined the expression of LIN7A and DLG2-iso7/8 in neuroblastoma primary samples. A strong positive correlation (R²=0.89, Y = 1.1x - 0.06, P<0.001) between the expression of DLG2-iso7/8 and LIN7A for 22 primary neuroblastoma tumors of varying stages was detected (Figure 4a). To determine if the relationship was causal we over expressed DLG2-iso7 or knocked down DLG2 expression by siRNA treatment in SKNAS neuroblastoma cells. When DLG2-iso7 was over expressed LIN7A expression increased, and LIN7A expression decreased following DLG2 silencing (Figure 4b). When LIN7A was over expressed or silenced by siRNA we saw no difference in total DLG2 expression (Figure 4c). To determine if DLG2-iso7 or DLG2-iso2 bound directly to LIN7A we performed co-immunoprecipitation using co-transfected HEK-293 cells, showing that DLG2-iso7 but not DLG2-iso2 could bind to LIN7A (Figure 4d).

LIN7A expression was low in high staged tumors and over expression changed the growth behavior of neuroblastoma cells.

To further investigate the importance of LIN7A we evaluated the association of LIN family expression with survival and INSS, using online microarray data in the neuroblastoma patient dataset (GSE49710) obtained from the R2 Genomics Analysis and Visualization Platform (http://r2.amc.nl). The data was divided into survival outcome; alive or deceased. LIN7A (log2 fc =1.06, p< 0.001) showed a decrease in expression in the deceased patients compared to the patients that survived (Figure 5a). LIN7B (log2 fc =0.43, p= 0.09) and LIN7C (log2 fc =0.20, p=0.66) showed no difference in expression (Figure 5a). The expression of LIN7A was then stratified by INSS stage. Stage 4 tumors showed the lowest expression compared to stage 1 (log2 fc =0.44, p< 0.01), stage 2 (log2 fc =0.44, p< 0.001), stage 4s (log2 fc =0.25, p< 0.05) and stage 3 (log2 fc =0.50, p< 0.01) (Figure 5b). Over expression of LIN7A in neuroblastoma cells (SKNAS) resulted in slower proliferation compared to the control (Figure 5c, p<0.001). We observed a decrease in the number of viable cells (Figure 5d, p<0.001) and an increase in the non-viable cell fraction (Figure 5d, p<0.001) in cells with increased LIN7A expression. LIN7A silencing in SKNAS cells resulted in an increase in cell proliferation (Figure 5c, p<0.01), with an associated increase in viable cell number, no effect in the non-viable cell number was observed (Figure 5d). The LIN7A over expression after expression plasmid transfection, and LIN7A silencing by siRNA treatment of neuroblastoma cells (SKNAS) was confirmed by qPCR (Figure 5e).

We have previously established that DLG2 is a candidate tumor suppressor gene with importance in 11q deleted neuroblastoma as well as a downregulated target of MYCN amplification in neuroblastoma (7). During which, we did not explore the various isoforms of DLG2 and the effects that the resulting proteins have on neuroblastoma. As we have shown in Fig. 1a DLG1, DLG2 and DLG4 all have isoforms that either contain an N-terminal L27 domain or palmitoylated cysteines. When the palmitoylated cysteines are present they modulate homo- or heterodimers with other palmitoylated cysteines that bind synaptic proteins, contributing to the function and strength of the post synaptic density (33). We could show that there was an overall loss of DLG1 in the high INSS stage tumors with no difference seen between the α- and β-isoforms (Fig. 1b and 2a). We could also show that DLG4 isoform expression was not altered in any of the neuroblastoma stages (Fig. 2c) despite showing that higher expression correlated with both survival and prognosis (Fig. 1c and d). We showed that DLG2 displayed differential isoform expression in the high INSS tumors (Fig. 2e). The decreased expression of the L27 domain containing DLG2 isoform 7/8 in the high stage neuroblastoma (Fig. 2e) highlights the importance of the L27 domain of DLG2 in neuroblastoma.

The L27 domain is involved in protein interactions, mainly the formation and correct localization of scaffolding and receptor proteins. The localization of L27 domain containing proteins to the membrane bound receptors indicates a signaling regulatory role in these receptors. The formation of the tripartite complexes is known to contain four L27 domains (30), with one protein such as CASK or the MPP family providing two L27 domains and serving as the platform on which the complex is built (30). The L27 domain containing members of the DLG family have been shown to bind to the N-terminal L27 domain, whereas the LIN family has been shown to bind to the adjacent L27 domain (30). The presence of the L27 domain is important for the binding of DLG2 encoding proteins into this complex. The LIN7 that is present also determines which DLG will likely bind, with DLG1 encoding proteins and LIN7C showing a strong preference, replicating the already known binding patterns (27, 34). Whereas, DLG2 is more of a generalist with expression correlating to all LIN7 homologues (Fig. 3a, c and e), however the clear stratification of tumors seen with DLG2 and LIN7A indicates there may be a causal relationship between the two (Fig. 3a). We were able to show that an increase in DLG2-iso7 resulted in an increase in LIN7A expression (Fig. 4b), but there was no alteration in total DLG2 expression when LIN7A was over expressed (Fig. 4c). Furthermore we could show that DLG2-iso2 cannot bind to LIN7A showing that the L27 domain of DLG2-iso7 is required for this binding to occur (Fig. 4d). The binding complexes that form as a result of the different L27 containing DLG members will likely have slight functional differences, depending on which base protein is present as well as which DLG and LIN7 family members are bound into the complex, yet have a high degree of redundancy (35). The various permutations of the base protein, DLG and LIN7 families exponentially expand the different types of the complex that can form.

The depletion of LIN7A in neurons has previously been shown to result in abnormal neuronal migration (36), a feature of neuroblastoma (37). Clinical cases have also shown that loss of the LIN7A loci results in cellular hyperplasia (36). We were able to replicate these clinical results with the knockdown of LIN7A in neuroblastoma cells, resulting in increased cell number and proliferation (Fig. 5c-d). However, increased LIN7A expression has been previously shown to be associated with a loss of polarity in breast cancer cells (38) as well as increased proliferation in hepatocellular carcinoma (39) and ovarian cancer (40). Our analysis showed that these previously established tumor types in which LIN7A is oncogenic or disruptive tended to cluster with low DLG2 expression in Fig. 3a. Tissue specificity may account for the altered function observed.

The deletion of 11q in neuroblastoma is known to be heterozygous and hence leaves one copy of any potential tumor suppressor gene in this region. It has been established that any TSG will probably be involved in a haploinsufficient mechanism due to the general lack of a second hit. Having a gene with two distinct structural isoforms with separate functions resulting in differing protein localization increases the likelihood that DLG2 may have a haploinsuffient mechanism. The fact that the other members of the DLG family with L27 domains have such a high degree of structural homology, the correct function of the tripartite complex as a whole must be important to the cell. We suggest that whilst there is probably a high degree of redundancy within the DLG family for the tripartite complex function it is most likely highly sensitive to disruptions like 11q deletion or lower expression of another DLG family member.

We have provided evidence that gene expression of the L27 domain containing DLG2-isoform 7/8 but not L27 domain lacking DLG2-isoform 2 is disrupted in neuroblastoma, in particular in the aggressive subsets of tumors. The presence of the complete L27 domain allows for the binding to LIN7A, which will control cell polarity and signaling, thus affecting cancer cell viability.

International Neuroblastoma Staging System (INSS), Discs Large Homologue 2 (DLG2), guanylate kinase (GUK), isoform (iso)

Ethics approval and consent to participate

Consent for publication

All authors give consent for the publication of the manuscript.

Availability of data and materials

The datasets analyzed during the current study are available in the 'R2: Genomics Analysis and Visualization Platform repository, [http://r2.amc.nl]. The datasets analyzed are SEQC GSE49710 (microarray) and Neuroblastoma NCI TARGET data (RNA-Seq). The results generated from the NCI TARGET data was generated by the Therapeutically Applicable Research to Generate Effective Treatments (https://ocg.cancer.gov/programs/target) initiative, phs000218. The data used for this analysis are available at https://portal.gdc.cancer.gov/projects

Competing interests

The authors declare that they have no competing interests.

Funding

This work was supported by grants from the Swedish Childhood Cancer Fund, Jane and Dan Olsson Foundation and Assar Gabrielsson Fund. The funders were not involved in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Authors' contributions

KE generated conception and designed this study and provided technical and material support. SK developed the methodology, performed the assays, analyzed and interpreted the data. TM and PK provided clinical and genetic data and samples. SK and KE organized the data and wrote the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank the Swedish Childhood Cancer Fund, Jane and Dan Olsson foundation, Assar Gabrielssons Foundation and University of Skövde for financial support.

Pugh TJ. The genetic landscape of high-risk neuroblastoma. Nature Genetics. 2013(3):279.
Parmar R, Wadia F, Yassa R, Zenios M. Neuroblastoma: a rare cause of a limping child. How to avoid a delayed diagnosis? Journal Of Pediatric Orthopedics. 2013;33(4):e45-e51.
Smith EI, Haase GM, Seeger RC, Brodeur GM. A surgical perspective on the current staging in neuroblastoma--the International Neuroblastoma Staging System proposal. J Pediatr Surg. 1989;24(4):386-90.
Shuangshoti S, Shuangshoti S, Nuchprayoon I, Kanjanapongkul S, Marrano P, Irwin MS, et al. Natural course of low risk neuroblastoma. Pediatric Blood & Cancer. 2012;58(5):690-4.
Caren H, Kryh H, Nethander M, Sjoberg R-M, Trager C, Nilsson S, et al. High-risk neuroblastoma tumors with 11q-deletion display a poor prognostic, chromosome instability phenotype with later onset. Proceedings of the National Academy of Sciences of the United States. 2010(9):4323.
Mlakar V, Jurkovic Mlakar S, Lopez G, Maris JM, Ansari M, Gumy-Pause F. 11q deletion in neuroblastoma: a review of biological and clinical implications. Mol Cancer. 2017;16(1):114.
Keane S, Ameen S, Lindlof A, Ejeskar K. Low DLG2 gene expression, a link between 11q-deleted and MYCN-amplified neuroblastoma, causes forced cell cycle progression, and predicts poor patient survival. Cell Commun Signal. 2020;18(1):65.
Siaw J, Javanmardi N, Van den Eynden J, Lind D, Fransson S, Marinez-Monleon A, et al. 11q Deletion or ALK Activity Curbs DLG2 Expression to Maintain an Undifferentiated State in Neuroblastoma. Cell Reports. 2020; 32(12):108171.
Shao YW, Wood GA, Lu J, Tang QL, Liu J, Molyneux S, et al. Cross-species genomics identifies DLG2 as a tumor suppressor in osteosarcoma. Oncogene. 2019;38(2):291-8.
Zhuang RJ, Bai XX, Liu W. MicroRNA-23a depletion promotes apoptosis of ovarian cancer stem cell and inhibits cell migration by targeting DLG2. Cancer Biol Ther. 2019:1-15.
Roberts S, Delury C, Marsh E. The PDZ protein discs-large ( DLG): the ' Jekyll and Hyde' of the epithelial polarity proteins. FEBS Journal. 2012;279(19):3549-58.
Ludford-Menting MJ, Thomas SJ, Crimeen B, Harris LJ, Loveland BE, Bills M, et al. A functional interaction between CD46 and DLG4: a role for DLG4 in epithelial polarization. The Journal Of Biological Chemistry. 2002;277(6):4477-84.
Liu J, Li J, Ren Y, Liu P. DLG5 in cell polarity maintenance and cancer development. International Journal Of Biological Sciences. 2014;10(5):543-9.
Papagiannouli F, Mechler BM. Refining the role of Lgl, Dlg and Scrib in Tumor Suppression and Beyond: Learning from the Old Time Classics. InTech, 2012-02-03.; 2012.
Schluter OM, Xu W, Malenka RC. Alternative N-terminal domains of PSD-95 and SAP97 govern activity-dependent regulation of synaptic AMPA receptor function. Neuron. 2006;51(1):99-111.
Parker MJ, Zhao S, Bredt DS, Sanes JR, Feng G. PSD93 regulates synaptic stability at neuronal cholinergic synapses. J Neurosci. 2004;24(2):378-88.
Kruger JM, Favaro PD, Liu M, Kitlinska A, Huang X, Raabe M, et al. Differential roles of postsynaptic density-93 isoforms in regulating synaptic transmission. J Neurosci. 2013;33(39):15504-17.
Jo K, Derin R, Li M, Bredt DS. Characterization of MALS/velis-1, -2, and -3: a family of mammalian LIN-7 homologs enriched at brain synapses in association with the postsynaptic density-95 NMDA receptor postsynaptic complex. Journal of Neuroscience. 1999;19(11):4189-99.
Liu M, Lewis LD, Shi R, Brown EN, Xu W. Differential requirement for NMDAR activity in SAP97beta-mediated regulation of the number and strength of glutamatergic AMPAR-containing synapses. J Neurophysiol. 2014;111(3):648-58.
Cai C, Li H, Rivera C, Keinanen K. Interaction between SAP97 and PSD-95, two Maguk proteins involved in synaptic trafficking of AMPA receptors. J Biol Chem. 2006;281(7):4267-73.
Zheng CY, Petralia RS, Wang YX, Kachar B, Wenthold RJ. SAP102 is a highly mobile MAGUK in spines. J Neurosci. 2010;30(13):4757-66.
Hanada N, Makino K, Koga H, Morisaki T, Kuwahara H, Masuko N, et al. NE-dlg, a mammalian homolog of Drosophila dlg tumor suppressor, induces growth suppression and impairment of cell adhesion: possible involvement of down-regulation of beta-catenin by NE-dlg expression. Int J Cancer. 2000;86(4):480-8.
Liu J, Li P, Wang R, Li J, Zhang M, Song Z, et al. High expression of DLG3 is associated with decreased survival from breast cancer. Clin Exp Pharmacol Physiol. 2019;46(10):937-43.
Liu J, Li J, Li P, Wang Y, Liang Z, Jiang Y, et al. Loss of DLG5 promotes breast cancer malignancy by inhibiting the Hippo signaling pathway. Sci Rep. 2017;7:42125.
Liu J, Li J, Ren Y, Liu P. DLG5 in cell polarity maintenance and cancer development. Int J Biol Sci. 2014;10(5):543-9.
Lin EI, Jeyifous O, Green WN. CASK regulates SAP97 conformation and its interactions with AMPA and NMDA receptors. J Neurosci. 2013;33(29):12067-76.
Bohl J, Brimer N, Lyons C, Pol SBV. The stardust family protein MPP7 forms a tripartite complex with LIN7 and DLG1 that regulates the stability and localization of DLG1 to cell junctions. Journal of Biological Chemistry. 2007;282(13):9392-400.
Li Y, Karnak D, Demeler B, Margolis B, Lavie A. Structural basis for L27 domain-mediated assembly of signaling and cell polarity complexes. EMBO J. 2004;23(14):2723-33.
Bachmann A, Kobler O, Kittel RJ, Wichmann C, Sierralta J, Sigrist SJ, et al. A perisynaptic menage a trois between Dlg, DLin-7, and Metro controls proper organization of Drosophila synaptic junctions. J Neurosci. 2010;30(17):5811-24.
Yang X, Xie X, Chen L, Zhou H, Wang Z, Zhao W, et al. Structural basis for tandem L27 domain-mediated polymerization. FASEB J. 2010;24(12):4806-15.
Petrosky KY, Ou HD, Lohr F, Dotsch V, Lim WA. A general model for preferential hetero-oligomerization of LIN-2/7 domains: mechanism underlying directed assembly of supramolecular signaling complexes. J Biol Chem. 2005;280(46):38528-36.
Ongena K, Das C, Smith JL, Gil S, Johnston G. Determining cell number during cell culture using the Scepter cell counter. Journal of visualized experiments : JoVE. 2010(45):2204.
Waites CL, Specht CG, Hartel K, Leal-Ortiz S, Genoux D, Li D, et al. Synaptic SAP97 isoforms regulate AMPA receptor dynamics and access to presynaptic glutamate. J Neurosci. 2009;29(14):4332-45.
Lozovatsky L, Abayasekara N, Piawah S, Walther Z. CASK deletion in intestinal epithelia causes mislocalization of LIN7C and the DLG1/Scrib polarity complex without affecting cell polarity. Mol Biol Cell. 2009;20(21):4489-99.
Kamijo A, Saitoh Y, Sakamoto T, Kubota H, Yamauchi J, Terada N. Scaffold protein Lin7 family in membrane skeletal protein complex in mouse seminiferous tubules. Histochem Cell Biol. 2019;152(5):333-43.
Matsumoto A, Mizuno M, Hamada N, Nozaki Y, Jimbo EF, Momoi MY, et al. LIN7A depletion disrupts cerebral cortex development, contributing to intellectual disability in 12q21-deletion syndrome. PLoS One. 2014;9(3):e92695.
Johnsen JI, Dyberg C, Wickstrom M. Neuroblastoma-A Neural Crest Derived Embryonal Malignancy. Front Mol Neurosci. 2019;12:9.
Gruel N, Fuhrmann L, Lodillinsky C, Benhamo V, Mariani O, Cedenot A, et al. LIN7A is a major determinant of cell-polarity defects in breast carcinomas. Breast Cancer Research. 2016;18(1):23.
Luo CB, Yin D, Zhan H, Borjigin U, Li CJ, Zhou ZJ, et al. microRNA-501-3p suppresses metastasis and progression of hepatocellular carcinoma through targeting LIN7A. Cell Death & Disease. 2018;9(5):535.
Hu X, Li Y, Kong D, Hu L, Liu D, Wu J. Long noncoding RNA CASC9 promotes LIN7A expression via miR-758-3p to facilitate the malignancy of ovarian cancer. J Cell Physiol. 2019;234(7):10800-8.

Table 1

*DLG2* NCBI reference sequence and PCR primer target sequence
NCBI Reference Sequence	Isoform	Protein	Forward Primer (5’ to 3’)	Reverse Primer (5’ to 3’)
NM_001142699.1	Isoform 1, 7 and 8	PSD93β (975aa)	GCACGGAGCAAGAAGGGAT	AGCTTATTCCAAGCTTTGCT
NM_001364.3	Isoform 2	PSD93α (870aa)	GCTCTCACTCAGTGCCTTCA	GTCCGGAGTGCACAGTAACA
NM_001142700.2	Isoform 3	PSD93 (749aa)	TTTGAGTGTTACCAGCTTTCGCT	TTTCTGTCCCATTGACCGGA
NM_001142702.2	Isoform 4	PSD93 (334aa)	TCAGGTTCCGCTAGTGAGTT	AACCGTCGTCACCTAATCCG
NM_001351274.2 NM_001351275.2	Isoform 7 Isoform 8	PSD93ζ (969aa/968aa)	AGAAGACAGATACTGACCGAGC	CACGGAGCAAGAAGGGATGT

Download PDF

Journal Publication

published 16 Mar, 2021

Read the published version in Cancer Cell International →

Editorial decision: Major revision
27 Dec, 2020
Review #5 received at journal
24 Dec, 2020
Review #2 received at journal
21 Dec, 2020
Review #4 received at journal
21 Dec, 2020
Review #8 received at journal
18 Dec, 2020
Review #7 received at journal
17 Dec, 2020
Review #6 received at journal
17 Dec, 2020
Review #1 received at journal
16 Dec, 2020
Reviewer #9 agreed at journal
06 Dec, 2020
Review #3 received at journal
06 Dec, 2020
Reviewer #8 agreed at journal
06 Dec, 2020
Reviewer #7 agreed at journal
05 Dec, 2020
Reviewer #6 agreed at journal
05 Dec, 2020
Reviewer #5 agreed at journal
04 Dec, 2020
Reviewer #4 agreed at journal
04 Dec, 2020
Reviewer #3 agreed at journal
04 Dec, 2020
Reviewer #2 agreed at journal
29 Nov, 2020
Reviewer #1 agreed at journal
27 Nov, 2020
Reviewers invited by journal
26 Nov, 2020
Editor assigned by journal
14 Oct, 2020
First submitted to journal
13 Oct, 2020
Editor invited by journal
13 Oct, 2020
Submission checks completed at journal
13 Oct, 2020

You are reading this older preprint version

Read the latest preprint version →

The Loss of DLG2 Isoform 7/8, But Not Isoform 2, is Critical in Advanced Staged Neuroblastoma

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

List of Abbreviations

Declarations

References

Tables

Status:

Journal Publication

Version 1