3.1 Morphological identification
The Pleurotus ostreatus was identified based on the various morphological characters such as mycelium growth, height of fruiting body, stipe length, stipe diameter, pileus diameter, microscopic view of mushroom spore and spore print.
3.2 Growth and pure culture of mushroom
Potato dextrose agar (PDA) medium was poured in sterilized Petri plate and inoculated with 10 mm disc of Pleurotus ostreatus under aseptic condition. Then, the Petri plate were incubated at 25 ± 2°C. The diameter of colony was measured after 6 days of growth. sub culturing was done on PDA slants as and when needed.
3.3 Microscopic view of mushroom spore
Mushroom spore studied by observing cotton blue stained slides under compound light microscope by using 40x objective and 10x eyepiece lenses. After calibrating the microscope, the measurement of spore was taken with the help of microscopic measuring slide [4].
3.4 Spore print
While a single mushroom spore can’t be seen by the naked eye, a pile of many spores and color of a mushroom’s spores is an easily identify by obtaining a mushroom’s “spore print”.
To make a spore print first remove the stem from smaller mushroom and place the cap, gills or pores downward, on a piece of paper or glass. For white color oyster mushroom using a black paper while white paper used for pink oyster mushroom. In case of large mushroom, slices off a section of the cap and use only the section. Place a cup or glass upside-down on top of mushroom, to keep in air tight condition. After overnight, when remove the cap and lift the mushroom cap, we got a print like the ones illustrated to the left [5].
3.5 Molecular identification
Mushroom species was identified based on molecular method. In molecular method, genome sequencing, was done for ITS region. For genome sequencing the pure culture of Pleurotus sp. was sent to Eurofins Genomics India Pvt. Ltd., Bangalore. The fungal genomic DNA was extracted from mycelia grown in 250 ml of PDB at 28°C for 5 days. The mycelia were harvested from broth and lyophilised and stored at -20°C for further process.
3.6 DNA extraction
The genomic DNA for PCR was extracted by using DNA isolation kit. The ITS region of fungi, including ITS1 (5’TCCGTAGGTGAACCTGCGG3') and ITS4 (5’TCCTCCGCTTTATTGATATG3') were amplified. The amplification was performed in 30 µl reaction volume with 0.1 mM of each dNTP and 100pmol of both forward and reverse primer. ABI Veriti pcr was programmed for initial denaturation at 94°C for 4 min, and 35 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min. The amplification was completed with a final extension at 72°C for 5 min. Further it was sequenced by ABI 3730 capillary sequencing [6].
3.7 Sequencing
Consensus sequence of the PCR amplicon was generated from forward and reverse sequence data using aligner software. 6. The ITS region sequence was used to carry out BLAST with the database of NCBI GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Based on maximum identity score first ten sequences were selected and aligned using multiple alignment software program Cluster W. Distance matrix was generated and the phylogenetic tree was constructed using MEGA X [6].