Patients and Tissue Specimens
The retrospectively study was approved by the human study ethics committees at Guizhou Provinicial People’s Hospital [No:(2020)394]. All specimens were handled and made anonymous according to the ethical and legal standards. Tissue samples (n =32) were obtained from consecutive patients who underwent RP surgery as part of their clinical care at Guizhou Provinicial People’s Hospital from September 2019 to September 2020. Medical records were reviewed, and clinical data captured included demographic information, pre-surgery PSA, TNM stage, distant metastasis and Gleason score (Table 1). Meanwhile, a tissue microarray (TMA, n=116) including 58 prostate cancer tissues, 58 adjacent non-cancerous prostate tissues were obtained from Changhai Hospital of Second Military Medical University (Y.W.Y). The clinical features was exhibited in the Table 1.
The TCGA dataset (https://cancergenome.nih.gov/) is downloaded from the cBioPortal for Cancer Genomics (http://www.cbioportal.org/). In addition, the clinical information was downloaded. The median value of YTHDC2 expression levels in PCa tissues of TCGA dataset was used as a cutoff point. High expression group was defined when YTHDC2 expression was more than the median, while the rest was the low expression group.
Immunohistochemistry analysis
Specimens were fixed in 10% neutral buffered formalin and subsequently embedded in paraffin. Paraffin-embedded tissue was cut to 4 μm, then de-paraffined in xylene and rehydrated for further peroxidase immunohistochemical staining using the DAKO EnVision system (Dako Diagnostics, Switzerland). Following a brief proteolytic digestion and a peroxidase blocking of tissue slides, the slides were incubated overnight with the primary antibody against YTHDC2 (rabbit polyclonal antibody, ab220160, Abcam Co. Ltd., UK) at a dilution of 1: 500, at 4℃. After washing, peroxidase labeled polymer and substrate-chromogen were employed in order to visualize the staining of the interested protein. In each immunohistochemistry run, negative controls were carried out by omitting the primary antibody.
The intensity of immunostaining was scored separately by two independent experienced pathologists, who were blinded to the clinicopathological data and clinical outcomes of the patients. The scores of the two pathologists were compared and any discrepant scores were trained through reevaluated by a re-examination of the staining by both pathologists to achieve a consensus score. The immunolabeling of cancer cells was evaluated. The number of positive-staining cells in five representative fields at a 400-fold was counted and the percentage of positive cells was also calculated. According to the antibody specification sheet, cytoplasmic staining was regarded as positive signals. The semi-quantitative scoring of the expression intensity in each sample was performed according to a previous report and was based on the staining intensity and percentage. The staining intensity was visually scored and stratified according to the following criteria: no staining (0 points), mild staining (1 point), moderate staining (2 points), and strong staining (3points). The percentage scoring of immunoreactive tumor cells was defined as follows:<5% (0 points), 6-25% (1 point), 26-50% (2 points), 51-75% (3 points), and >75% (4 points). The final immunoreactivity scores (IRS) of each case were the addition of calculated by adding the two scores for the immunostaining intensity and immunostaining percentage.
Cell culture
Four human PCa cell lines (LNCaP, PC-3, DU-145 and 22Rv1) and two immortalized prostate epithelial cell line BPH-1/ RWPE1 were obtained from Guangzhou HYY Med.Co., Ltd and maintained in RPMI 1640 or DMEM supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA) and penicillin (50 IU/ml)/streptomycin (50 μg/ml) (Thermo Fisher Scientific, Waltham, MA, USA).
YTHDC2-overexpressing/knockdown PCa cell model
To construct YTHDC2 overexpression/knockdown stable cells, two PCa cell lines DU145 and PC-3 were transfected with YTHDC2 human cDNA clone or pCMV6-neo vector according to the manufacturer's protocol (Origene, Rockville, MD, USA). 48 hours after transfection, cells were selected using G418 (1.2 mg/ml) (Cellgro, Manassas, VA, USA). Generate and maintain stable cell lines with DU145 knockout and PC-3 overexpressing YTHDC2 in intact RPMI 1640 containing G418 (1.2 mg/ml). Then the overexpression/knockdown of YTHDC2 cell lines were confirmed by real-time RT-PCR.
qRT-PCR
Expression levels of YTHDC2 mRNA in PCa cell lines and clinical PCa tissues were detected by qRT-PCR analysis according to the protocol of our previous studies [18-19]. The sequences of all the primers used in this study were as following: YTHDC2 (F:TGCCTTTGCTCAGGTCTTTC,R:CCAGCCATTTGATGCTTTAC); GAPDH (F:TGACTTCAACAGCGACACCCA, R:CACCCTGTTGCTGTAGCCAAA).
Cell viability assay
Cell proliferation rates were assessed by Cell Counting Kit 8 assay according to the supplier’ s instructions. The effects of YTHDC2 on prostate cancer cell proliferation were measured by CCK-8 assay. The cells were plated in 96-well culture plates at a density of 1 × 104 cells/well and were counted at 1d, 2d,3d,4d and 5d after transfection.
Cell invasion and migration assays
For cell migration assay, 1 × 105 prostate cancer cells in 100 µL serum-free medium were added in the upper Transwell chamber (8.0-µm pore size; BD, San Jose, CA, USA). The upper chamber was coated with Matrigel for the invasion assay. The 10% fetal bovine serum was added to the bottom chambers. The cells were allowed to migrate or invade for 24h, respectively. And, the cells were allowed to migrate or invade for 24h, respectively. The migrating or invading cells at the lower surface were fixed with methanol and stained with 1% crystal violet. Cells were counted, and images were acquired using a Nikon TI-S microscope (Nikon, Japan) at magnification 10×.
Statistical analysis
The SPSS software version 17.0 for Windows (SPSS Inc., Chicago, IL, USA) and R software version: 4.1.0 were used for statistical analysis. All experiments were repeated thrice, and data were expressed as mean ±SD. Statistical analysis was performed independently by two biostatisticians with Fisher’s exact test for any 2×2 tables and Pearson χ2 test for non-2×2 tables. Kaplan-Meier method was used for the survival analysis. A probability level of P<0.05 was considered significant.